D-psicose 3-epimerase with improved thermal stability and mutants
By performing site-directed mutation of D-psicose 3-episomerase, especially A13S/V235I mutation, the problem of poor thermal stability of enzymes at high temperatures is solved, higher enzyme activity and wider application temperature are achieved, and the efficiency and environmental protection of converting D-fructose into D-psicose are improved.
Patent Information
- Application Number
- CN202211704773.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-29
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2042-12-29
AI Technical Summary
The existing D-psicose 3-episomerase has poor thermal stability at high temperatures, resulting in rapid inactivation in industrial production, increasing the cost and difficulty of use.
By performing site-directed mutations on D-psicose 3-episomerase, especially superposition mutations at positions 13 and 235, the mutant A13S/V235I is formed, improving its thermal stability.
Mutant enzymes have longer half-life and higher enzyme activity at 70°C, which expands the application temperature range of enzymes, improves the efficiency and substrate affinity of D-fructose to D-psicose, reduces the three waste problems of chemical synthesis, and has important industrial application prospects.
Smart Images

Figure CN115786319B_ABST
Abstract
Description
(1) Technical Field
[0001] The present invention relates to a D - psicose 3 - epimerase with high thermal stability, its mutants, and the encoding genes, as well as their application in the microbial - catalyzed isomerization of D - psicose to prepare a mixture of D - fructose and D - psicose, belonging to the technical field of enzyme engineering. (2) Background Art
[0002] D - Psicose is a hexulose with health - care functions. The sweetness of D - psicose is about 70% of that of sucrose, but its energy value is only 10% of that of sucrose. It has high solubility and low blood - glucose response, and it is hardly absorbed in the digestive tract, making it an ideal sucrose substitute. In addition, recent studies have shown that D - psicose also has many physiological functions, including neuroprotective effects, enhanced insulin tolerance, antioxidant activity, reducing blood glucose and lipids to prevent diabetes, maintaining normal blood - lipid levels, and avoiding the metabolic burden caused by traditional sweeteners to the human body, thus having important application value. Therefore, developing natural, healthy, and rare sugars to replace existing sweeteners has become a research hotspot.
[0003] The chemical synthesis method of D - psicose has common drawbacks that are difficult to overcome, such as difficult separation, many by - products, serious pollution caused by chemical waste generation, and complex and uncontrollable steps. The bio - enzyme method is a process that uses one or several special extracellular or intracellular enzymes produced by microorganisms as biocatalysts to convert substrates into products. The bio - enzyme method has high regioselectivity and stereoselectivity, usually obtaining the target product in a single - step reaction, with mild reaction conditions, high activity, low dosage, no need for toxic reagents, and good environmental compatibility. D - Psicose 3 - epimerase has been found to use the sole substrate D - fructose as a raw material and directly generate D - psicose through a C - 3 epimerization reaction in one step, and it is currently the most promising enzyme for the industrial production of D - psicose. This technology is green and environmentally friendly, with simple steps and strong industrialization prospects. Currently, using isomerase or cells containing this enzyme as biocatalysts for isomerization reactions to prepare various sugar compounds has become an important economic growth point in the sugar industry.
[0004] D - allulose 3 - epimerase (DAE) can achieve the interconversion between D - fructose and D - allulose. It was initially discovered by the Izumori team at Kagawa University in Japan in Pseudomonas cichorii ST - 24 in 1993. The relevant research in China started relatively late, and currently, the industrialization level of DAE is low. Industrially, enzymatic conversion is generally carried out at relatively high temperatures (50 - 60 °C), and most enzymes have good thermal stability under conditions below 50 °C. However, at present, most DAE has poor thermal stability and rapidly inactivates when the temperature is higher than 50 °C, which is not conducive to application and also increases the use cost of DAE to a certain extent.
[0005] To meet the needs of industrial applications, research on improving the thermal stability of D - allulose 3 - epimerase with different properties has been carried out based on protein engineering technology. With the development of bioinformatics and computational biology, computer - aided molecular modification of enzyme thermal stability is of great significance for meeting the growing demand for sugar intake of the people. (III) Summary of the Invention
[0006] The object of the present invention is to provide a D - allulose 3 - epimerase with high thermal stability, its mutant A13S / V235I, and the encoding gene, so as to solve the technical problem of poor thermal stability of D - allulose 3 - epimerase in industrial production.
[0007] The technical solution adopted by the present invention is as follows:
[0008] A D - allulose 3 - epimerase, whose amino acid sequence is as shown in SEQ ID NO.2.
[0009] The present invention also relates to a mutant of D - allulose 3 - epimerase, which is obtained by site - directed mutagenesis of the amino acid shown in SEQ ID NO.2, and the site - directed mutation sites are superimposed mutations at the 13th and 235th positions.
[0010] Preferably, the amino acid sequence of the mutant is as shown in SEQ ID NO.4.
[0011] Due to the particularity of the amino acid sequence, any variant of the polypeptide with the amino acid sequence shown in SEQ ID NO.4, such as its conservative variant, bioactive fragment or derivative, as long as the fragment or polypeptide variant of the polypeptide has a homology of more than 95% with the aforementioned amino acid sequence, belongs to the scope of protection of the present invention. The changes may include deletion, insertion or substitution of amino acids in the amino acid sequence; for conservative changes of the variant, the substituted amino acid has a structure or chemical property similar to the original amino acid, such as replacing isoleucine with leucine, and the variant may also have non-conservative changes, such as replacing glycine with tryptophan.
[0012] The present invention also relates to genes encoding the D-psicose 3-epimerase and its mutants.
[0013] Preferably, the nucleotide sequence of the encoding gene is as shown in SEQ ID NO.3.
[0014] Due to the particularity of the nucleotide sequence, any variant of the polynucleotide shown in SEQ ID NO.3, as long as it has a homology of more than 95% with the polynucleotide, belongs to the scope of protection of the present invention. The variant of the polynucleotide refers to a polynucleotide sequence with one or more nucleotide changes. Such variants of the polynucleotide can be native allelic variants or non-native variants, including substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of encoding amino acids.
[0015] The present invention also relates to recombinant vectors and recombinant genetically engineered bacteria containing the encoding gene.
[0016] The present invention also relates to the application of the D-psicose 3-epimerase and its mutants in the microbial catalysis of D-fructose isomerization to prepare D-psicose. A recombinant vector containing the D-psicose 3-epimerase gene is constructed, the recombinant vector is transformed into Escherichia coli, the obtained recombinant genetically engineered bacteria are induced to culture, and the culture solution is separated to obtain cell bodies containing D-psicose 3-epimerase, which can be used as an enzyme source for microbial catalysis of D-fructose isomerization to prepare D-psicose.
[0017] Specifically, the application is as follows: using the wet cell bodies obtained by fermentation culture of genetically engineered bacteria containing the encoding gene of D-psicose 3-epimerase or mutant as the enzyme source, using D-fructose as the substrate, using manganese ions as the co-catalyst, using a buffer solution with pH 6.5 as the reaction medium, reacting under the conditions of 50-80 °C and 100-200 r / min, and after the reaction is complete, obtaining a mixture of D-fructose and D-psicose.
[0018] Preferably, in the reaction system, the initial concentration of the substrate is 50 - 500 g / L, preferably 100 g / L; the dosage of the wet bacterial cells is 10 - 150 g / L, preferably 25 g / L; and the final concentration of manganese ions is 0.1 - 10 mM, preferably 1 mM.
[0019] The wet bacterial cells are prepared as follows: The recombinant genetic engineering bacteria containing the D - psicose 3 - epimerase or its mutant gene are inoculated into an LB liquid medium containing kanamycin with a final concentration of 50 μg / mL, and cultured at 37°C and 200 r / min until OD 600 = 0.8 - 1.0 to obtain a seed solution; the seed solution is transferred into an LB liquid medium containing kanamycin with a final concentration of 50 μg / mL at an inoculation amount of 1 - 5% (v / v), and cultured at 37°C and 180 r / min until OD 600 = 0.6 - 0.8, IPTG with a final concentration of 0.1 mM is added, and the culture is induced at 28°C and 180 r / min for 12 - 14 h to obtain an induced culture bacterial suspension, and the induced culture bacterial suspension is centrifuged to collect the wet bacterial cells.
[0020] The screening, expression and enzyme activity determination method of the D - psicose 3 - epimerase mutant of the present invention is as follows:
[0021] (1) Screening of recombinant bacteria: The recombinant expression plasmid pET - 28a - CbDAE carries a kanamycin resistance gene. If the recombinant plasmid has been transformed into Escherichia coli, the recombinant strain has kanamycin resistance and can grow on a plate containing 50 μg / mL kanamycin; pick the positive transformant, which is the D - psicose 3 - epimerase recombinant bacteria BL21(DE3) / pET - 28a - CbDAE.
[0022] (2) Construction of the D - psicose 3 - epimerase mutant expression strain
[0023] Using the core catalytic region of A. tumefaciens DAE (AtDAE, GenBank accession number AAK88700.1) with reported high catalytic activity as a probe, three unstudied potential DAE strains were obtained from the NCBI database. Among them, the DAE derived from Christensenellaceae bacterium was selected for further study. The nucleotide sequence of CbDAE is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. Using the plasmid of recombinant bacterium BL21(DE3) / pET-28a-CbDAE as a template, two rounds of mutant PCR were carried out continuously. The alanine at the 13th position was mutated to serine, and the valine at the 235th position was mutated to isoleucine. After digestion of the mutant plasmid with Dpn I, it was transferred into Escherichia coli. The recombinant strain was resistant to kanamycin and could grow on the plate containing 50 μg / mL kanamycin. Positive transformants were picked for sequencing, and the sequence showed that the 13th and 235th sites were successfully mutated, namely the D-allulose 3-epimerase mutant bacterium BL21(DE3) / pET-28a-CbDAE / A13S / V235I.
[0024] (3) The recombinant mutant bacterium was cultured to express D-allulose 3-epimerase
[0025] The composition of LB liquid medium (g / L): tryptone 10, yeast extract 5, NaCl 10, the solvent is ultrapure water, pH 7.0; LB solid medium is added with 20 g / L agar; autoclaved; add kanamycin with a final concentration of 50 μg / mL before use.
[0026] The D-allulose 3-epimerase mutant bacterium was inoculated into LB liquid medium with a final concentration of 50 μg / mL kanamycin in a test tube with a liquid loading of 10 mL, cultured at a temperature of 37 °C and a shaker speed of 200 r / min until OD 600 = 0.8 - 1.0 to obtain a seed solution; the seed solution was transferred into a 500 mL conical flask containing 100 mL of LB liquid medium with a final concentration of 50 μg / mL kanamycin at an inoculation amount of 1% by volume, and cultured at 37 °C and 180 r / min for 2 - 3 h (OD 600 = 0.6 - 0.8), add IPTG with a final concentration of 0.1 mM, and then induce culture at 28 °C and 180 r / min for 12 h to obtain an induced culture bacterial suspension. Take the induced culture solution, centrifuge at 4 °C, 8000 r / min for 10 min, and then freeze at -20 °C in the refrigerator for standby. The SDS-PAGE results of the soluble expression of the obtained bacterial cells are shown in Figure 1 .
[0027] (4) Determination of D-allulose 3-epimerase enzyme activity and yield
[0028] Dissolve 0.25 g of the bacterial cells in 10 mL of 50 mM sodium phosphate buffer solution (pH 6.5), mix well to suspend the bacterial cells, and add Mn with a final concentration of 1 mM 2+ , D-fructose with a final concentration of 100 g / L. Sampling is carried out at 10 min and 3 h of reaction under the conditions of 70 °C and 600 rpm. The reaction is terminated by ice bath for 10 min, centrifuged at 12,000 r / min for 1 min, and the supernatant is diluted 10 times;
[0029] HPLC detection conditions: Agilent 1260 HPLC chromatograph, Agilent autosampler, sugar-park chromatographic column, Agilent differential refractometer detector. The mobile phase is ultrapure water, the column temperature is set at 70 °C, the flow rate is 0.4 mL / min, and the external standard method is used. The yield of D-allulose is determined according to the retention time and peak area of the peak. Enzyme activity definition: At 70 °C and pH 6.5, the amount of enzyme required to isomerize D-fructose to produce 1 μmol of D-allulose per minute is defined as one enzyme activity unit (U). The yield (%) is defined as the ratio of the D-allulose concentration to the initial D-fructose concentration when sampling at 3 h of reaction.
[0030] Both the D-allulose 3-epimerase and the mutant described in the present invention can tolerate high temperatures of 40-70 °C. When the substrate concentration is 100 g / L and the reaction temperature is 70 °C, the enzyme activity of the wild-type D-allulose 3-epimerase reaches 223.5 U / (g·wet cell weight), and the conversion rate reaches 29.2%; the enzyme activity of the D-allulose 3-epimerase mutant reaches 363.8 U / (g·wet cell weight), and the conversion rate reaches 33.2%.
[0031] The beneficial effects of the present invention are mainly reflected in: A high-temperature-tolerant D-allulose 3-epimerase and its mutant are screened in the present invention, the half-life of the mutant enzyme is enhanced, the substrate affinity and conversion efficiency of the enzyme for D-fructose, the substrate for synthesizing D-allulose, are improved, and the t of the stacked mutant enzyme A13S / V235I at 70 °C 1 / 2 value is 420 min, and the T m value rises from 55.1 °C of the wild enzyme to 65.1 °C. The optimum temperature of the stacked mutant enzyme A13S / V235I rises to 70 °C, which is more than 10 °C higher than that of the wild enzyme; the present invention improves the problem of too short half-life of the wild enzyme at high temperature through mutation. The mutant enzyme has a relatively long action time, expands the relatively rare enzyme library, demonstrates the technical advantages of D-fructose in synthesizing D-allulose 3-epimerase, such as green environmental protection, low toxicity and few by-products, overcomes the problem of easy generation of three wastes in chemical synthesis methods, and has important industrial application prospects. (4) Description of the Drawings
[0032] Figure 1 Electrophoresis diagrams of wild-type enzymes CbDAE, CbDAE / A13S, CbDAE / V235I, CbDAE / G148M, and CbDAE / A13S / V235I; (Lane 1: Marker, Lane 2: wild-type enzyme CbDAE, Lane 3: CbDAE / A13S, Lane 4: CbDAE / V235I, Lane 5: CbDAE / A13S, Lane 6: CbDAE / A13S / V235I;)
[0033] Figure 2 High-performance liquid chromatography detection diagram for the reaction of catalyzing the conversion of D-fructose to D-psicose;
[0034] Figure 3 Comparison diagram of the half-life of the original enzyme CbDAE and the mutant enzyme CbDAE / A13S / V235I.
[0035] Figure 4 Optimal reaction temperature of the original enzyme CbDAE and the mutant enzyme CbDAE / A13S / V235I.
[0036] Figure 5 For the original enzyme CbDAE and the pure mutant enzyme T m Diagram. (5) Specific Embodiments
[0037] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:
[0038] Example 1: Construction of single-site mutants of D-psicose 3-epimerase
[0039] According to the gene sequence of the original enzyme CbDAE derived from Christensenellaceae bacterium (amino acid sequence is SEQ ID NO.2, nucleotide sequence is SEQ ID NO.1), site-directed mutagenesis primers were designed. Using the rapid PCR technique, with the recombinant vector pET28a / CbDAE as the template, single mutations were introduced at positions 13, 148, and 235 respectively. The designed primers are:
[0040] Forward primer A13S: CCTACTGGGAACAG AGC TGGGCCGCCGACTA (underlined is the mutated base)
[0041] Reverse primer A13S: ACAGGTAGTCGGCGGCCCA GCT CTGTTCC (underlined is the mutated base)
[0042] Forward primer G148M:
[0043] TGATCTG ATG ATGGAGATTCTGAATCGTTTTGAA (Underlined is the mutated base)
[0044] Reverse primer G148M: TCTCCAT CAT CAGATCAATCCCATAATCTGCGG (Underlined is the mutated base)
[0045] Forward primer V235I: GAAAGAA ATT GGTTACGATGGCCGTGTGATCA (Underlined is the mutated base)
[0046] Reverse primer V235I:
[0047] GGCCATCGTAACC AAT TTCTTTCAGTGCTTCACCAAT (Underlined is the mutated base)
[0048] The PCR reaction system (50 μL) is as follows: 2×Phanta Max Buffer 25 μL, dNTPs 1 μL, forward primer 2 μL (5 pmol / μL), reverse primer 2 μL (5 pmol / μL), template DNA 1 μL (20 ng / μL), Phanta Max Super-Fidelity DNA Polymerase 1 μL, add ddH2O to 50 μL.
[0049] The PCR reaction program is pre-denaturation at 95°C for 5 min; 30 cycles (denaturation at 95°C for 10 s, annealing at 55 - 60°C for 15 s, extension at 72°C for 5.5 min); extension at 72°C for 10 min, and finally incubation at 16°C. The PCR products are verified by 0.9% agarose gel electrophoresis. If a gene fragment of the same size as the target vector is amplified, the next experiment can be carried out.
[0050] After the PCR product was digested with Dpn I at 37 °C for 3 h to remove the template, 3 μL of the PCR product was added to 100 μL of ice-bathed E. coli BL21(DE3) competent cell suspension. It was allowed to stand on ice for 30 min, and the transformation product was heat-shocked at 42 °C for 90 s and then quickly cooled on ice for 5 min. 600 μL of LB liquid medium was added to the tube, and the mixture was cultured at 37 °C and 150 r / min for 50 min. Then, it was centrifuged at 12,000 r / min for 1 min, and 400 μL of the supernatant was discarded and the bacterial suspension was resuspended. 200 μL of the above resuspended solution was spread on an LB solid medium plate containing kanamycin at a final concentration of 50 μg / mL. After the bacterial suspension was completely absorbed by the medium, it was cultured upside down at 37 °C for 12 h. Colonies were picked and inoculated into 10 mL of LB liquid medium containing kanamycin at a final concentration of 50 μg / mL, and cultured at 37 °C for 12 h to obtain their respective bacterial suspensions. The bacterial suspensions were sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing, and the sequencing results were correctly aligned, which were the single-site mutant recombinant bacteria E. coli BL21(DE3) / pET28a / CbDAE / A13S, E. coli BL21(DE3) / pET28a / CbDAE / G148M, and E. coli BL21(DE3) / pET28a / CbDAE / V235I.
[0051] Example 2: Construction of double-site mutants of D-allulose 3-epimerase
[0052] Using the recombinant vector pET28a / CbDAE / A13S in Example 1 as a template, a single mutation was introduced at the 235th position. Mutation primers for site-directed mutagenesis were designed according to the parental sequence: Forward primer V235I: GAAAGAA ATT GGTTACGATGGCCGTGTGATCA (underlined bases are mutated bases), Reverse primer V235I: GGCCATCGTAACC AAT TTCTTTCAGTGCTTCACCAAT (underlined bases are mutated bases). Site-directed mutagenesis was performed using the fast PCR technique.
[0053] The PCR reaction system (50 μL) was: 2×Phanta Max Buffer 25 μL, dNTPs 1 μL, forward primer 2 μL (5 pmol / μL), reverse primer 2 μL (5 pmol / μL), template DNA 1 μL (20 ng / μL), Phanta Max Super-Fidelity DNA Polymerase 1 μL, and ddH2O was added to 50 μL.
[0054] The PCR reaction procedure was pre-denaturation at 95°C for 5 min; 30 cycles (denaturation at 95°C for 10 s, annealing at 55 - 60°C for 15 s, extension at 72°C for 5.5 min); extension at 72°C for 10 min, and finally incubation at 16°C. The PCR products were verified by 0.9% agarose gel electrophoresis, and the gene fragments corresponding to the size of the target vector were amplified as a result.
[0055] After the PCR products were digested with Dpn I at 37°C for 3 h, 3 μL of the PCR products were taken and added to 100 μL of ice-bathed E. coli BL21(DE3) competent cell suspension. It was left standing on ice for 30 min, and the transformation products were heat-shocked at 42°C for 90 s and quickly cooled on ice for 5 min. 600 μL of LB liquid medium was added to the tube, and it was cultured at 37°C and 180 r / min for 50 min. Then it was centrifuged at 12000 r / min for 1 min, and 400 μL of the supernatant was discarded and the bacterial suspension was resuspended. 200 μL of the above resuspended solution was spread on an LB solid medium plate containing kanamycin at a final concentration of 50 μg / mL. After the bacterial suspension was completely absorbed by the medium, it was cultured inverted at 37°C for 12 h. Colonies were picked and inoculated into 10 mL of LB liquid medium containing kanamycin at a final concentration of 50 μg / mL, and cultured at 37°C for 12 h to obtain respective bacterial suspensions. The bacterial suspensions were sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing, and the sequencing results were correctly aligned, which was the double-site mutant recombinant bacterium E. coli BL21(DE3) / pET28a / CbDAE / A13S / V235I.
[0056] Example 3: Expression of recombinant Escherichia coli
[0057] The D-allulose 3-epimerase CbDAE / A13S / V235I strain in Example 2 was inoculated into 10 mL of LB liquid medium (containing kanamycin at a final concentration of 50 μg / mL), and cultured at 37°C and 200 r / min until OD 600 = 0.8 - 1.0 to obtain a seed solution; the seed solution was transferred into 100 mL of fresh LB liquid medium containing kanamycin at a final concentration of 50 μg / mL at an inoculation amount of 1% (v / v), and cultured at 37°C and 180 r / min until the cell concentration OD 600 = 0.6 - 0.8, and IPTG at a final concentration of 0.1 mM was added, and then induced to culture at 28°C and 180 r / min for 12 h.
[0058] After 12 h of induction culture, 1 g of the cell precipitate was suspended in 10 mL of 50 mM sodium phosphate buffer (pH 6.5), sonicated (sonication for 2 s, pause for 2 s, 30 min), centrifuged, and then purified using a nickel-NTA affinity chromatography column (Bio-Scale MiniProfinity IMAC pre-packed column, 40 mm long × 12.6 mm inner diameter). After purification, it was dialyzed overnight in sodium phosphate buffer (pH 6.5). 15 μL of the dialysate was taken, mixed with 5 μL of 4×SDS buffer, heated in a boiling water bath for 15 min, and 5 μL was taken for SDS-PAGE electrophoresis analysis. Using CbDAE as a control, a protein band with the same molecular weight of approximately 33 kDa was obtained.
[0059] Example 4: Enzyme Activity Assay of D-psicose 3-epimerase and Its Mutants
[0060] The wild-type D-psicose 3-epimerase CbDAE, the single-site mutants of D-psicose 3-epimerase CbDAE / A13S, CbDAE / G148M, CbDAE / V235I in Example 1, and the double-site mutant of D-psicose 3-epimerase CbDAE / A13S / V235I in Example 2 were induced to express according to the method in Example 3, and the enzyme activities of the recombinant bacteria and mutant bacteria against D-fructose were measured simultaneously.
[0061] The method for enzyme activity assay was as follows: 0.25 g of the cells collected in Example 3 was dissolved in 10 mL of 50 mM sodium phosphate buffer solution (pH 6.5), and the cells were fully mixed and suspended. Mn with a final concentration of 1 mM was added, 2+ D-fructose with a final concentration of 100 g / L. 1 mL of the sample was taken after reacting for 10 min at 70 °C and 600 rpm, and the reaction was terminated by placing it on ice for 10 min. After centrifuging at 12000 r / min for 1 min, the supernatant was taken, diluted 10 times, filtered through a 0.22 μm water membrane, and the concentrations of D-fructose and D-psicose were detected using an HPLC liquid chromatograph.
[0062] HPLC detection conditions: Agilent 1260 HPLC chromatograph, Agilent autosampler, sugar-park chromatographic column, Agilent differential refractometer detector. The mobile phase was ultrapure water, the column temperature was set at 70 °C, the flow rate was 0.4 mL / min, and the external standard method was used. The yield of D-psicose was determined according to the retention time and peak area of the peaks. The HPLC spectra of the standard samples of D-fructose and D-psicose and their mixed standard samples are shown in Figure 2 as follows.
[0063] Definition of enzyme activity unit: The amount of enzyme required to isomerize 1 μmol of D-fructose to D-psicose per minute at 70 °C and pH 6.5 is defined as one enzyme activity unit (U). The specific enzyme activity of D-psicose 3-epimerase is expressed as the number of enzyme activity units per g of wet cell weight (U / g·wet cell weight), and the results are shown in Table 1. The activity of the double-site mutant recombinant bacterium CbDAE / A13S / V235I of D-psicose 3-epimerase is 1.62 times that of the wild-type D-psicose 3-epimerase, reaching 363.8 U / (g·wet cell weight).
[0064] Table 1: Enzyme activities of D-psicose 3-epimerase and its mutants
[0065]
[0066]
[0067] Example 5: Determination of kinetic constants of D-psicose 3-epimerase and its mutants
[0068] Purification of recombinant enzymes and mutant enzymes: The wild-type D-psicose 3-epimerase CbDAE and the double-site mutant D-psicose 3-epimerase CbDAE / A13S / V235I in Example 2 were induced and expressed according to the method in Example 3. After 12 h of induction culture, the cells were collected by centrifugation at 8000 r / min for 10 min, the supernatant was discarded, and the cells were rinsed once with 50 mM sodium phosphate buffer (pH 6.5) and then collected under the same conditions. A certain amount of cells was taken and suspended in sodium phosphate buffer (pH 6.5) at a ratio of 100 g cells / L. The cells were sonicated and centrifuged at 8000 r / min for 10 min, and the supernatant was taken. The supernatant was the crude enzyme solution. The supernatant was purified by passing through a nickel-NTA affinity chromatography column (Bio-Scale Mini Profinity IMAC pre-packed column, 40 mm long × 12.6 mm inner diameter). First, the chromatography column was equilibrated with the equilibration buffer (50 mM pB buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0). The sample solution was loaded at a rate of 1 mL / min for 4 column volumes, and then the elution buffer (50 mM pB buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) was used for elution at a rate of 2 mL / min. According to the signal responses of the ultraviolet detector and the conductivity detector, the corresponding elution solution was collected when the signals of both the ultraviolet detector and the conductivity detector increased simultaneously, and the collection was stopped when the signal of the conductivity detector remained unchanged and the signal of the ultraviolet detector decreased, which was the pure enzyme solution. The protein concentrations of the obtained pure enzyme solutions were measured using a BCA kit, and the results were 3.02 mg / mL and 3.04 mg / mL, respectively. This purified enzyme was used to catalyze the substrates D-fructose and D-psicose to determine the kinetic constants.
[0069] The reaction system was as follows: The initial substrate concentrations of D-fructose and D-psicose were 20 - 600 mM, with manganese ions (1 mM) as the co-catalyst, and 50 mM sodium phosphate buffer (pH 6.5) as the reaction medium. After reacting at 70 °C and 600 r / min for 10 min, the reaction solution was separated and purified, and the kinetic constants were calculated by fitting the production amounts of D-fructose and D-psicose. The results are shown in Table 2. The results showed that the double-site mutation CbDAE / A13S / V235I improved the substrate affinity.
[0070] Table 2: Determination of enzyme kinetic parameters
[0071]
[0072] Example 6: Thermal stability determination of D-psicose 3-epimerase and its mutants
[0073] Purify the wild-type D-allulose 3-epimerase CbDAE and the double-site mutant D-allulose 3-epimerase CbDAE / A13S / V235I in accordance with the D-allulose 3-epimerase purification method in Example 5. The collected pure enzyme solution is used for catalyzing the isomerization reaction of the substrate D-fructose to prepare D-allulose. Reaction system: 50 mM pB buffer (pH 6.5), 100 g / L D-fructose and 0.03 mg / mL pure enzyme solution, with a total volume of 1 mL. Reaction conditions: Incubate in a water bath at 50 - 70 °C for 420 min. During this process, take an enzyme amount with a final concentration of 0.03 mg / ml every 10 min for reaction for 10 min, terminate the reaction by ice bath for 10 min, centrifuge at 12,000 r / min, dilute 10 times, and filter through a 0.22 μm water membrane. Use the detection method in Example 4 to detect the concentrations of D-fructose and D-allulose and calculate the residual enzyme activity. The results are shown in Figure 3 .
[0074] The results show that the half-life of the original strain at 50 °C is about 120 min, while the mutant strain still retains more than 90% of the residual enzyme activity after incubation at 50 °C for 120 min. At the same time, the half-life of the mutant strain at 70 °C can reach about 420 min. It can be found that the thermal stability of the mutant strain is significantly improved.
[0075] Example 7: Determination of the optimal reaction temperature of wild-type CbDAE and double-site mutant CbDAE / A13S / V235I
[0076] Use the pure enzyme solution prepared in Example 5 as the enzyme for transformation to determine the optimal reaction temperature of the enzyme. Reaction system: 100 g / L D-fructose and 0.04 mg / mL pure enzyme solution, and then add 50 mM pB (pH 6.5) buffer to make the total volume of the system 1 mL. React at different temperatures (40, 45, 50, 55, 60, 65, 70, 75, 80 °C) for 10 min. Other conditions are the same as the enzyme activity detection method in Example 4. The results are shown in Figure 4 As shown. It can be seen from the figure that the optimal reaction temperatures of wild-type CbDAE and mutant enzyme CbDAE / A13S / V235I are 60 °C and 70 °C respectively, which increases the optimal temperature by 10 °C and makes it more heat-resistant.
[0077] Example 8: Determination of the T m value of D-allulose 3-epimerase and its mutants
[0078] Purify the wild-type D-allulose 3-epimerase CbDAE, the double-site mutant CbDAE / A13S in Example 1, CbDAE / V235I, and the double-site mutant D-allulose 3-epimerase CbDAE / A13S / V235I in Example 2 according to the D-allulose 3-epimerase purification method in Example 5. After desalting the collected pure enzyme solutions respectively, use a circular dichroism spectrometer to measure the T m value. The results are as Figure 5 shown. The T m value increased from 55.1 °C of the wild enzyme to 65.1 °C.
[0079] Example 9: Preparation of D-allulose from D-fructose catalyzed by D-allulose 3-epimerase mutants
[0080] Induce the expression of the double-site mutant D-allulose 3-epimerase CbDAE / A13S / V235I in Example 2 according to the method in Example 3. After 12 h of induction culture, centrifuge the cells at 8000 r / min for 10 min to collect the cells, discard the supernatant, wash the cells once with 50 mM sodium phosphate buffer (pH 6.5), and collect the cells under the same conditions. Collect the wet cells as the enzyme for transformation, and use D-fructose as the substrate to carry out the isomerization reaction to prepare D-allulose.
[0081] The specific operation is as follows: Add 10 mL of 50 mM sodium phosphate buffer (pH 6.5), 0.25 g of wet cells, D-fructose with a final concentration of 100 g / L, and Mn with a final concentration of 1 mM into a 50 mL reaction flask in sequence 2+ . React at 70 °C and 600 r / min. Take 1 mL of the reaction solution at regular intervals and centrifuge at 12000 r / min. After diluting 10 times and filtering through a 0.22 μm water membrane, use the detection method in Example 4 to detect the concentrations of D-fructose (D-Fructose) and D-allulose. It is found that the D-allulose 3-epimerase mutant can make the catalytic reaction reach equilibrium within 3 h when catalyzing D-fructose, and the conversion rate is as high as 33.2%. Further discovery, when adding boric acid with a boric acid to fructose ratio of 0.9 (final concentration 90 g / L) to the reaction system, when the D-allulose 3-epimerase mutant catalyzes D-fructose to reach equilibrium within 3 h, the conversion rate is as high as 78.6%.
Claims
1. A D-psicose 3-epimerase, the amino acid sequence of which is shown in SEQ ID NO.
2.
2. A mutant of D-psicose 3-epimerase, which is obtained by site-directed mutagenesis of the amino acids shown in SEQ ID NO.2, and the site-directed mutation sites are that alanine at the 13th position is mutated to serine and valine at the 235th position is mutated to isoleucine.
3. The mutant according to claim 2, wherein The amino acid sequence of the mutant is shown in SEQ ID NO.
4.
4. A gene encoding the D-psicose 3-epimerase and its mutant according to claim 1 or 2.
5. The gene according to claim 4, wherein The nucleotide sequence of the encoding gene is shown in SEQ ID NO.1 and SEQ ID NO.
3.
6. A vector containing the gene according to claim 4.
7. A genetically engineered bacterium containing the gene according to claim 4.
8. Use of the D-psicose 3-epimerase and its mutant according to claim 1 or 2 in the microbial catalysis of D-fructose isomerization to prepare D-psicose.
9. The application according to claim 8, characterized in that The use is as follows: using the wet cells obtained by fermentation culture of a genetically engineered bacterium containing the encoding gene of D-psicose 3-epimerase or mutant as the enzyme source, using D-fructose as the substrate, using manganese ions as the co-catalyst, using a buffer solution with pH 6.5 as the reaction medium, reacting under the conditions of 50-80 °C and 100-200 r / min, and after the reaction is complete, obtaining a mixture of D-fructose and D-psicose.
10. The application according to claim 9, characterized in that: The initial concentration of the substrate is 50-500 g / L, the dosage of the wet cells is 10-150 g / L, and the final concentration of manganese ions is 0.1-10 mM.
Citation Information
Patent Citations
High-temperature-resistant D-psicose 3-epimerase, mutant and application thereof
CN110904088A
Allulose 3-epimerase mutant, engineered bacterium expressing same, and immobilized enzyme and immobilization method thereof
US20220340944A1