Application of a compact editing tool EbCas12a in gene editing
By using the compact CRISPR protein EbCas12a for gene editing, the existing Cas12a system has been solved, and more efficient gene editing tools are achieved, suitable for basic scientific research and clinical treatment.
Patent Information
- Application Number
- CN202211369291.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-03
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2042-11-03
AI Technical Summary
The existing Cas12a system has problems such as large size, complex PAM recognition and high off-target rate in gene editing, which limits its application and efficiency in gene editing.
The compact CRISPR protein EbCas12a from the Erysipelotrichia bacteria strain was used to identify the PAM sequence as TTTV, and the C-terminal NLS sequence and 3HA tag were added to eukaryotic cells for in vitro and in vivo gene editing.
It has realized a smaller and more efficient gene editing tool, expanded the target range of gene editing, and reduced off-target rate, and provided better gene site-directed insertion and repair tools, suitable for basic scientific research and clinical treatment.
Smart Images

Figure CN115786305B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and specifically relates to an application of a class II, type V CRISPR protein Cas12a (EbCas12a) from Erysipelotrichia bacterium in gene editing. Background Art
[0002] Since 2013, gene editing technology has made breakthroughs, bringing new changes to many fields, including basic scientific research, medicine, clinical practice, and biotechnology. In addition to the representative Cas9 system, Cas12, also known as Cpf1, is another newly discovered member of the CRISPR system with gene editing effects. It has greatly expanded the editable range of gene editing system targets. Compared with the Cas9 system, Cas12a's function of processing precursor RNA provides it with more convenient and efficient editing capabilities for mediating multi-gene editing. In addition, compared with the guide RNA of Cas9, the guide RNA of Cas12a is simpler in composition and more convenient to design.
[0003] In 2015, Zhang Feng's team first discovered a new gene-editing member of the CRISPR system, Cas12a, also known as Cpf1, which they classified as a Class 2, Type V CRISPR system. Compared to the Cas9 system, Cas12a's editing efficiency is comparable to that of Cas9, and lower at some targets. Cas12a also has a very low off-target rate, making it a safe gene editing tool compared to the high off-target rate of Cas9. Cas12a forms sticky ends after cleavage, while Cas9 forms blunt ends. Studies have shown that the sticky ends of Cas12a cleavage are more susceptible to homologous recombination repair than the blunt ends of Cas9, providing a better tool for site-specific gene insertion and repair. Cas12a has a clear advantage in processing guide RNAs. Cas12a alone can process the precursor RNA, while the Cas9 system requires RNase III for processing. This has greatly facilitated the application of Cas12a in multi-gene editing. In terms of PAM recognition, Cas12a recognizes 5'-TTTN-3' or 5'-KYTV-3', while Cas9 recognizes 5'-NGG-3'.
[0004] Therefore, as a new gene editing tool, Cas12a, together with the Cas9 system, provides a powerful tool for scientific research and disease treatment. Based on the existing research on Cas12a, it is of great significance to discover a smaller and more compact Cas12a system to cope with gene editing events in various situations in the future. Summary of the Invention
[0005] The purpose of the present invention is to provide an application of a compact Cas12a editing tool EbCas12a in gene editing in response to the deficiencies in the prior art.
[0006] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:
[0007] A class II type V CRISPR protein EbCas12a from Erysipelotrichia bacterium, whose amino acid sequence is shown in SED ID NO. 1 or 2. Among them, the sequence shown in SED ID NO. 2 is the sequence used by EbCas12a in eukaryotic cells.
[0008] The PAM sequence recognized by the above-mentioned EbCas12a is mainly TTTV, and it can also weakly recognize TCTA, TTCA or CTTA, where the V represents A, C, or G.
[0009] The above-mentioned EbCas12a has the ability to cut DNA and can perform gene editing on in vitro DNA and in vivo genomes at a specific site.
[0010] The above-mentioned application of EbCas12a in gene editing. The gene editing includes in vitro gene editing, prokaryotic gene editing, and eukaryotic gene editing. In prokaryotic gene editing, the amino acid sequence of EbCas12a is shown in SED ID NO.1; in eukaryotic gene editing, the amino acid sequence of EbCas12a is shown in SED ID NO.2.
[0011] The amino acid sequence of the protein EbCas12a of the present invention is as follows:
[0012] The protein sequence of EbCas12a itself (SEQ ID NO.1):
[0013]
[0014] Sequence used by EbCas12a in eukaryotic cells (SEQ ID NO.2):
[0015] KRPAATKKAGQAKKKK GS YPYDVPDYAYPYDVPDYAYPYDVPDYA .
[0016] The sequence used in eukaryotic cells adds the KRPAATKKAGQAKKKK sequence (this sequence is the C-terminal NLS nuclear entry sequence) to the C-terminus of the EbCas12a protein amino acid sequence, and then connects the YPYDVPDYAYPYDVPDYAYPY DVPDYA sequence (this sequence is the 3HA sequence) with the GS sequence.
[0017] Beneficial effects of the present invention: The present invention has identified for the first time a smaller Class II, Type V CRISPR protein EbCas12a (1158AA) with gene editing effects in Erysipelotrichia bacterium strains, which is smaller than all currently reported Cas12a with gene editing functions; the EbCas12a is capable of site-directed gene editing of in vitro DNA and eukaryotic genomes under the mediation of crRNA. The discovery of EbCas12a further expands the types of gene editing tools, and also provides an important alternative tool for subsequent gene editing in various different situations, which plays a very important role in basic scientific research and clinical treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Illustration of the CRISPR array and crRNA direct repeat of the Erysipelotrichia bacterium strain.
[0019] Figure 2 This is an in vitro cleavage experiment after prokaryotic expression of EbCas12a. S represents substrate; P represents product.
[0020] Figure 3 Verify the PAM of EbCas12a for in vitro experiments.
[0021] Figure 4 To validate EbCas12a gene editing in vivo. DETAILED DESCRIPTION
[0022] In order to better understand the present invention, the content of the present invention is further illustrated below in conjunction with the examples, but the content of the present invention is not limited to the following examples.
[0023] Example 1
[0024] The EbCas12a in vitro cleavage experiments with different time gradients and different PAMs included the following experimental steps:
[0025] (1) Expression and purification of EbCas12a protein: The EbCas12a gene sequence (as shown below) was synthesized into the pet28a expression vector (with NcoI and XhoI enzyme cleavage sites) with a 6His tag at the C-terminus. The synthesized plasmid was then transformed into the E. coli Rosseta 2 (DE3) expression strain, and a single clone was picked. After a small amount of expression test to confirm protein expression, the protein was expressed and purified in large quantities. The recombinant protein was purified by Ni column affinity chromatography, heparin column chromatography, and superdex 200 molecular sieve, and then stored in buffer (10mM Tris-HCl, 200mM NaCl, 1mM MgCl) and frozen at -80°C for use.
[0026] Gene sequence of EbCas12a (SEQ ID NO.3):
[0027]
[0028] (2) Using the crRNA direct repeat sequence of 5'-AATTTCTACTGTTGTAGAT-3', crRNA targeting the EGFP gene was obtained by in vitro transcription; the EbCas12a protein obtained in step (1) was mixed with crRNA in a molar ratio of 1:1 to obtain an EbCas12a-crRNA complex.
[0029] (3) Take 100nM EbCas12a-crRNA complex and 300ng linearized substrate (PAM is TTTA, the fragment is based on the ptriEx-EGFP plasmid (the EGFP gene is constructed with the ptriEx vector as the backbone) as a template, design upstream and downstream primers for PCR, and amplify the substrate fragment with a length of 1.1kb. There is a PAM sequence of TTTA and a spacer target sequence of CGTCGCCGTCCAGCTCGACCAGG on the fragment. The Cas12a-crRNA binary complex can recognize this target and cut the 1.1kb substrate into products of 0.4kb and 0.7kb in length respectively.) Mix well, incubate at 37°C for 0, 2.5, 5, 8, 10, and 15 minutes respectively, add appropriate amount of proteinase K, digest at 58°C for 60 minutes, and run on 2% agarose gel. In addition, select some different PAMs (PAM sequences are shown in Figure 2 , the substrate is the same as above, only the four bases at the PAM are different) and the above cleavage experiments are performed separately. The results are as follows Figure 2 As shown, EbCas12a has good cleavage ability in vitro.
[0030] Example 2
[0031] Determination of PAM recognition by EbCas12a
[0032] (1) Upstream and downstream primers with random combinations of the four positions NNNN (N represents A, G, C, and T) were designed, and PCR was performed using the overlap PCR method using the ptriEx-EGFP plasmid as a template to obtain 256 300-bp linearized substrates with different PAM sequences but the same spacer sequence.
[0033] (2) 100 nM of the EbCas12a-crRNA complex in Example 1 was mixed with 300 ng of the linearized substrate, and the mixture was incubated at 37 ° C for 10 min. The uncut substrate was amplified by PCR for next-generation sequencing. The results were as follows: Figure 3 As shown, EbCas12a can recognize different PAMs: TTTV, TCTA, TTCA, CTTA, but the optimal PAM is TTTV (V represents A, C or G).
[0034] Example 3
[0035] EbCas12a editing of different genes in mammalian cells:
[0036] (1) Construction of EbCas12a eukaryotic expression plasmid: The EbCas12a gene sequence used in eukaryotic cells was constructed into the eukaryotic expression plasmid pcDNA3.1. The EbCas12a gene sequence used in eukaryotic cells is as follows (SEQ ID NO.4):
[0037]
[0038]
[0039] Standard The sequence is the C-terminal nuclear entry sequence NLS, The sequence is GS link, The sequence is 3HA tag.
[0040] (2) In mammalian cells, taking 293T cells as an example, seven gene targets, CLIC-4, VEGFA-2, PD1, DNMT1-4, TRAC, TRBC, and TAX1BP3, were selected. Seven U6-crRNA spacer eukaryotic expression plasmids (the vector backbone is pU6-As-crRNA, Addgene: #78956) were constructed with these seven genes as targets. The crRNA transcription sequences of the seven gene targets (including AATTTCTACTGTTGTAGAT for direct repeat) are as follows:
[0041] AATTTCTACTGTTGTAGAT CCCTGGCTACCTCCCCTACC (targeting CLIC-4),
[0042] AATTTCTACTGTTGTAGAT GGAGGTCAGAAATAGGGGGTCCA (targeting VEGFA-2),
[0043] AATTTCTACTGTTGTAGAT GCACGAAGCTCTCCGATGTGTTG (targeting PD1),
[0044] AATTTCTACTGTTGTAGAT GCTCAGCAGGCACCTGCCTCAGC (targeting DNMT1-4),
[0045] AATTTCTACTGTTGTAGATTTGCTCCAGGCCACAGCACTGTT (targeting TRAC),
[0046] AATTTCTACTGTTGTAGAT AGCCATCAGAAGCAGAGATCTCC (targeting TRBC),
[0047] AATTTCTACTGTTGTAGAT CACATAGGCCATTCAGAAAC (targeting TAX1BP3).
[0048] (3) Design surveyor primers near the cleavage target sites of these seven genes and verify the specificity of the PCR primers.
[0049] (4) Digest 293T cells and plate them in a 24-well plate at an appropriate concentration, with 500 μL per well.
[0050] (5) EbCas12a eukaryotic expression plasmid (700 ng) and U6-crRNA spacer eukaryotic expression plasmid (300 ng) were co-transfected into a 24-well plate. After 48 h, the cells were lysed, 1 μL of the lysate was used as a template, and PCR was performed using the surveyor primer designed in step (3), and the PCR product was purified.
[0051] (6) Take 300 ng of PCR product and mix it with 1 μL 10×T7EI buffer. According to the following PCR program, anneal at 95℃ for 10 min, 95℃ to 85℃-2℃ for 2s, 85℃ to 25℃-0.25℃ for 2s, and 25℃ for 1 min. After annealing, add 1 μL T7EI to the product, digest it at 37℃ for 20 min, and run it on 2% agarose gel. The results are as follows: Figure 4 As shown, CLIC-4, VEGFA-2, PD1, DNMT1-4, TRAC, TRBC, and TAX1BP3 can be gene edited, with editing efficiencies of 9%, 17%, 32%, 16%, 8%, 7%, and 6%, respectively (the seven genes in this example are listed only as representatives).
Claims
1. A use of a class II, type V CRISPR protein EbCas12a in gene editing for non-disease diagnosis or treatment, characterized in that: The amino acid sequence of the EbCas12a is shown in SEQ ID NO. 1 or 2; the gene editing is in vitro gene editing or eukaryotic gene editing.
2. The use according to claim 1, characterized in that: The PAM sequences recognized by EbCas12a are TTTV, TCTA, TTCA, or CTTA, where V represents A, C, or G.
3. The use according to claim 1, wherein: In in vitro gene editing, the amino acid sequence of EbCas12a is shown in SED ID NO.
1.
4. The use according to claim 1, wherein: In eukaryotic gene editing, the amino acid sequence of EbCas12a is shown in SED ID NO. 2.