A set of transgenic primers, vectors, transformants, kits for reducing the chlorine content of cigar tobacco leaves, and applications and methods thereof

Through the construction and transformation of specific transgenic primers and vectors, the chloride ion content of cigar tobacco leaves was significantly reduced, solving the problem of high chloride ion content in the existing technology, improving the combustibility and aroma of the tobacco leaves, and realizing the cultivation of low-chloride content cigar tobacco leaves.

CN115820628BActive Publication Date: 2025-10-24YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211383736.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-07
Publication Date
2025-10-24
Estimated Expiration
2042-11-07

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively reduce the chloride ion content of cigar tobacco leaves, resulting in problems such as poor combustibility of the tobacco leaves and reduced aroma.

Method used

Specific transgenic primers P1/P2 and P3/P4 were used to connect with the pHSE401 vector through PCR amplification to construct a recombinant transgenic vector, which was transformed into Agrobacterium competent cells C58C1 and then transfected into cigar tobacco materials to cultivate transgenic tobacco plants with low chloride ion content.

Benefits of technology

The chloride ion content of cigar tobacco leaves was significantly reduced, with the highest reduction rate approaching 70%, which improved the combustibility and aroma of the tobacco leaves and provided a method for cultivating new varieties of cigar tobacco leaves with low chloride content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115820628B_ABST
    Figure CN115820628B_ABST
Patent Text Reader

Abstract

The application of "a group of transgenic primers, vectors, transformants, kits for reducing the chlorine content of cigar tobacco leaves, and methods thereof" belongs to the technical field of transgenic technology. The application provides a group of transgenic primers for reducing the chlorine content of cigar tobacco leaves, which comprises: upstream and downstream primers P1 and P2, the sequences of which are shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively; or, upstream and downstream primers P3 and P4, the sequences of which are shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively. The application also provides a transgenic vector, a transformant, a kit and a method obtained based on the primers. After the transgenic primers are used to obtain a recombinant vector, the transgenic tobacco plant obtained by transforming the transformant can greatly reduce the chlorine ion content in the transgenic tobacco plant, and the highest reduction rate is close to 70%.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a group of transgenic primers for reducing the chlorine content of cigar tobacco leaves, vectors, transformants, kits, and applications and methods thereof. BACKGROUND

[0002] In recent years, the Chinese cigar consumption market has rapidly expanded, providing opportunities for the development of Chinese-style cigars. Tobacco is a weakly chlorine-tolerant crop, and high chlorine ion content in tobacco leaves can cause a series of problems such as thickening, brittleness, decreased elasticity, poor burning, and decreased aroma. Soil chlorine ion content and chlorine application affect the chlorine content and accumulation of tobacco plants. When the chlorine ion content of tobacco leaves is between 0.3-0.6%, the burning of tobacco leaves is better, while the chlorine ion content of Chinese cigar tobacco leaves is about 1%.

[0003] There is an urgent need in the art to develop a product or method that can effectively and significantly reduce the chlorine ion content of cigar tobacco leaves. SUMMARY

[0004] Based on the above deficiencies and needs existing in the prior art, the purpose of the present application is to provide a group of transgenic primers for reducing the chlorine content of cigar tobacco leaves, vectors, transformants, kits, and applications and methods thereof. The present application has broad application prospects in cultivating low-chlorine ion content cigar tobacco leaf varieties and meeting the sustainable development of China's cigar tobacco industry.

[0005] The technical solution of the present application is as follows:

[0006] The group of transgenic primers for reducing the chlorine content of cigar tobacco leaves comprises: upper and lower primers P1 and P2 with sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; or,

[0007] upper and lower primers P3 and P4 with sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0008] The group of transgenic primers for reducing the chlorine content of cigar tobacco leaves comprises: upper and lower primers P1 and P2 with sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; and,

[0009] upper and lower primers P3 and P4 with sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0010] A transgenic vector for reducing the chlorine content of cigar tobacco leaves, wherein the recombinant transgenic vector is obtained by connecting a product obtained by PCR amplification using upstream and downstream primers P1 and P2 having sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, or upstream and downstream primers P3 and P4 having sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively, to pCBC-DT1T2 plasmid DNA as a template, to pHSE401 vector.

[0011] A transformant for reducing the chlorine content of cigar tobacco leaves, wherein the transformant is obtained by transforming the recombinant transgenic vector obtained by connecting a product obtained by PCR amplification using upstream and downstream primers P1 and P2 having sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, or upstream and downstream primers P3 and P4 having sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively, to pCBC-DT1T2 plasmid DNA as a template, to pHSE401 vector, to a competent cell.

[0012] The competent cell is an Agrobacterium competent cell.

[0013] Preferably, the Agrobacterium competent cell is Agrobacterium competent cell C58C1.

[0014] A kit for reducing the chlorine content of cigar tobacco leaves, comprising: upstream and downstream primers P1 and P2 having sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; and / or,

[0015] upstream and downstream primers P3 and P4 having sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0016] The kit for reducing the chlorine content of cigar tobacco leaves further comprises: PCR reagents, enzyme digestion reagents, and ligation and transformation reagents.

[0017] Use of the set of transgenic primers for reducing the chlorine content of cigar tobacco leaves, or the transgenic vector for reducing the chlorine content of cigar tobacco leaves, or the transformant for reducing the chlorine content of cigar tobacco leaves, or the kit for reducing the chlorine content of cigar tobacco leaves in reducing the chlorine content of cigar tobacco leaves.

[0018] A method for reducing the chlorine content of cigar tobacco leaves, comprising: performing PCR using upstream and downstream primers P1 and P2 having sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, or upstream and downstream primers P3 and P4 having sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively, to pCBC-DT1T2 plasmid DNA as a template.

[0019] The method for reducing the chlorine content of cigar tobacco leaves also includes connecting the product of the PCR with a pHSE401 vector.

[0020] Preferably, each microliter of the reaction system of the PCR includes 0.2 microliters of 5x Reaction Buffer, 2.5 micromoles of dNTP, 10 micromoles of upstream and downstream primers, 0.02 microliters of pCBC-DT1T2, and 0.01 microliters of Q5 enzyme.

[0021] Preferably, the reaction program of the PCR includes 98℃ pre-denaturation for 30 seconds, 7 denaturation seconds at 98℃, 30 seconds of annealing at 60℃, 30 seconds of extension at 72℃ for 1 cycle, and 35 cycles in total, and 5 minutes at 72℃.

[0022] Preferably, the pHSE401 vector needs to be digested before the connection.

[0023] Preferably, the method for reducing the chlorine content of cigar tobacco leaves also includes transforming the recombined vector obtained by the connection into Agrobacterium competent cells C58C1 to obtain transformants.

[0024] Preferably, the method for reducing the chlorine content of cigar tobacco leaves also includes transfecting the transformants into cigar tobacco materials.

[0025] Preferably, the cigar tobacco materials are selected from Yunxue No. 1 and / or Yunxue No. 2.

[0026] The beneficial effects of the present application are:

[0027] The present application develops a group of transgenic primers P1 / P2 and / or P3 / P4, and verifies through experiments that the product obtained by PCR amplification of the group of transgenic primers with pCBC-DT1T2 plasmid DNA as a template and connected with a pHSE401 vector can greatly reduce the chlorine ion content in transgenic tobacco plants after the recombined transgenic vector is transformed into the transformants. Figure 1 and Figure 2 As shown in the figures, 5 transgenic tobacco materials with significant differences in chlorine ion content phenotype are obtained after the related primers are constructed into vectors and then transgenically transformed into Yunxue No. 1 and Yunxue No. 2. The chlorine ion content of the leaves of the 5 transgenic tobacco materials is significantly reduced, and the highest reduction rate is close to 70%. The present application provides an effective method for reducing the chlorine ion content of cigar tobacco leaves, and provides a new path for cultivating new varieties of cigar tobacco leaves with low chlorine content. BRIEF DESCRIPTION OF DRAWINGS

[0028] The above and / or additional aspects and advantages of the present application will become apparent and more readily appreciated from the following description of the experiments, taken in conjunction with the accompanying drawings, in which:

[0029] Figure 1 Chloride content of Yunxue No. 1 transgenic material of Experimental Example 2 of the present application. T1 represents Yunxue No. 1, and T1-KO-11, T1-KO-13 and T1-KO-26 represent transgenic materials.

[0030] Figure 2 Chloride content of Yunxue No. 2 transgenic material of Experimental Example 2 of the present application. T2 represents Yunxue No. 2, and T2-KO-4 and T1-KO-25 represent transgenic materials. DETAILED DESCRIPTION

[0031] The detailed content and technical effects of the present application are further described below in combination with specific examples and experimental examples, but the protection scope of the present application is not limited thereby.

[0032] Sources of biomaterials

[0033] First, the E. coli competent cells used in Experimental Example 1 of the present application are commercially available.

[0034] Second, the Agrobacterium competent cells C58C1 used in Experimental Example 2 of the present application are commercially available; and the tobacco materials, Yunxue No. 1 and Yunxue No. 2, are both well-known and commonly used cigar tobacco varieties, and are commercially available.

[0035] First group of examples, transgenic primers of the present application

[0036] This group of examples provides a group of transgenic primers for reducing the chloride content of cigar tobacco leaves. All examples in this group have the following common features: the transgenic primers comprise: upstream and downstream primers P1 and P2 having sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; or, upstream and downstream primers P3 and P4 having sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0037] In a preferred example, the transgenic primers comprise: upstream and downstream primers P1 and P2 having sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; and,

[0038] upstream and downstream primers P3 and P4 having sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0039] Second group of examples, transgenic vectors of the present application

[0040] The embodiments of the present application provide a transgenic vector for reducing the chlorine content of cigar tobacco leaves. All the embodiments of the present application have the following common features: the transgenic vector is a recombined transgenic vector obtained by connecting a product obtained by PCR amplification with pCBC-DT1T2 plasmid DNA as a template and pHSE401 vector, wherein the upstream and downstream primers P1 and P2 have sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively, or the upstream and downstream primers P3 and P4 have sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively.

[0041] The third group of embodiments, the transformant of the present application

[0042] The embodiments of the present application provide a transformant for reducing the chlorine content of cigar tobacco leaves. All the embodiments of the present application have the following common features: the transformant is a transformant obtained by transforming a recombined transgenic vector into a competent cell, wherein the recombined transgenic vector is obtained by connecting a product obtained by PCR amplification with pCBC-DT1T2 plasmid DNA as a template and pHSE401 vector, wherein the upstream and downstream primers P1 and P2 have sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively, or the upstream and downstream primers P3 and P4 have sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively.

[0043] In specific embodiments, the competent cell is an agrobacterium competent cell.

[0044] Preferably, the agrobacterium competent cell is an agrobacterium competent cell C58C1.

[0045] The fourth group of embodiments, the kit of the present application

[0046] The embodiments of the present application provide a kit for reducing the chlorine content of cigar tobacco leaves. All the embodiments of the present application have the following common features: the kit comprises: the upstream and downstream primers P1 and P2 having sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively; and / or,

[0047] the upstream and downstream primers P3 and P4 having sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively.

[0048] In further embodiments, the kit further comprises: PCR reagents, enzyme digestion reagents, and ligation and transformation reagents.

[0049] The fifth group of embodiments, the application of the primers of the present application

[0050] The embodiments of the present application provide the application of the transgenic primer for reducing the chlorine content of cigar tobacco leaves provided by any one of the first group of embodiments, or the transgenic vector for reducing the chlorine content of cigar tobacco leaves described by any one of the second group of embodiments, or the transformant for reducing the chlorine content of cigar tobacco leaves described by any one of the third group of embodiments, or the kit for reducing the chlorine content of cigar tobacco leaves described by any one of the fourth group of embodiments in reducing the chlorine content of cigar tobacco leaves.

[0051] The method of the sixth group of embodiments, the method of the present application

[0052] The embodiments of the present application provide a method for reducing the chlorine content of cigar tobacco leaves. All the embodiments of the present application have the following common features: the method comprises: performing PCR by using the upstream and downstream primers P1 and P2 having the sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, or the upstream and downstream primers P3 and P4 having the sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, and taking the pCBC-DT1T2 plasmid DNA as a template.

[0053] In further embodiments, the method for reducing the chlorine content of cigar tobacco leaves further comprises: connecting the product of the PCR with the pHSE401 vector.

[0054] Preferably, the reaction system of the PCR comprises: 0.2 μl of 5x Reaction Buffer, 2.5 mM of dNTP, 10 μM of upstream and downstream primers, 0.02 μl of pCBC-DT1T2, and 0.01 μl of Q5 enzyme per microliter.

[0055] Preferably, the reaction procedure of the PCR comprises: 98℃ pre-denaturation for 30 seconds; 1 cycle of 98℃ denaturation for 7 seconds, 60℃ annealing for 30 seconds, and 72℃ extension for 30 seconds; and 35 cycles in total; and 72℃ for 5 minutes.

[0056] Preferably, the pHSE401 vector needs to be digested before the connection.

[0057] The digestion has the conventional technical meaning generally understood by those skilled in the art, and those skilled in the art can perform the digestion operation on the pHSE401 vector according to the conventional technical means in the field of molecular biology or the product use instruction of the pHSE401 vector.

[0058] The connection has the conventional technical meaning generally understood by those skilled in the art, and those skilled in the art can perform the connection operation according to the conventional technical means in the field of molecular biology or the product use instruction of the connection kit.

[0059] Preferably, the method for reducing the chlorine content of cigar tobacco leaves further comprises: transforming the recombinant vector obtained by ligation into Agrobacterium competent cells C58C1 to obtain a transformant;

[0060] Preferably, the method for reducing the chloride content of cigar tobacco leaves further comprises: transfecting cigar tobacco material with the transformant;

[0061] Preferably, the cigar tobacco material is selected from: Yunxue No. 1 and / or Yunxue No. 2.

[0062] Experimental Example 1: Construction of Chloride-Reducing Transgenic Vector

[0063] (1) Chlorine-lowering transgenic primers are shown in Table 1 below:

[0064] Table 1

[0065]

[0066] (2) PCR amplification

[0067] PCR amplification was performed using 100-fold diluted pCBC-DT1T2 plasmid DNA as a template.

[0068] A. PCR system is as follows

[0069]

[0070]

[0071] In the PCR system, F and R are respectively the primer combinations P1 / P2 or P3 / P4 in Table 1 above.

[0072] B. PCR amplification procedure is as follows

[0073] Pre-denaturation at 98°C for 30 seconds; denaturation at 98°C for 7 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, 35 cycles; 72°C for 5 minutes, hold at 20°C.

[0074] The PCR products were purified and recovered using a PCR product purification kit.

[0075] (3) Enzyme digestion of pHSE401 vector

[0076] Configure the following enzyme digestion system:

[0077]

[0078] The enzyme digestion products were detected by agarose gel electrophoresis, and the band sizes were 1200 bp and 11520 bp. The enzyme digestion product of 11520 bp was recovered by gel excision.

[0079] (4) Ligation of pHSE401 vector and PCR recovery product

[0080] The following ligation system was configured:

[0081]

[0082] 22°C for 1 h. 5 μl of the ligation product was used to transform E. coli competent cells. Positive clones were screened on LB plates containing kanamycin.

[0083] (7) Colony PCR and sequencing

[0084] The positive clones picked were detected by colony PCR using primer pair U626-IDF / U629-IDR, and the PCR product was 726 bp. The positive clones were extracted for plasmid DNA, and then sequenced using primers U626-IDF and U629-IDF to verify the positive clones. The sequences of the primers are as follows:

[0085] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO. 5)

[0086] U629-IDF: TTAATCCAAACTACTGCAGCCTGAC (SEQ ID NO. 6)

[0087] U629-IDR: AGCCCTCTTCTTTCGATCCATCAAC (SEQ ID NO. 7)

[0088] Experimental Example 2, Agrobacterium transformation and tobacco leaf disc transformation

[0089] (8) Agrobacterium competent cells C58C1 were dissolved and added to the positive clone DNA obtained in step (7) for Agrobacterium transformation to obtain Agrobacterium clones containing the target vector. Specifically, Agrobacterium competent cells (C58C1) were taken from a -80°C freezer, dissolved on ice, and then 4 μl of positive clone DNA was added. The mixture was quickly frozen in liquid nitrogen for 1 minute, then transferred to a 37°C water bath for 5 minutes, and then ice-bathed for 2 minutes. Then, 1 mL of LB liquid medium was added to the mixture, and the mixture was cultured at 28°C and 220 rpm for 3-4 hours. The culture was spread on LB solid medium containing kanamycin 100 mg / L and rifampicin 25 mg / L, and cultured at 28°C for 2-3 days. Agrobacterium clones containing the target vector were visible.

[0090] (9) The Agrobacterium containing the target vector obtained in step (8) is inoculated by streaking and then expanded in LB medium containing kanamycin and rifampicin to obtain a suspension of the LB liquid culture medium of the Agrobacterium containing the target vector; specifically, the Agrobacterium clone containing the target vector is picked and streaked on an LB plate containing kanamycin and rifampicin, and cultured at 28°C for 2-3 days; the streaked bacterial colonies are scraped and inoculated into LB medium containing kanamycin and rifampicin, and cultured at 28°C with shaking at 220 rpm, and the bacterial liquid is collected when the concentration reaches OD=0.5-0.8 for infection.

[0091] (10) The cigar tobacco leaves Yunxue No. 1 and Yunxue No. 2 are used as the transformation receptor. The leaves are treated with ethanol and HgCl2 and then washed with sterile water to remove the surface liquid to obtain sterile leaves; specifically, the wild-type tobacco leaves are placed in a 500 mL wide-mouth bottle, and an appropriate amount of 75% ethanol is added for rinsing for 1 min; the ethanol is discarded, and 0.1% HgCl2 solution is added, and the mixture is shaken on a shaking bed at room temperature for 15-30 min; the solution is discarded, and the leaves are washed with sterile water for 6 times.

[0092] (11) The sterile wild-type cigar tobacco leaves obtained in step (10) are cut into small pieces and then placed in the suspension of the LB liquid culture medium of the Agrobacterium containing the target vector obtained in step (9) for culture, and the leaves are then transferred into a differentiation medium for culture until callus gradually forms at the cut surface and sprouts differentiate; specifically, the sterile wild-type leaves obtained in step (10) are taken out, and the surface liquid is washed off with sterile absorbent paper, and the sterile leaves are cut into small pieces of 1 cm x 1 cm with scissors, and the small pieces are placed in the suspension of the LB liquid culture medium of the Agrobacterium containing the target vector, and left to stand for 15-20 min; the leaves are taken out, and the excess liquid is absorbed with sterile filter paper, and the leaves are cultured in a MS medium containing 6-BA (0.02 mg / L) and NAA (2 mg / L) at 25°C in the dark for two days; the leaves are transferred into a differentiation medium, and the cut surface is in contact with the medium, and the differentiation medium is a MS medium containing 6-BA (0.5 mg / L), NAA (0.1 mg / L), hygromycin (20 mg / L), and cephalosporin (500 mg / L), and the leaves are subcultured every 2-3 weeks, and callus gradually forms at the cut surface, and sprouts finally differentiate.

[0093] (12) When the sprouts in step (11) grow to 3-5 cm, the sprouts are cut, and the cut sprouts are induced to root, and the rooted transgenic plants are transplanted into sterilized nutrient soil to obtain T0 generation transgenic tobacco seedlings; specifically, the sprouts growing to 3-5 cm are cut and transferred into a MS medium for root induction, and the rooted transgenic plants are taken out, washed with tap water to remove the medium, and transplanted into sterilized nutrient soil.

[0094] Experimental Example 3: Sequencing screening of transgenic materials

[0095] (13) After the T0 transgenic seedlings in step (12) have grown for one week, DNA is extracted from leaves. The primer pair U626-IDF / U629-IDR is used to detect positive clones in the transgenic material. Three transgenic materials, T1-KO-11, T1-KO-13, and T1-KO-26, were detected in the transgenic material Yunxue No. 1. Two transgenic materials, T2-KO-4 and T2-KO-25, were detected in the transgenic material Yunxue No. 2.

[0096] Experimental Example 4: Chloride ion content in cigar tobacco leaves from genetically modified materials is significantly reduced

[0097] (14) Greenhouse sowing of the Yunxue No. 1 transgenic materials T1-KO-11, T1-KO-13, T1-KO-26 and Yunxue No. 2 transgenic materials T2-KO-4, T2-KO-25, and wild materials obtained in (13). The seeds were sown in tobacco floating trays, specifically referring to the national standard (GB / T 25241.1-2010 Technical regulations for intensive tobacco seedling cultivation Part 1: Floating seedling cultivation). The tobacco seedlings grew for about 40 days. Ten plants of uniform growth were selected for each transgenic material. All tobacco seedling leaves were taken, fixed at 100°C for 30 minutes, and then dried at 50°C. The leaves were ground into powder and passed through a 40-mesh sieve for chloride ion content testing. The detection method was based on the tobacco industry standard "Continuous flow method for the determination of chlorine in tobacco and tobacco products" (YC / T 162-2011).

[0098] From the test results, as shown in Table 2 and Table 3, Figure 1 and Figure 2 As shown, the chloride ion content of the transgenic materials decreased significantly compared with the control. The chloride ion content of Yunxue 1 transgenic material T1-KO-11 decreased most significantly, by 69.83%. The chloride ion content of Yunxue 2 transgenic material T2-KO-25 decreased most significantly, by 54.04%.

[0099] Table 2. Chloride ion content of Yunxue No. 1 genetically modified material (unit: %)

[0100]

[0101]

[0102] Table 3. Chloride ion content of Yunxue No. 1 genetically modified material (unit: %)

[0103]

[0104] The foregoing describes the basic principles, main features and advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above experimental examples, and the above experimental examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application.

Claims

1. A set of transgenic primers for reducing the chlorine content of cigar tobacco leaves, characterized in that, comprising: upstream and downstream primers P1 and P2 with sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; or upstream and downstream primers P3 and P4 with sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

2. A set of transgenic primers for reducing the chlorine content of cigar tobacco leaves, characterized in that, comprising: upstream and downstream primers P1 and P2 with sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; and upstream and downstream primers P3 and P4 with sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

3. A transgenic vector for reducing the chlorine content of cigar tobacco leaf, characterized in that, a recombinant transgenic vector obtained by connecting a product obtained by PCR amplification using pCBC-DT1T2 plasmid DNA as a template and upstream and downstream primers P1 and P2 with sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively, or upstream and downstream primers P3 and P4 with sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively, to pHSE401 vector.

4. A transformant for reducing the chlorine content of cigar tobacco leaves, characterized in that, a transformant obtained by transforming a recombinant transgenic vector obtained by connecting a product obtained by PCR amplification using pCBC-DT1T2 plasmid DNA as a template and upstream and downstream primers P1 and P2 with sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively, or upstream and downstream primers P3 and P4 with sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively, to pHSE401 vector to a competent cell.

5. The transformant for reducing the chlorine content of cigar tobacco leaves according to claim 4, characterized in that, The competent cell is an Agrobacterium competent cell.

6. The transformant for reducing the chlorine content of cigar tobacco leaves according to claim 5, characterized in that, The Agrobacterium competent cell is Agrobacterium competent cell C58C1.

7. A kit for reducing the chlorine content of cigar tobacco leaf, characterized in that, comprising: upstream and downstream primers P1 and P2 with sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; and / or upstream and downstream primers P3 and P4 with sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

8. A kit for reducing the chlorine content of cigar tobacco leaves according to claim 7, characterized in that, further comprising: PCR reagents, enzyme digestion reagents, ligation and transformation reagents.

9. Use of a set of transgenic primers for reducing the chlorine content of cigar tobacco leaves according to claim 1 or 2, or a transgenic vector for reducing the chlorine content of cigar tobacco leaves according to claim 3, or a transformant for reducing the chlorine content of cigar tobacco leaves according to any one of claims 4-6, or a kit for reducing the chlorine content of cigar tobacco leaves according to claim 7 or 8, in reducing the chlorine content of cigar tobacco leaves.

10. A method of reducing the chlorine content of cigar tobacco leaf, characterized by, comprising: PCR using pCBC-DT1T2 plasmid DNA as a template and upstream and downstream primers P1 and P2 with sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively, or upstream and downstream primers P3 and P4 with sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively, connecting the PCR product to pHSE401 vector, transforming the obtained recombinant vector into Agrobacterium competent cell C58C1 to obtain a transformant, and transfecting the transformant into cigar tobacco material.

11. A method of reducing the chlorine content of cigar tobacco leaf according to claim 10, wherein, The reaction system of each microliter PCR includes: 0.2 μl 5x Reaction Buffer, 2.5 mM dNTP, 10 μM upstream and downstream primers, 0.02 μl pCBC-DT1T2, 0.01 μl Q5 enzyme.

12. The method of reducing the chlorine content of cigar leaf of claim 10, wherein The reaction procedure of PCR includes: 98℃ pre-denaturation for 30 sec; 7 denaturation sec at 98℃, 60℃ annealing for 30 sec, 72℃ extension for 30 sec for 1 cycle, 35 cycles in total; 72℃ for 5 min.

13. The method of reducing the chlorine content of cigar leaf of claim 10, wherein, Before ligation, the pHSE401 vector needs to be cut by enzyme.

14. The method of reducing the chlorine content of cigar leaf of claim 10, wherein, The cigar tobacco material is selected from: Yunxue No. 1 and / or Yunxue No. 2.

Citation Information

Patent Citations

  • Tobacco chloride ion absorbing gene NtSLAC2 and cloning method and application thereof

    CN109439668A

  • Cloning and application of tobacco nornicotine compound regulatory gene NtERF91

    CN110643616A