Application of up20 sequence in enhancing gene expression and method thereof

Abstract

The present invention "Application of up20 sequence in enhancing gene expression and method thereof" belongs to the field of molecular biology technology. On one hand, the present invention provides the application of up20 sequence as shown in SEQ ID NO.1 in enhancing gene expression, and based on the new application of up20 sequence, provides a method for enhancing gene expression and a method for enhancing glyphosate resistance. The present invention has experimentally confirmed that up20 sequence can at least double the expression and enzyme activity of GUS gene in Arabidopsis or tobacco, and up20 sequence can significantly enhance the expression of glyphosate resistance gene. aroA20 Gene expression to improve transformation aroA20 Glyphosate resistance in recombinant Escherichia coli strains expressing the gene.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to the application of up20 sequence in enhancing gene expression and a method thereof. Background Art

[0002] The aroA20 gene has been reported to be involved in the shikimate pathway of Enterobacterium E20 and encodes phosphoenolpyruvate-3-phosphoshikimate synthase (EPSPS). Transgenic studies have found that overexpression of this gene does not confer glyphosate resistance to transgenic plants.

[0003] In the complete genome sequence of Enterobacter E20 (Genbank accession number CP012999.1), positions 1534911 to 1536194 are the gene sequence (aroA20 gene) of phosphoenolpyruvate 3-phosphoshikimate synthase (Genbank accession number ALL16934.1), and positions 1533753 to 1534841 are the gene sequence of 3-phosphoserine aminotransferase (Genbank accession number). There is a 69bp sequence between these two gene sequences, which has not attracted much attention, its function is still unclear, and has not been reported. Summary of the Invention

[0004] Based on the above-mentioned gaps in the prior art, the present invention develops the application of the above-mentioned 69bp sequence in enhancing gene expression and a method for enhancing gene expression based on the application.

[0005] The technical solutions of the present invention are as follows:

[0006] The application of up20 sequence in enhancing gene expression is characterized in that the up20 sequence is as shown in SEQ ID NO.1.

[0007] The gene is selected from the group consisting of: aroA20 gene and / or GUS gene.

[0008] The aroA20 gene is the aroA20 gene of Enterobacter E20.

[0009] The enhancing gene expression is selected from: enhancing the expression of aroA20 gene not by increasing the transcription level, and / or enhancing the expression of GUS gene by increasing the translation level.

[0010] A method for enhancing gene expression, comprising: connecting the gene to an up sequence; the up20 sequence is shown as SEQ ID NO.1.

[0011] The method for enhancing gene expression further comprises: connecting the gene to the up sequence and then connecting it to an overexpression vector to obtain a recombinant expression vector;

[0012] Preferably, the up sequence is linked to the 5' end of the gene.

[0013] The method for enhancing gene expression further comprises: transforming the recombinant expression vector into a host cell to obtain a transformant;

[0014] Preferably, the method further comprises: transfecting a plant with the transformant;

[0015] Preferably, the gene is selected from: aroA20 gene or GUS gene;

[0016] Preferably, the overexpression vector is selected from: pACYC184 vector, p3301-121 vector, p1300-221-35S vector;

[0017] Preferably, the host cell is selected from: Escherichia coli competent cells, Agrobacterium competent cells, yeast cells;

[0018] Preferably, the Escherichia coli competent cells are Escherichia coli ER2799 competent cells;

[0019] Preferably, the plant is selected from the group consisting of: Arabidopsis thaliana or tobacco.

[0020] A method for enhancing glyphosate resistance, characterized by overexpressing a glyphosate resistance gene connected to a up20 sequence; the up20 sequence is shown in SEQ ID NO.1.

[0021] The method for enhancing glyphosate resistance comprises: connecting a glyphosate resistance gene sequence having an up20 sequence connected to the 5' end to an overexpression vector to form a recombinant expression vector;

[0022] Preferably, the method further comprises: transforming the recombinant expression vector into a host cell to obtain a transformant.

[0023] The glyphosate-resistant gene is the aroA20 gene;

[0024] Preferably, the overexpression vector is pACYC184 vector;

[0025] Preferably, the host cell is an Escherichia coli ER2799 competent cell.

[0026] The present invention proposes for the first time the use of the up20 sequence shown in SEQ ID NO. 1 for enhancing gene expression. Experiments demonstrate that the up20 sequence can at least double the expression and enzyme activity of the GUS gene in Arabidopsis or tobacco. Furthermore, the experiments show that the up20 sequence can significantly enhance the expression of the glyphosate-resistant gene aroA20, thereby improving the glyphosate resistance of recombinant Escherichia coli strains transformed with the aroA20 gene. Furthermore, it was found that the up20 sequence enhances aroA20 gene expression not by increasing the transcriptional level, but by increasing the translational level. The novel use of the up sequence for enhancing gene expression, as well as the method for enhancing gene expression and improving glyphosate resistance based on this use, provided by the present invention, has excellent industrial applicability in the field of molecular biology. It can effectively enhance the expression of at least the GUS and aroA20 genes to increase GUS enzyme activity or enhance the glyphosate resistance of a strain. The present invention provides a strategy, research and development direction, and production possibilities for the use of up sequences to enhance the expression of genes other than the GUS and aroA20 genes for subsequent development and production in this field. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a bar graph of the OD values ​​of the resistance experiment of different recombinant strains to different concentrations of glyphosate in Part 1.1 of the experimental example; among them, AroA20: recombinant strain containing plasmid pACYC-aroA20; upAroA20: recombinant strain containing plasmid pACYC-uparoA20; AM79: recombinant strain containing plasmid pACYC-AM79; pACYC184: recombinant strain containing plasmid pACYC184; this figure shows that the up20 sequence can enhance the glyphosate resistance of aroA20 in prokaryotes.

[0028] Figure 2 This is a bar graph of the gene transcription levels of different recombinant vectors of aroA20 in Escherichia coli ER2799 in part 1.2 of the experimental example; among them, AroA20: recombinant strain containing plasmid pACYC-aroA20; upAroA20: recombinant strain containing plasmid pACYC-uparoA20; pACYC184: recombinant strain containing plasmid pACYC184.

[0029] Figure 3These are photos of tobacco seedling growth from the experiment to identify glyphosate resistance of tobacco transformed with the aroA20 gene in part 1.3 of Experimental Example; top: identification of glyphosate resistance of T1 tobacco seedlings transformed with p3301-121sparoA20HA (MS+1mM glyphosate); bottom: identification of glyphosate resistance of T1 tobacco seedlings transformed with p3301-121-sp-uparoA20HA (MS+1mM glyphosate).

[0030] Figure 4 The figure is a bar graph showing the GUS enzyme activity assay in Arabidopsis thaliana transformed with the recombinant plasmids p1300-221-35S-gus and p1300-221-35S-up20-gus, respectively. gus represents the GUS enzyme activity in T2 seedlings of Arabidopsis thaliana transformed with p1300-221-35S-gus; up20-gus represents the GUS enzyme activity in T2 seedlings of Arabidopsis thaliana transformed with p1300-221-35S-up20-gus. wt represents the GUS enzyme activity in wild-type Arabidopsis thaliana.

[0031] Figure 5 The figure is a bar graph showing the GUS enzyme activity assay in tobacco transformed with the recombinant plasmids p1300-221-35S-gus and p1300-221-35S-up20-gus, respectively. gus represents the GUS enzyme activity in T1-generation tobacco seedlings transformed with p1300-221-35S-gus; up20-gus represents the GUS enzyme activity in T1-generation tobacco seedlings transformed with p1300-221-35S-up20-gus. wt represents the GUS enzyme activity in wild-type tobacco. DETAILED DESCRIPTION

[0032] The detailed contents and technical effects of the present invention are further described and confirmed below through specific embodiments and experimental examples, but they do not limit the scope of protection of the present invention.

[0033] Sources of biological materials

[0034] Empty vectors pCambia3301, p1300-221, and pACYC184 are all commercially available; Escherichia coli ER2799 competent cells, tobacco and Arabidopsis seeds are all common competent cells and plant seeds in the art and are all commercially available.

[0035] The E20 strain is the strain whose full genome sequence is recorded in Genbank Accession No. CP012999.1. This strain is currently maintained in the applicant's laboratory. The applicant promises to release it to the public within 20 years from the filing date for use in validating the technical effects of this invention. The full genome sequence of the E20 strain is known. Based on this known full genome sequence, those skilled in the art can use conventional molecular biology techniques to construct transformants containing the full genome sequence of the E20 strain and thereby obtain the E20 strain.

[0036] Group 1 Examples: New Uses of the Up20 Sequence of the Present Invention

[0037] This group of embodiments provides an application of the up20 sequence in enhancing gene expression, characterized in that the up20 sequence is as shown in SEQ ID NO.1.

[0038] In some embodiments, the gene is selected from the group consisting of: aroA20 gene and / or GUS gene.

[0039] The GUS gene is a reporter gene well-known in the field of molecular biology and has conventional technical meanings commonly understood by those skilled in the art.

[0040] In a specific embodiment, the aroA20 gene is the aroA20 gene of Enterobacter E20. The aroA20 gene is a known gene with a Genbank accession number of ALL16934.1 and a DNA sequence as shown in SEQ ID NO.2.

[0041] In a preferred embodiment, the enhancing gene expression is selected from: enhancing the expression of the aroA20 gene not by increasing the transcription level, and / or enhancing the expression of the GUS gene by increasing the translation level.

[0042] Group 2 Examples: Methods of Enhancing Gene Expression of the Present Invention

[0043] This group of embodiments provides a method for enhancing gene expression. All embodiments in this group have the following common features: the method comprises: linking the gene to an up sequence; the up20 sequence is shown in SEQ ID NO.1.

[0044] In a further embodiment, the method for enhancing gene expression further comprises: connecting the gene to the up sequence and then connecting the gene to an overexpression vector to obtain a recombinant expression vector;

[0045] Preferably, the up sequence is linked to the 5' end of the gene.

[0046] In a further embodiment, the method for enhancing gene expression further comprises: transforming the recombinant expression vector into a host cell to obtain a transformant;

[0047] Preferably, the method further comprises: transfecting a plant with the transformant;

[0048] Preferably, the gene is selected from: aroA20 gene or GUS gene;

[0049] Preferably, the overexpression vector is selected from: pACYC184 vector, p3301-121 vector, p1300-221-35S vector;

[0050] Preferably, the host cell is selected from: Escherichia coli competent cells, Agrobacterium competent cells, yeast cells;

[0051] Preferably, the Escherichia coli competent cells are Escherichia coli ER2799 competent cells;

[0052] Preferably, the plant is selected from the group consisting of: Arabidopsis thaliana or tobacco.

[0053] The third group of embodiments, the method for improving glyphosate resistance of the present invention

[0054] This group of embodiments provides a method for enhancing glyphosate resistance. All embodiments in this group share the following common features: overexpressing a glyphosate resistance gene linked to a up20 sequence; the up20 sequence is shown in SEQ ID NO. 1.

[0055] In some embodiments, the method for enhancing glyphosate resistance comprises: connecting a glyphosate resistance gene sequence having an up20 sequence connected to the 5' end to an overexpression vector to form a recombinant expression vector;

[0056] Preferably, the method further comprises: transforming the recombinant expression vector into a host cell to obtain a transformant.

[0057] In other embodiments, the glyphosate resistance gene is the aroA20 gene;

[0058] Preferably, the overexpression vector is pACYC184 vector;

[0059] Preferably, the host cell is an Escherichia coli ER2799 competent cell.

[0060] Experimental example: Experiment on enhancing gene expression using up sequence

[0061] 1 Materials and Methods

[0062] 1.1 Main experimental materials

[0063] 1.1.1 Plasmids and strains

[0064] Table 1. Strains and plasmids used in this experiment

[0065]

[0066] 1.2 Main experimental methods

[0067] 1.2.1 Extraction of bacterial genomic DNA

[0068] Bacterial genomic DNA was extracted according to the EasyPure method of Beijing Quanshijin Biotechnology Co., Ltd. TM Genomic DNA Kit Instructions:

[0069] 1) Take 1-5 mL of bacterial culture medium and centrifuge at 12000 rpm for 1 minute. Aspirate the supernatant as much as possible.

[0070] 2) Add 100 μL LB2 and 20 μL Proteinase K to the bacterial pellet and shake until the bacteria are completely suspended.

[0071] 3) Incubate at 55°C for 15 minutes. If RNA removal is required, add 20 μL of RNase A to the sample and incubate at room temperature for 2 minutes.

[0072] 4) Add 500 μL of BB2, vortex immediately for 5 seconds, and incubate at 70°C for 10 minutes.

[0073] 5) Add all the solution to the centrifuge column, centrifuge at 12000 rpm for 30 seconds, and discard the effluent.

[0074] 6) Add 500 μL of solution CB2, centrifuge at 12,000 rpm for 30 seconds, and discard the flow-through.

[0075] 7) Repeat step 4 once.

[0076] 8) Add 500 μL of WB2 solution (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, and discard the flow-through.

[0077] 9) Repeat step 6 once.

[0078] 10) Centrifuge at 12000 rpm for 2 minutes to completely remove residual WB2.

[0079] 11) Place the spin column in a clean centrifuge tube. Add 200 μL of preheated EB (60°C) or deionized water (pH > 7.0) to the center of the column. Let stand at room temperature for 1 minute. Centrifuge at 12,000 rpm for 1 minute to elute the DNA.

[0080] 12) To obtain more DNA, perform a second elution. Add 200 μL of preheated EB (60°C) or deionized water (pH > 7.0) to the center of the column. Let stand at room temperature for 1 minute. Centrifuge at 12,000 rpm for 1 minute to elute the DNA. Store the eluted DNA at -20°C.

[0081] 1.2.2 Recovery and purification of DNA fragments

[0082] Genomic DNA was partially digested with Sau3AI, and the product was recovered according to the instructions of the TIANgel Midi Purification Kit from Beijing Tiangen Biochemical Biotechnology Co., Ltd.

[0083] 1) Add 500 μL of equilibration solution BL to the adsorption column CA2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube.

[0084] 2) Cut the target DNA band from the agarose gel, place it in a clean centrifuge tube, and weigh it.

[0085] 3) Add 3 times the volume of sol solution PN to the gel block and place it in a 50℃ water bath for 10 minutes. During this time, gently turn the centrifuge tube upside down to ensure that the gel block is fully dissolved.

[0086] 4) Add the solution obtained in the previous step to an adsorption column CA2 (place the adsorption column in a collection tube), leave it at room temperature for 2 minutes, centrifuge it at 12,000 rpm for 30-60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CA2 in the collection tube.

[0087] 5) Add 600 μL of rinse solution PW to the adsorption column CA2 (please check whether anhydrous ethanol has been added before use). Centrifuge at 12,000 rpm for 30-60 seconds. Discard the waste liquid in the collection tube and place the adsorption column CA2 in the collection tube.

[0088] 6) Repeat step 5.

[0089] 7) Return the adsorption column CA2 to the collection tube and centrifuge at 12,000 rpm for 2 minutes to remove as much of the rinse solution as possible. Allow the adsorption column CA2 to dry thoroughly at room temperature for several minutes to prevent residual rinse solution from interfering with the next step of the experiment.

[0090] 8) Place the adsorption column CA2 in a clean centrifuge tube and add an appropriate amount of elution buffer EB dropwise to the middle of the adsorption membrane. Incubate at room temperature for 2 minutes. Centrifuge at 12,000 rpm for 2 minutes to collect the DNA solution and store at -20°C for later use.

[0091] 1.2.3 Screening and identification of glyphosate-resistant clones

[0092] The recovered DNA digest was ligated to the BamHI-digested pACYC184 vector using T4 DNA ligase overnight at 16°C. The ligation product was transformed into competent Escherichia coli ER2799 by electroporation, plated onto M9 solid medium containing 50 mM glyphosate, and incubated at 37°C for 48 hours.

[0093] After plasmids were extracted from resistant clones, they were detected by enzyme digestion and the sequences were analyzed by sequencing.

[0094] Tail-PCR cloning of aroA gene

[0095] Upstream primer (degenerate primer)

[0096] aroA-random-S:

[0097] GTAATACGACTCACTATAGGAADMGNCCDWTDRR(SEQ ID NO.3)

[0098] Among them, D stands for A / G / T;

[0099] M stands for A / C;

[0100] N stands for A / C / G / T;

[0101] W stands for A / T;

[0102] R stands for A / G;

[0103] 18 base letters commonly used in bioinformatics

[0104] letter bases Full name illustrate Single base A A Adenine Adenine C C Cytosine Cytosine G G Guanine Guanine I I Isosine Hypoxanthine T T Thymine Thymine U U Uracil Uracil dibase K G / T Keto Ketone M A / C aMino Contains amino R A / G puRine Purine S G / C Strong pair Strong pairing W A / T Weak pair Weak pairing Y C / T pYrimidine Pyrimidine Tribase B C / G / T Not A Non-A D A / G / T Not C Non-C H A / C / T Not G Non-G V A / C / G Not U (or T) Non-U(T) Four bases N A / C / G / T Any Any base X A / C / G / T Unknown Unknown base

[0105] Downstream primer (anchor primer)

[0106] aroA-universal-A:

[0107] GTAATACGACTCACTATAGGCATGGCGATGCGATGATC(SEQ ID NO.4)

[0108] Tail-PCR procedure

[0109]

[0110]

[0111] 1.2.4 Construction of expression vector

[0112] The plant expression vector was based on p3301-121spAM79, with the AM79 sequence replaced. The stop codon at the 3' end of the aroA20 gene was removed, and an HA tag sequence was added. This completed the construction of the p3301-121sparoA20HA vector. To verify the role of the up20 sequence in gene expression regulation, this sequence was inserted into the 5' end of the aroA20 gene in the p3301-121sparoA20HA vector via enzyme digestion and ligation, forming the recombinant plasmid p3301-121spuparoA20HA. Furthermore, the up20 sequence was inserted into the gus gene of the plant expression vector P1300-221-35S-gus to analyze its effect on GUS protease activity.

[0113] The p3301-121spAM79 vector was constructed based on the empty vector pCambia3301, with sequence optimization and modification, and restriction enzyme sites adjusted. The primers used to construct p3301-121spAM79 are as follows:

[0114] B-AM79-SS

[0115] AATGGATCCATGTCACATTCTACCTCT(SEQ ID NO.5)

[0116] B-AM79-SA

[0117] CGGAGCTCTTAATTATACTCCACATG(SEQ ID NO.6)

[0118] The primers used to construct the p3301-121spuparoA20HA vector are:

[0119] Primer1: BamHI-up20-Aro20F

[0120] GGAGGATCCTTTGCTGTTTTTCAC(SEQ ID NO.7)

[0121] Primer2:XbaI-up20R

[0122] GCCTTCTAGAGAAAACTAAACTCTCAA(SEQ ID NO.8)

[0123] By using the traditional enzyme digestion and ligation method, the signal peptide and up20+aroA20 between the BamHI and SalI restriction sites were replaced with the aroA20 sequence, and the p3301-121sparoA20HA plasmid in Table 1 was constructed accordingly.

[0124] The PCR reaction system used to construct the above vector is as follows: total volume 30 μL

[0125] 5x Phusion Buffer: 8 μL

[0126] 10mM dNTP Mix: 0.8μL

[0127] Primer F: 2 μL

[0128] Primer R: 2 μL

[0129] Template: 2 μL

[0130] Phusion PoLymerase: 0.4 μL

[0131] ddH2O: 14.8 μL

[0132] The PCR amplification reaction procedure is as follows:

[0133]

[0134] The prokaryotic expression vector was based on pACYC-BAM79S, with the aroA20 sequence and up20-aroA20 sequence inserted into the BamHI and SalI restriction sites of pACYC184, respectively. All vectors were verified by restriction enzyme digestion and sequencing.

[0135] The prokaryotic expression vector pACYC-BAM79S was constructed based on the empty vector pACYC184, with sequence optimization and modification, and restriction enzyme sites adjusted. The primers used to construct pACYC-BAM79S were:

[0136] BamHI-AM79-SalI-S:AAT GGATCC ATTGTCACATTCTACCTCT(SEQ ID NO.9)

[0137] BamHI-AM79-SalI-A:CGGAG CTC TTAATTATACTCCACATG(SEQ ID NO.10)

[0138] By using the traditional enzyme digestion and ligation method, the AM79 between the BamHI and SalI restriction sites was replaced with the aroA20 sequence and the up20-aroA20 sequence, and the pACYC-aroA20 and pACYC-uparoA20 plasmids in Table 1 were constructed accordingly.

[0139] PCR reaction system and procedure:

[0140] Reaction system 30 μL

[0141] 5x Phusion Buffer: 8 μL

[0142] 10mM dNTP Mix: 0.8μL

[0143] Primer F: 2 μL

[0144] Primer R: 2 μL

[0145] Template: 2 μL

[0146] Phusion PoLymerase: 0.4 μL

[0147] ddH2O: 14.8μL.

[0148] The PCR amplification reaction procedure is as follows:

[0149]

[0150] 1.2.5 Identification of glyphosate resistance of recombinant strains

[0151] Construct a recombinant vector containing the relevant EPSPS encoding gene and transform it into ER2799 competent cells. Plate the cells onto LB solid medium containing the corresponding antibiotic, and detect single clones using PCR. Select a single clone and incubate in 5 mL of LB liquid medium containing the corresponding antibiotic at 37°C until the OD600 reaches 0.5. Collect the cells and resuspend them in liquid M9 medium without glyphosate to an OD600 of 0.5. Transfer an equal volume of the resuspended cells to liquid M9 medium containing various concentrations of glyphosate and incubate at 37°C, 200 rpm, with shaking for 16 hours. The culture suspension is then sampled for OD600 measurement.

[0152] 1.2.6 Agrobacterium-mediated tobacco transformation

[0153] Agrobacterium-mediated tobacco transformation was performed according to the method of Horsch et al. (Horsch et al., 1985):

[0154] 1) Take the leaves of sterile tobacco seedlings, remove the leaf edges and main veins, and cut into pieces of 0.5 × 0.5 cm2;

[0155] 2) Soak the cut leaf tissue in the Agrobacterium solution containing the transformation vector for 10 minutes;

[0156] 3) Remove the leaf, blot the surface of the bacterial solution with sterile filter paper, transfer to MS solid medium covered with a layer of sterile filter paper, and incubate in the dark at 28°C for three days;

[0157] 4) Transfer the co-cultured material to differentiation medium containing antibiotics (MS minimal medium + 3 mg / L 6-BA + 0.2 mg / L NAA + 10 mg / L PPT + 500 mg / L Cef) and culture at 28°C with 16 hours of light and 8 hours of darkness;

[0158] 5) When the resistant buds grow to 2 cm in height, the bud tissue is excised and transferred to rooting medium (MS minimal medium + PPT 10 mg / L + Cef 500 mg / L) to induce rooting;

[0159] 6) After the regenerated seedlings have obvious root systems, transplant them into large flower pots in the greenhouse and grow normally until harvest.

[0160] 1.2.7 Agrobacterium-mediated transformation of Arabidopsis

[0161] The Arabidopsis transformation method is reported by Clough et al. (Clough and Bent, 1998).

[0162] 1.2.8 Identification of plant glyphosate resistance

[0163] T1 transgenic tobacco seeds were surface-sterilized (70% ethanol for 1 min, 0.5% sodium hypochlorite for 10 min, and rinsed six times with sterile water) and seeded on MS medium containing 10 mg / L PPT. The seeds were cultured at 25°C under 16 hr light / 8 hr dark conditions. One week later, positive seedlings with consistent growth were transplanted to MS medium containing different concentrations of glyphosate and grown vertically for 2 weeks. The phenotypes were then observed and biomass was counted.

[0164] Tobacco T1 seedlings grown normally on MS medium containing 10 mg / L PPT were transplanted into greenhouse plug trays and sprayed with glyphosate isopropylamine salt solutions of varying concentrations at the 6-8 leaf stage. Growth was observed two weeks later, and survival rates were calculated.

[0165] The resulting T1 transgenic corn plants were sprayed in the field with 1x the concentration of glyphosate (approximately 4 g / L), and their growth was observed after three weeks. Plants from the selected glyphosate-resistant lines were self-pollinated to obtain T2 seeds, which were then planted in the field and sprayed with 4x the field-use concentration of glyphosate (approximately 16 g / L), and their growth was observed.

[0166] 1.2.9 GUS staining

[0167] 1) Fix the stained material in 90% acetone for 15-20 minutes;

[0168] 2) After rinsing, add GUS staining solution and vacuum pump for 30 minutes, then incubate at 37°C overnight;

[0169] 3) After decolorization with ethanol (30, 50, 70, 95, 100% in sequence), the results were observed under a microscope.

[0170] GUS staining solution formula: 100 mmol / L phosphate buffer pH 7.0, 0.5% Triton X-100, 20% methanol, X-Gluc 0.5 mg / mL

[0171] 1.2.10 GUS enzyme activity assay

[0172] 1) Prepare 1 mM / L 4-MU (4-methylumbelliferone) in the reaction stop solution and serially dilute it to concentrations of 1000, 500, 250, 125, 62.5, 31.5, and 15.625 nM / L. Construct a standard curve by measuring their fluorescence intensities.

[0173] 2) Take about 0.1g of material into a 2mL centrifuge tube, grind it with liquid nitrogen, and add 0.6mL of protein extraction solution;

[0174] 3) 4°C, 13,000 rpm, 10 min, collect the supernatant;

[0175] 4) Take an appropriate amount of supernatant and determine the protein content using the Coomassie brilliant blue method

[0176] 5) Add 10 μl of GUS-containing supernatant to the ELISA plate, followed by 100 μl of GUS detection solution (2 mM / LMUG solution). Mix thoroughly and quickly. Measure the amount of 4-MU generated using a fluorescence spectrophotometer at an excitation wavelength of 365 nm and an emission wavelength of 455 nm. Calculate the GUS enzyme activity based on the standard curve.

[0177] 3 Results

[0178] 3.1 Construction of a prokaryotic expression vector containing the up20 sequence and identification of glyphosate resistance in Escherichia coli

[0179] The up20+aroA20 sequence was constructed into pACYC184 by PCR, generating the recombinant plasmid pACYC-uparoA20. The recombinant plasmid was transformed into competent E. coli ER2799 cells using the freeze-thaw method and plated onto LB solid medium containing Chl. Positive clones were identified by PCR. A recombinant strain (AroA20) containing the plasmids pACYC184, pACYC-AM79 (AM79 is an EPSP synthase described in Chinese Patent 200710177090.1 and has been reported to be resistant to glyphosate; the amino acid and DNA sequences of AM79 are both described in Chinese Patent 200710177090.1), and pACYC-aroA20 was used as a reference. Three single clones were selected for each vector and cultured overnight in 5 mL of LB liquid medium to an OD600 of approximately 0.6. The cells were then collected by centrifugation and resuspended in liquid M9 medium to an OD600 of 0.5. 0.5 mL of resuspended cells were added to 200 mL of liquid M9 medium containing various glyphosate concentrations. The cultures were shaken at 200 rpm. After 16 hours of culture (when the recombinant strain reached logarithmic growth), the OD600 was measured. Glyphosate concentrations of 0 mM, 5 mM, 10 mM, 20 mM, 50 mM, 100 mM, 150 mM, and 200 mM were selected.

[0180] The results showed that aroA20, driven by up20, and the recombinant plasmid pACYC-uparoA20 could confer high glyphosate resistance to the ER2799 strain. Compared with the strain containing the recombinant plasmid pACYC-aroA20, its glyphosate resistance was significantly enhanced. The recombinant strain containing the plasmid pACYC-uparoA20 grew better than the recombinant strain containing the plasmid pACYC-AM79 under glyphosate stress conditions below 50 mM ( Figure 1 ).

[0181] 3.2 Analysis of the transcription of the aroA20 gene in E. coli

[0182] To determine whether up20 enhances the transcription of aroA20 and thereby enhances glyphosate resistance in the recombinant strain, real-time RT-PCR was used to detect the transcription of aroA20 in recombinant strains containing aroA20 and uparoA20 before and after 200 mM glyphosate stress, using the recombinant strain containing the pACYC184 plasmid as a control.

[0183] Real-time RT-PCR was used to detect the expression of aroA20. The primers used were:

[0184] 20-qRT-F

[0185] ACCATCAATCTGCCTGGTTC(SEQ ID NO.11)

[0186] 20-qRT-R

[0187] AATGAACCGCCACACACTTTC(SEQ ID NO.12)

[0188] PCR system and method:

[0189] 1) Amplification of target fragment: 30 μL reaction system

[0190] 5x Phusion Buffer: 8 μL

[0191] 10mM dNTP Mix: 0.8μL

[0192] Primer F: 2 μL

[0193] Primer R: 2 μL

[0194] cDNA: 2 μL

[0195] Phusion PoLymerase: 0.4 μL

[0196] ddH2O: 14.8 μL

[0197] The PCR amplification reaction procedure is as follows:

[0198]

[0199]

[0200] (1) Real-time PCR reaction system:

[0201] 20 μL reaction system

[0202] 2×UltraSYBR Mixture 10μL

[0203] Forward Primer, 10 μM, 0.2 μL

[0204] Reverse Primer, 10 μM 0.2 μL

[0205] cDNA 2 μL

[0206] ddH2O 17.6μL.

[0207] (2) Real-time PCR reaction program: Two-step PCR is used for program setting

[0208] Pre-denaturation: 95℃ for 10min

[0209] Denaturation 95℃ for 15s

[0210] Annealing / extension 60℃ 1min

[0211] Melting curve analysis:

[0212] 95℃15s

[0213] 60℃1min

[0214] 95℃15s

[0215] 60℃15s

[0216] Denaturation and annealing / extension were performed for 35-40 cycles.

[0217] The experimental method was as described above. 0.5 mL of resuspended cells were added to 200 mL of liquid M9 medium containing Chl. When the recombinant strain grew to the logarithmic phase, 2 mL of the cells were taken for use. 200 mM glyphosate was added to the remaining cells and the culture was continued for 1 hour. Then 2 mL of glyphosate-treated cells were taken for use. Total RNA was extracted and reverse transcribed. The transcription level of the target gene was detected by real-time RT-PCR. Bacterial 16S rRNA was used as an internal reference. The experimental results were expressed as Ct gene / Ct 16S express.

[0218] The results showed that there was no significant difference in the transcription level of the aroA20 gene in the recombinant strains containing aroA20 and uparoA20 before and after glyphosate stress, indicating that the improved glyphosate resistance of the recombinant strain containing uparoA20 was not due to the increase in the transcription of the aroA20 gene by the up20 sequence, but that the up20 sequence may regulate the expression of the aroA20 gene in other ways ( Figure 2 ).

[0219] 3.3 Construction of plant expression vectors and genetic transformation into wild-type tobacco and Arabidopsis

[0220] To evaluate the glyphosate resistance of the aroA20 gene and investigate the regulatory effect of up20 on aroA20, a plant expression vector was constructed according to the method described in 1.2.4 above. The aroA20 gene stop codon was removed, and an HA tag was added to the 3' end. The AM79 sequence in the plant expression vector p3301-121spAM79 was replaced to complete the construction of p3301-121sparoA20HA and p3301-121spuparoA20HA. The vectors were verified to be correct by restriction enzyme digestion and sequencing.

[0221] To further investigate the role of the up20 sequence in regulating gene expression, this experiment linked the up20 sequence to the front end of the gus gene, and together they were driven by CaMV35S to construct the plant expression vector p1300-221-35S-up20-gus (the p1300-221-35S-gus plant expression vector is maintained in our laboratory). The constructed vector was verified by restriction enzyme sequencing.

[0222] The plant expression vector p1300-221-35S-gus was based on the p1300-221 empty vector, with sequence optimization and modification, and the restriction enzyme cutting sites on the vector were adjusted.

[0223] The primers for constructing p1300-221-35S-gus are as follows:

[0224] GUS-S:CCAACTCCTACCGTACCTC(SEQ ID NO.13)

[0225] GUS-A:TCGAAACCAATGCCTAAA(SEQ ID NO.14)

[0226] The PCR reaction system is as follows:

[0227] Total volume 30 μL

[0228] 5x Phusion Buffer: 8 μL

[0229] 10mM dNTP Mix: 0.8μL

[0230] Primer F: 2 μL

[0231] Primer R: 2 μL

[0232] cDNA: 2 μL

[0233] Phusion PoLymerase: 0.4 μL

[0234] ddH2O: 14.8 μL

[0235] The PCR reaction procedure is as follows:

[0236]

[0237]

[0238] By conventional enzyme digestion and ligation methods, the up20 sequence was connected between the BamHI and SalI restriction sites to construct the p1300-221-35S-up20-gus plasmid in Table 1.

[0239] The plant expression vectors p3301-121sparoA20HA, p3301-121-sp-uparoA20HA and p1300-221-35S-up20-gus were transformed into wild-type tobacco by Agrobacterium-mediated method, and p1300-221-35S-up20-gus was transformed into wild-type Arabidopsis thaliana by Agrobacterium-mediated method.

[0240] 3.4 Identification of glyphosate resistance in transgenic tobacco

[0241] The method for identifying glyphosate resistance in transgenic tobacco was the same as that for screening transgenic tobacco lines derived from aroA818. For details, see “Gaoyi Cao, Yunjun Liu, Shengxue Zhang, Xuewen Yang, Rongrong Chen, Yuwen Zhang, Wei Lu, Yan Liu, Jianhua Wang, Min Lin, Guoying Wang. A Novel 5-Enolpyruvylshikimate-3-Phosphate Synthase Shows High Glyphosate Tolerance in Escherichia coli and Tobacco Plants. PLoS ONE 2012, 7(6): e38718.”

[0242] doi:10.1371 / journal.pone.0038718." In this experiment, T1 seedlings were germinated normally on MS medium containing 10 mg / L PPT and then transplanted to MS medium containing 1 mM glyphosate for two weeks. The results showed that the p3301-121sparoA20HA recombinant plasmid did not confer high glyphosate resistance on the transgenic tobacco. Furthermore, the up20 sequence in the p3301-121-sp-uparoA20HA recombinant plasmid did not regulate the aroA20 gene to enhance glyphosate resistance in the transgenic tobacco. Figure 3 ).

[0243] 3.5 up20 sequence enhances gus gene expression

[0244] The recombinant plasmid p1300-221-35S-gus and the recombinant plasmid p1300-221-35S-up20-gus were transformed into wild-type tobacco and Arabidopsis, respectively. In this experiment, transgenic tobacco T1 seedlings and transgenic Arabidopsis T2 seedlings were used to extract their GUS protein and determine their enzyme activity.

[0245] The results showed that under the regulation of up20, the GUS enzyme activity of the gus gene can be increased by two times in transgenic Arabidopsis ( Figure 5 ), and can be increased by nearly double in genetically modified tobacco ( Figure 4 ). up20 and gus genes are driven by CaMV35S at the same time, and up20 can enhance the expression of gus gene at the translation level.

Claims

1. Application of up20 sequence in enhancing gene expression, characterized in that: The up20 sequence is shown in SEQ ID NO.1; the gene is selected from: aroA20 Gene or GUS gene; said enhanced gene expression is selected from: enhancing by not increasing transcription level aroA20 The expression of the gene can be enhanced by increasing the translation level.

2. The use of the up20 sequence according to claim 1 in enhancing gene expression, characterized in that described aroA20 Enterobacter E20 aroA20 Gene.

3. A method for enhancing gene expression, characterized in that: include: The gene is linked to the up20 sequence; the up20 sequence is shown in SEQ ID NO.1; the gene is selected from: aroA20 gene or GUS gene; The gene is connected to the up20 sequence and then connected to the overexpression vector to obtain a recombinant expression vector; the overexpression vector is selected from: pACYC184 vector, p3301-121 vector, p1300-221-35S vector; wherein, aroA20 The gene is connected to the up20 sequence and then connected to the pACYC184 vector to obtain a recombinant expression vector; the GUS gene is connected to the up20 sequence and then connected to the pACYC184 vector or the p3301-121 vector or the p1300-221-35S vector to obtain a recombinant expression vector; the up20 sequence is connected to the 5' end of the gene.

4. The method for enhancing gene expression according to claim 3, wherein: Also includes: The recombinant expression vector is transformed into a host cell to obtain a transformant.

5. The method for enhancing gene expression according to claim 4, wherein: The method further comprises: transfecting a plant with the transformant.

6. The method for enhancing gene expression according to claim 4, wherein: The host cell is selected from the group consisting of: Escherichia coli competent cells, Agrobacterium competent cells, and yeast cells.

7. The method for enhancing gene expression according to claim 6, wherein: The Escherichia coli competent cells are Escherichia coli ER2799 competent cells.

8. The method for enhancing gene expression according to claim 5, wherein: The plant is selected from Arabidopsis thaliana or tobacco.

9. A method for enhancing glyphosate resistance, characterized in that: Overexpression of a glyphosate resistance gene connected to an up20 sequence; the up20 sequence is shown in SEQ ID NO.1; the glyphosate resistance gene sequence connected to the up20 sequence at the 5' end is connected to an overexpression vector to form a recombinant expression vector; the glyphosate resistance gene is aroA20 gene; the overexpression vector is pACYC184 vector.

10. The method for enhancing glyphosate resistance according to claim 9, wherein: described aroA20 The Genbank accession number of the gene is ALL16934.1, and the DNA sequence is shown in SEQ ID NO.

2.

11. A method for enhancing glyphosate resistance according to claim 9 or 10, characterized in that: The method further comprises: transforming the recombinant expression vector into a host cell to obtain a transformant.

12. The method for enhancing glyphosate resistance according to claim 11, wherein: The host cell is Escherichia coli ER2799 competent cell.

Images