A Blackwell cordyceps strain and a cultivation method of its artificial fruiting body

Abstract

The present invention belongs to the technical field of fungal cultivation, and specifically relates to a Blackwell Cordyceps strain and a cultivation method of its artificial fruiting body. The Blackwell Cordyceps (Cordyceps blackwelliae) strain ZYJ0835 was deposited in the China Center for Type Culture Collection on May 18, 2022, with a deposit number of: CCTCC NO: M 2022663; the deposit address is: Wuhan University, Wuhan, China. The mycelium and fermentation liquid processed products obtained by shaking culture of the strain ZYJ0835 have antioxidant, fibrinolytic, antibacterial and other activities, and fruiting bodies can be cultivated on substrates such as rice, wheat, and tussah pupae, and the obtained artificial fruiting bodies also have antioxidant, fibrinolytic and other activities. The cultivation method of the Cordyceps fruiting body of the present invention is simple, the cultivation conditions are easy to control, and industrial cultivation can be carried out, providing a new type of artificially cultivated Cordyceps resource.

Description

Technical Field

[0001] The invention belongs to the technical field of fungus cultivation, and in particular relates to a Blackwell cordyceps strain and a cultivation method of an artificial fruiting body thereof. Background Art

[0002] Cordyceps is widely distributed on the earth, contains rich active ingredients (such as cordycepin, adenosine, cordyceps polysaccharides, etc.), and exhibits a variety of physiological activities (such as antibacterial, anti-inflammatory, antioxidant, anti-tumor, hypolipidemic and blood sugar, anti-aging, etc.). In recent years, excessive excavation has led to a very scarce wild cordyceps resource, which cannot meet the growing market demand. At present, Cordyceps militaris, Cordyceps sinensis, Cordyceps cicada, Guangdong Cordyceps, etc. have been cultivated on a large scale. However, there are still a large number of Cordyceps fungi that cannot be artificially cultivated into fruiting bodies. In-depth research on Cordyceps fungi will help to fully tap its potential value, enable it to better serve mankind, and protect people's physical and mental health. Blackwell Cordyceps Cordyceps blackwelliae is a new species reported in 2018, belonging to the Ascomycota, Sordariomycetes, Hypocreales, and Cordycipitaceae. This Cordyceps infects the larvae or pupae of Coleoptera or Lepidoptera insects on fallen leaves or the back of leaves, and has only been reported in Thailand and Vietnam. There are no research reports on artificial cultivation in my country. Summary of the invention

[0003] The invention aims to provide a Blackwell cordyceps strain and a cultivation method of its artificial fruiting body.

[0004] To achieve the above object, the technical solution adopted by the present invention is:

[0005] The present invention provides a Cordyceps blackwelliae strain ZYJ0835, which was deposited in the China Center for Type Culture Collection on May 18, 2022, with a deposit number of CCTCC NO: M 2022663; the deposit address is: Wuhan University, Wuhan, China.

[0006] A method for preparing a fermentation product of Cordyceps blackwelliae strain ZYJ0835, comprising the following steps:

[0007] (1) Strain activation

[0008] Strain ZYJ0835 was inoculated on solid culture medium plates and cultured at 20-25°C for 7 days;

[0009] (2) Liquid fermentation culture

[0010] Cut 3-5 bacterial blocks from the activated solid culture medium plate and inoculate them into sterile liquid fermentation medium, and culture them at 20-25℃ with shaking for 7 days;

[0011] (3) Treatment of fermentation culture

[0012] The fermentation culture cultured for 7 days was centrifuged, and the supernatant and mycelium precipitate were collected respectively; the mycelium was further treated by ultrasound or homogenization to obtain a mycelium crude extract.

[0013] The solid culture medium is PDA culture medium; the liquid culture medium is any one of PDB culture medium, corn steep liquor culture medium, lactose culture medium, sucrose culture medium or SDAY culture medium.

[0014] Furthermore, the supernatant and the crude mycelial extract are used for biological activity assays, including fibrinolytic activity, antioxidant activity and antibacterial activity assays.

[0015] A method for cultivating artificial fruiting bodies of Cordyceps blackwelliae strain ZYJ0835, comprising the following steps:

[0016] (1) Strain activation

[0017] Strain ZYJ0835 was inoculated on solid culture medium plates and cultured at 20-25°C for 7 days;

[0018] (2) Preparation of liquid bacterial strains

[0019] Cut 3-5 bacterial blocks from the activated solid culture medium plate and inoculate them into sterile liquid fermentation medium, and culture them at 20-25°C with shaking for 7 days to obtain liquid strains;

[0020] (3) Cultivation and management of fruiting bodies

[0021] (i) Inoculation stage: inoculating the liquid bacterial strain onto a suitable solid culture matrix;

[0022] (ii) Mycelium culture stage: The culture bottle is cultured in the dark at 20°C and relative humidity of 60% to 70% until the mycelium grows all over the solid culture medium;

[0023] (iii) Primordial induction differentiation stage: The mycelium was stimulated by light and temperature difference, with 200 Lx light treatment at 22°C for 14 h and dark treatment at 17°C for 10 h every day for 7 days;

[0024] (iv) Fruiting body management stage: For mycelium that has completed the primordium induction differentiation stage, maintain 22°C, 80% air humidity, 1000Lx light for 12 hours per day, and the management time is 45-55 days;

[0025] (v) Harvesting: Harvesting when the fruiting bodies grow to 3-5 cm.

[0026] Furthermore, the solid culture matrix is ​​one of rice, wheat or tussah pupae.

[0027] Furthermore, when rice or wheat is used as the cultivation medium, a nutrient solution needs to be added, the formula of the nutrient solution is: 20g glucose, 12g silkworm pupa powder, 5g peptone, 0.5g MgSO4, 1.5g KH2PO4 and 0.01g vitamin B1, natural pH, and distilled water is used to make the volume to 1000mL.

[0028] The beneficial effects of the present invention are:

[0029] The Cordyceps blackwelliae strain ZYJ0835 of the present invention is a new Cordyceps strain, and its liquid fermentation product has antioxidant, fibrinolytic, antibacterial and other activities, and can cultivate fruiting bodies on rice, wheat and tussah pupa substrates, and the obtained artificial fruiting bodies also have antioxidant, fibrinolytic and other activities. The cultivation method of the Cordyceps fruiting body is simple, the cultivation conditions are easy to control, and industrial cultivation can be carried out, providing a new type of artificially cultivated Cordyceps resource. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a colony and microscopic morphology of the ZYJ0835 strain of the present invention on a PDA plate;

[0031] Figure 2 It is a phylogenetic tree of the ZYJ0835 strain of the present invention based on multi-gene construction, and the node values ​​are the support obtained by using the maximum likelihood method (before the slash) and the Bayesian method (after the slash);

[0032] Figure 3 It is the fibrinolytic activity result of the ZYJ0835 strain of the present invention fermented in lactose medium;

[0033] Figure 4 It is the result of the bacterial inhibition activity of the plate culture of the ZYJ0835 strain of the present invention;

[0034] Figure 5 It is the result of the fungi-inhibiting activity of the plate culture of the ZYJ0835 strain of the present invention;

[0035] Figure 6 The fruiting body is artificially cultivated by ZYJ0835 of the present invention on different substrates such as rice, wheat and tussah silkworm pupae. DETAILED DESCRIPTION

[0036] The present invention is described in detail below with reference to the embodiments.

[0037] Example 1

[0038] Isolation and identification of Cordyceps sinensis strain ZYJ0835

[0039] (1) Sample collection and strain isolation

[0040] In 2019, the applicant collected a sample of entomogenous fungi during a fungal resource survey in Danxia Mountain, Guangdong Province. The sample consisted of a dead leaf wrapped around an unidentifiable insect, with white spore stalks growing on it and powdery conidia on the top. After the sample was brought back to the laboratory, a small amount of conidia was picked up with an inoculation needle and placed in a PDA separation medium. After cultivation and purification, a fungal culture was obtained, numbered ZYJ0835. The strain was deposited in the China Center for Type Culture Collection on May 18, 2022, with the deposit number CCTCC NO: M 2022663.

[0041] (2) Strain culture and identification

[0042] a. Characterization of strains

[0043] Strain ZYJ0835 was re-transferred to the center of the PDA medium and cultured in a constant temperature incubator at 25°C for 14 days. The colony morphology was observed, and the spore production structure was observed using an electron microscope.

[0044] from Figure 1 It can be seen that the ZYJ0835 strain was cultured on PDA medium at 25°C for 14 days, and the colonies were regular circles with a diameter of about 5.7 cm, white on the front and light yellow on the back, with dense hyphae ( Figure 1 A). Conidiophores are branched; the base of the phialopse is swollen and gradually tapers at the top. Conidia are ellipsoidal ( Figure 1 B), diameter 4-6μm, slightly wrinkled surface, stringy ( Figure 1 C, E, F). These features are similar to those of the known Blackwelliae Cordyceps.

[0045] b. Gene sequence analysis of strains

[0046] The genomic DNA was extracted by CTAB method, and the nrDNA ITS fragment was amplified using primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). The amplified product was sequenced, and the obtained sequence was subjected to BLAST analysis in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) for preliminary identification.

[0047] The nrDNA ITS fragment of ZYJ0835 was amplified by PCR and sequenced, and the obtained sequence (SEQ ID NO: 1) was:

[0048] CCAGAGTTTTACAACTCCCAACCCTTCTGTGAACCTACCCATCGTTGC TTCGGCGGACTCGCCCCAGCGTCCGGACGGCCCCGCGCCGGCCCGCGACCTGGACCCAGGCGGCCGCCGGAGACCACCTGCATCCATCAGTC TCTCTGAATCCGCCGCGAGGCAACACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGT AATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCT CGACGCCCCCGGGACGTCGGCCTTGGGGACCGGCAACACCCCCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTACAACCACTCGCACCGGGAACCCGACGCGGCCCGCCGTGAAACCCCCAACTCT GAAC.

[0049] The above nrDNA ITS sequence was subjected to BLAST analysis, and it was found that its similarity with the nrDNA ITS sequence of Cordycepsblackwelliae in the database was more than 99%.

[0050] Furthermore, based on the multi-gene sequences, the maximum likelihood method and Bayesian method were used to construct a phylogenetic tree.

[0051] Based on the construction of a phylogenetic tree based on multiple genes, it was confirmed that ZYJ0835 clustered with other known strains of Cordyceps blackwelliae (see Figure 2 ). Based on the above results, the isolated strain ZYJ0835 was finally identified as Cordyceps blackwelliae.

[0052] Example 2

[0053] Determination of Antioxidant Activity of Cordyceps Strain ZYJ0835

[0054] (1) Activation of Cordyceps Strain ZYJ0835

[0055] The strain ZYJ0835 was inoculated on PDA medium plates and cultured at 25°C for 7 days.

[0056] (2) Liquid fermentation culture

[0057] 50 mL of liquid culture medium was placed in each 250 mL conical flask and sterilized at 121° C. for 25 min. Three ZYJ0835 bacterial blocks (d=5 mm) were inoculated into the sterilized liquid culture medium and cultured in a shaking incubator at 25° C. and 160 rpm for 7 days to obtain a fermentation culture.

[0058] The liquid culture medium is any one of the following culture media.

[0059] PDB medium (1 L): 200.0 g of potato, boiled in distilled water for 30 min and filtered, added with 3.0 g of KH2PO4, 1.5 g of MgSO4, 20.0 g of glucose, 20.0 g of peptone and 0.01 g of vitamin B1.

[0060] Corn slurry culture medium (1L): 3g corn slurry, 10g soybean cake powder, and appropriate amount of distilled water were boiled for 30min, filtered, and 50g glucose, 1.5g KH2PO4 and 1.5g MgSO4 were added.

[0061] Lactose medium (1L): 10.0g silkworm pupa powder, boiled in distilled water for 30min, filtered, added with 10.0g lactose, 5.0g yeast extract, 1.0g KH2PO4 and 0.5g MgSO4.

[0062] Sucrose culture medium (1L): 50.0g soybean cake powder was boiled in distilled water for 30min and filtered, and 20.0g sucrose, 0.1g MgSO4, 0.2g KH2PO4, 0.1g CaCl2, 0.5g MnSO4 and 0.05g FeSO4 were added.

[0063] SDAY medium (1 L): 10.0 g glucose, 2.5 g peptone and 2.5 g yeast powder.

[0064] (3) Treatment of fermentation culture

[0065] Fermentation broth treatment: The fermentation broth of the fermentation culture was centrifuged at 5000 rpm for 10 min, and the supernatant and mycelium precipitate were collected for later use.

[0066] Mycelium treatment (ultrasonic method): The mycelium obtained by centrifugation of the fermentation culture was washed with PBS buffer, dried at 50°C and ground into powder, and then distilled water was added. The mycelium was treated with an ultrasonic cleaner at 360 W and 50°C for 30 minutes to obtain a crude mycelium extract, which was centrifuged at 12000 rpm for 10 minutes to obtain a supernatant.

[0067] (4) Antioxidant activity assay

[0068] 1) Eliminate DPPH free radicals

[0069] Take 1.5mL of fermentation supernatant or mycelial crude extract (sample) and 1.5mL of 0.2mmol / L DPPH solution, and measure the absorbance of the mixture. The absorbance is expressed as A i When distilled water is used instead of the sample, the absorbance of the mixture is measured, and the absorbance is represented by Ac; when distilled water is used instead of DPPH, the absorbance of the mixture is measured, and the absorbance is represented by A j The solution in each system was shaken in a test tube and allowed to stand at room temperature in the dark for 30 min. The solution was adjusted to zero with distilled water (3 mL) and the absorbance at 517 nm was measured using an ultraviolet spectrophotometer. The experiment was repeated 3 times. The clearance rate was calculated according to the following formula:

[0070] Clearance rate (%) = [1-(A i -A j ) / A c ]×100

[0071] 2) Eliminate OH free radicals

[0072] Take 0.5 mL of fermentation supernatant or mycelial crude extract (sample), 0.5 mL of 4 mmol / L FeSO4 solution, 0.5 mL of 4 mmol / L salicylic acid-anhydrous ethanol solution and 0.5 mL of 4 mmol / L H2O2 solution, and measure the absorbance of the mixture. The absorbance is expressed as A x Indicates: Use distilled water instead of H2O2 solution to measure the absorbance of the mixture, which is expressed as A x0 Indicated by; using distilled water instead of the sample, measuring the absorbance of the mixture, the absorbance is represented by A0. All systems are supplemented with distilled water to 4mL and mixed, and then placed in a water bath at 37°C for 30min, adjusted to zero with distilled water (4mL), and the absorbance at 510nm is measured using a UV spectrophotometer. The experiment is repeated 3 times. The clearance rate is calculated according to the following formula:

[0073] Clearance rate (%) = [1-(A x -A x0 ) / A0]×100

[0074] 3) Effect of scavenging ABTS free radicals

[0075] Take equal volumes of 7.4mmoL / L ABTS solution and 2.6mmoL / L potassium persulfate solution, mix well and place at room temperature in the dark for 12 to 16 hours to obtain ABTS mother solution. Dilute the ABTS mother solution with distilled water so that its absorbance at 734nm reaches about 0.70±0.02, which is the ABTS working solution. Take 1.5mL of fermentation broth supernatant or mycelial crude extract (sample) and 1.5mL ABTS working solution, measure the absorbance of the mixture, and the absorbance is represented by B; use distilled water instead of the sample to measure the absorbance of the mixture, and the absorbance is represented by B0; repeat 3 times. When measuring the absorbance of each system, adjust it to zero with distilled water (3mL) and use a UV spectrophotometer to measure the absorbance at 734nm. Calculate the clearance rate according to the following formula:

[0076] Clearance (%) = [1-(B / B0)] × 100

[0077] The results showed that the liquid fermentation products of Cordyceps strain ZYJ0835 had scavenging effects on DPPH, ·OH, and ABTS free radicals, indicating that the species C. blackwelliae has antioxidant activity. The fermentation products obtained from different culture media had slightly different scavenging effects on the same free radical. Specifically, the scavenging rates of the fermentation supernatants of each culture medium for DPPH free radicals were between 63% and 93%, the scavenging rates for ·OH free radicals were between 47% and 85%, and the scavenging rates for ABTS free radicals were between 40% and 96%; the scavenging rates of the obtained mycelium crude extracts for DPPH free radicals were between 52% and 97%, the scavenging rates for ·OH free radicals were between 53% and 80%, and the scavenging rates for ABTS free radicals were between 16% and 96%.

[0078] Example 3

[0079] Determination of fibrinolytic activity of Cordyceps sinensis strain ZYJ0835

[0080] (1) The activation of Cordyceps sinensis strain ZYJ0835 was the same as that in Example 2.

[0081] (2) The liquid fermentation culture was the same as in Example 2.

[0082] (3) The treatment of the fermentation culture was the same as in Example 2.

[0083] The mycelium can also be homogenized by the following method: wash the mycelium with PBS buffer, add PBS at a wet weight of 1 g / mL, homogenize at 65 Hz for 6 minutes, centrifuge at 12000 rpm for 10 minutes, and collect the supernatant to obtain a mycelium crude extract.

[0084] (4) Preparation of fibrin plate

[0085] Prepare 1.25% agarose solution, heat to dissolve the agarose and place in a 65℃ water bath for later use. Take 10mL of 1.25% agarose solution and mix with 140μL of 100U / mL thrombin. Add 7.5mL of 2.4g / L fibrinogen solution to the culture dish, pour the mixture of agarose and thrombin into the culture dish, stir quickly with a sterile glass rod, let it stand and cool, and use a hole puncher to make a hole with a diameter of 5mm for later use.

[0086] (5) Draw the urokinase curve

[0087] Prepare 20, 40, 60, 80, and 100 U / mL urokinase, take 10 μL and add it to different fibrin wells, repeat 3 wells for each concentration. Keep at 37℃ for 18h, measure the radius of the transparent zone and convert it into the area of ​​the dissolution zone, and draw the urokinase standard curve (y=0.0281x+1.821, R 2 =0.9938).

[0088] (6) Determination of the fibrinolytic activity of lactose medium fermentation cultures

[0089] Take 10 μL of the fermentation supernatant and mycelial crude extract of strain ZYJ0835 cultured in lactose medium and spot it on the prepared coagulation fibrin plate. Repeat 3 times. Use urokinase as the positive control, PBS buffer and culture medium stock solution as negative controls. Incubate at 37°C for 18 h, measure the radius of the transparent zone and convert the fibrinolytic activity (U / mL) according to the urokinase standard curve.

[0090] The experimental results show that the fermentation product of Cordyceps sinensis strain ZYJ0835 has fibrinolytic activity (see Figure 3 ), in which: 1 is the fermentation supernatant, 2 is the mycelial crude extract, 3 is the positive control of urokinase solution, 4 is the negative control of PBS buffer, and 5 is the negative control of culture medium stock solution. Specifically, the fibrinolytic activity of the fermentation supernatant obtained by culturing strain ZYJ0835 in different culture media is 1.821-1.904 U / mL, and the fibrinolytic activity of the mycelial crude extract is 1.850-1.926 U / mL.

[0091] Example 4

[0092] Determination of antibacterial activity of Cordyceps sinensis strain ZYJ0835

[0093] (1) Preparation of test bacterial suspension:

[0094] Escherichia coli, Salmonella, and Staphylococcus aureus were selected as the test bacteria, and the operation methods of the three were consistent, including the following steps:

[0095] 1) Use a sterile inoculating loop to pick a single bacterial colony from the LB slant test tube, add it to LB liquid culture medium, and activate it at 37°C and 200 rpm for 18 hours;

[0096] 2) Perform gradient dilution of the mother solution, with a total dilution of 1×10 -1 ~1×10 -7 There are 7 gradients in total, take 50 μL of 1×10 -4 , 1×10 -5 , 1×10 -6 , 1×10 -7 The four gradient dilutions were spread on different LB plates and cultured at 37°C for 24 hours. The dilutions with colony counts between 30 and 300 on the plates were selected to calculate the concentration of the mother bacteria solution. The conversion formula is: mother bacteria solution concentration (per L) = colony count × 20 / dilution multiple;

[0097] 3) Dilute the mother bacterial solution to 1×10 5 CFU / mL is reserved.

[0098] (2) Determination of bacterial inhibition activity of Cordyceps sinensis strain ZYJ0835 on plates

[0099] 1) Take 200 μL of the test bacterial suspension (1×10 5 CFU / mL) onto LB plates, spread evenly and let stand for 30 min until the bacterial solution is absorbed;

[0100] 2) Cut three ZYJ0835 bacterial blocks (d = 5 mm) and place them evenly at 3 points with equal distance and no less than 10 mm from the edge of the dish, so that the side of the bacterial block with hyphae is attached to the surface of the culture medium; at the same time, use a blank agar block as a control; place the plate in a 4°C refrigerator for 12 to 14 hours;

[0101] 3) Incubate the above plate at 25°C for 24 h and measure the radius of the inhibition zone.

[0102] (3) Determination of antifungal activity of Cordyceps sinensis strain ZYJ0835

[0103] Aspergillus niger and Fusarium graminearum were selected as the test fungi, and the operation methods of the two were the same. Use a sterile inoculation needle to pick up a fungus block of appropriate size in the inclined test tube, place it in PDA culture medium, and culture it at 37°C. Observe until the morphology is stable and the activation is successful. Place the strain ZYJ0835 block (d = 5mm) in the center of the PDA culture medium plate, inoculate 2 fungal strains (d = 5mm) 25mm to the left and right of the center of the plate, and culture it at 28°C for 5 days to observe the growth of harmful fungi in the direction close to strain ZYJ0835. Use a plate inoculated with a piece of Aspergillus niger block (d = 5mm) as a control, and repeat 3 times. Calculate the inhibition rate of fungi.

[0104] The results showed that strain ZYJ0835 had a certain antibacterial activity (see Figure 4 and Figure 5 ), Figure 4 Middle: 1 is the ZYJ0835 bacterial block, which produces an obvious inhibition zone; 2 is the blank control. Figure 5 In the figure: 1 is ZYJ0835, 2 is the tested harmful fungus Aspergillus niger, and 3 is the antagonistic band produced. For the bacterial inhibition experiment, strain ZYJ0835 had no significant effect on Escherichia coli, Salmonella and Staphylococcus aureus (1×10 5 The average inhibition transparent zone radius of 10000 μg / mL (CFU / mL) was 9.17, 9.83 and 9.50 mm respectively. For the fungus inhibition experiment, the average inhibition rate of strain ZYJ0835 against Aspergillus niger and Fusarium graminearum was 44.24% and 47.46% respectively.

[0105] Example 5

[0106] Artificial cultivation of fruiting bodies of Cordyceps sinensis strain ZYJ0835 on rice or wheat substrate

[0107] (1) Bacteria activation:

[0108] The original strain was inoculated onto PDA medium and cultured at 25°C for 7 days.

[0109] (2) Preparation of liquid bacteria:

[0110] The liquid culture medium was divided into 250 mL conical flasks, each containing 50 mL of liquid culture medium, and sterilized at 121°C for 25 min. Three ZYJ0835 bacterial blocks (d = 5 mm) were inoculated, and cultured in a shaking incubator at 25°C and 160 rpm for 7 days. The obtained liquid culture can be used to inoculate solid culture medium. The liquid culture medium is made of 200 g potato, 20 g glucose, 5 g peptone, 0.5 g MgSO4, 1.5 g KH2PO4 and 0.01 g vitamin B1, natural pH, and distilled water to 1000 mL.

[0111] (3) Preparation of rice or wheat solid culture medium:

[0112] Each culture bottle is filled with 30g of rice or wheat, and then 45mL of nutrient solution is added, and the solid particles are gently shaken to spread to the bottom of the bottle; sterilized at 121°C for 25min, and inoculated after drying to room temperature. The nutrient solution is made of 20g of glucose, 12g of silkworm pupa powder, 5g of peptone, 0.5g of MgSO4, 1.5g of KH2PO4 and 0.01g of vitamin B1, natural pH, and distilled water to 1000mL.

[0113] (4) Cultivation and management of fruiting bodies

[0114] (i) Inoculation stage: Aseptically, use a pipette to take 10 mL of liquid bacteria and evenly spread it on the sterilized rice or wheat substrate;

[0115] (ii) Mycelium culture stage: The culture flask was cultured in a completely dark environment at 20°C and relative humidity of 60% to 70% until the mycelium covered the solid culture matrix, which lasted for 14 days;

[0116] (iii) Primordial induction differentiation stage: After the mycelium is generated, it is transferred to an LED-type overhead artificial incubator to provide light and temperature difference stimulation to the mycelium, with 14 h of light at 22°C and 200 Lx, and 10 h of darkness at 17°C for 7 days;

[0117] (iv) Fruiting body management stage: The mycelium that has completed the primordium induction differentiation stage is cultured at a constant temperature of 22°C, with an air humidity of 80% and a light intensity of 1000 Lx for 12 h per day for 45-55 days;

[0118] (v) Harvesting: When the fruiting bodies grow to about 3-5 cm, they are harvested intact.

[0119] The experimental results showed that strain ZYJ0835 could produce fruiting bodies on both rice and wheat substrates (see Figure 6 ), indicating that artificial cultivation of species C. blackwelliae is feasible. The characteristics of fruiting bodies cultivated in rice or wheat substrates are as follows: During the cultivation process, the surface of the substrate is covered with white hyphae, and the fruiting bodies grow from the roots of the rice substrate, either singly or in clusters, and will branch later, with white as the main color. The fruiting bodies are rod-shaped as a whole, with a pointed head and an uneven surface that appears fluffy.

[0120] Example 6

[0121] Artificial cultivation of fruiting bodies of Cordyceps sinensis strain ZYJ0835 on tussah pupae

[0122] (1) Bacterial activation: the same as in Example 5;

[0123] (2) Preparation of liquid bacterial strains: the same as in Example 5;

[0124] (3) Cultivation process:

[0125] 1) Inoculation stage: Use a syringe to inject liquid bacteria into the junction of the wings and abdomen of disinfected fresh silkworm pupae, 100 μL / pupae.

[0126] 2) The stage of ossification of the insect body and mycelium culture: The silkworm pupae are placed in a sterile culture bottle in an artificial incubator at 21°C and 60% humidity until the silkworm pupae gradually ossify. The ossified insect body is incubated at 21°C in the dark for 7 days until white mycelium grows out of the pupal body.

[0127] 3) The primordium induction and differentiation stage is the same as that in Example 5.

[0128] 4) The fruiting body management stage is the same as that in Example 5.

[0129] 5) Harvesting is the same as in Example 5.

[0130] The experimental results showed that strain ZYJ0835 could produce fruiting bodies on the substrate of tussah pupae (see Figure 5 ), indicating that artificial cultivation of species C. blackwelliae is feasible. The characteristics of fruiting bodies cultivated on tussah pupa substrate are as follows: on tussah pupa substrate, fruiting bodies first grow white hyphae at the pupa stage and then cover the entire tussah pupa. Fruiting bodies grow from the tussah pupa stage, solitary or clustered, and the surface of fruiting bodies is covered with hyphae. The color is mainly white, the height is relatively low, and the yield is relatively low.

[0131] Example 7

[0132] Analysis of Antioxidant and Fibrinolytic Activities of Artificially Cultivated Fruiting Bodies of Cordyceps Strain ZYJ0835

[0133] (1) Determination of the antioxidant activity of artificially cultivated fruiting bodies of Cordyceps sinensis strain ZYJ0835

[0134] 1) Obtaining fruit bodies: Obtain fruit bodies artificially cultivated on rice or wheat substrates according to the method of Example 5.

[0135] 2) Fruiting body treatment: The mycelium is treated in the same manner as in step (3) of Example 2 and step (2) of Example 3, i.e., the mycelium is treated by ultrasound and homogenization.

[0136] 3) Antioxidant activity determination: The same operation method as in step (4) of Example 2 for the scavenging activity of three free radicals (DPPH, ·OH, ABTS free radicals).

[0137] The results of antioxidant activity experiments showed that the average scavenging rates of the ultrasonic treatment products of rice-based fruiting bodies on DPPH, ·OH, and ABTS free radicals were 72.37%, 33.72%, and 6.65%, respectively; the average scavenging rates of the homogenate treatment products on the three free radicals were 65.38%, 59.21%, and 91.22%, respectively. The average scavenging rates of the ultrasonic treatment products of wheat-based fruiting bodies on DPPH, ·OH, and ABTS free radicals were 86.15%, 62.57%, and 9.29%, respectively; the average scavenging rates of the homogenate treatment products on DPPH, ·OH, and ABTS free radicals were 65.20%, 80.84%, and 95.83%, respectively.

[0138] (2) Determination of fibrinolytic activity of artificially cultivated fruiting bodies of Cordyceps sinensis strain ZYJ0835

[0139] 1) Fruiting body treatment: The mycelium is treated in the same manner as in step (3) of Example 2 and step (2) of Example 3, i.e., the mycelium is treated by ultrasonication and homogenization.

[0140] 2) Determination of fruiting body fibrinolytic activity: Same as Example 3.

[0141] The results of the fibrinolytic activity experiment showed that the average fibrinolytic activity of the products of the rice matrix cultured fruiting body after ultrasound and homogenization treatment was 1.835 and 1.869 U / mL, respectively. The average fibrinolytic activity of the wheat matrix cultured fruiting body after ultrasound and homogenization treatment was 1.832 and 1.892 U / mL, respectively.

[0142] The above descriptions are only some specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and concepts of the present invention within the technical scope disclosed by the present invention, and these changes should be covered by the protection scope of the present invention.

[0143]

Claims

1. A Cordyceps blackwelliae strain ZYJ0835, characterized in that: The deposit number of the Cordyceps blackwelliae strain ZYJ0835 is: CCTCC NO: M2022663.

2. The method for preparing a fermentation product of Cordyceps blackwelliae strain ZYJ0835 according to claim 1, characterized in that: The following steps are involved: (1) Strain activation Strain ZYJ0835 was inoculated on solid culture medium plates and cultured at 20-25°C for 7 days; (2) Liquid fermentation culture Cut 3-5 bacterial blocks from the activated solid culture medium plate and inoculate them into sterile liquid fermentation medium, and culture them at 20-25℃ with shaking for 7 days; (3) Treatment of fermentation culture The fermentation culture cultured for 7 days was centrifuged, and the supernatant and mycelium precipitate were collected respectively; the mycelium was further treated by ultrasound or homogenization to obtain a mycelium crude extract.

3. The method for preparing a fermentation product according to claim 2, characterized in that: The supernatant and the mycelial crude extract are used for biological activity assays, including fibrinolytic activity, antioxidant activity and antibacterial activity assays.

4. The method for cultivating an artificial fruiting body of Cordyceps blackwelliae strain ZYJ0835 according to claim 1, characterized in that: The following steps are involved: (1) Strain activation Strain ZYJ0835 was inoculated on solid culture medium plates and cultured at 20-25°C for 7 days; (2) Preparation of liquid culture Cut 3-5 bacterial blocks from the activated solid culture medium plate and inoculate them into sterile liquid fermentation medium, and culture them at 20-25°C with shaking for 7 days to obtain liquid strains; (3) Cultivation and management of fruiting bodies (i) Inoculation stage: inoculating the liquid bacterial strain onto the solid culture matrix; (ii) Mycelium culture stage: The culture bottle is cultured in the dark at 20°C and relative humidity of 60% to 70% until the mycelium grows all over the solid culture matrix; (iii) Primordial induction differentiation stage: The mycelium was stimulated by light and temperature difference, with 200 Lx light treatment for 14 h at 22°C and 10 h in the dark at 17°C for 7 days. (iv) Fruiting body management stage: For mycelium that has completed the primordium induction differentiation stage, maintain 22°C, 80% air humidity, and 12 h of light per day at 1000 Lx for 45-55 days; (v) Harvesting: Harvested when the fruiting bodies grow to 3-5 cm.

5. The method for cultivating artificial fruiting bodies according to claim 4, characterized in that: The solid culture matrix is ​​one of rice, wheat or tussah pupae.

6. The method for cultivating artificial fruiting bodies according to claim 5, characterized in that: When rice or wheat is used as the cultivation medium, a nutrient solution needs to be added. The formula of the nutrient solution is: 20 g glucose, 12 g silkworm pupa powder, 5 g peptone, 0.5 g MgSO4, 1.5 g KH2PO4 and 0.01 g vitamin B1, natural pH, and distilled water is used to make the volume to 1000 mL.

Images