An improved ccdB protein encoding gene and its related biological materials and applications

Abstract

The present invention discloses an improved ccdB protein encoding gene and its related biomaterials and applications, belonging to the field of genetic engineering technology. The improved ccdB protein encoding gene has a nucleotide sequence shown in any one of SEQ ID NO.2 to SEQ ID NO.7. The present invention also discloses biomaterials related to the improved ccdB protein encoding gene. The use of the improved ccdB protein encoding gene or its related biomaterials in the present invention to prepare monoclonal antibody-related proteins can greatly improve the conversion efficiency, is suitable for the development and production of high-throughput monoclonal antibodies, and has very good application value.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an improved ccdB protein encoding gene and related biological materials and applications thereof. Background Art

[0002] After years of development, monoclonal antibodies have extended from the laboratory to clinical diagnosis and therapeutic monoclonal antibody drugs, playing an increasingly important role in basic scientific research and various fields of life sciences. B cell cloning technology is a new technology for rapid preparation of monoclonal antibodies developed in recent years. Based on the characteristics of a single B cell producing only one specific antibody, the full length or variable region genes of IgG heavy chain and light chain are amplified from a single antibody-secreting B cell through molecular cloning technology and constructed into a vector, and then expressed in mammalian cells to obtain biologically active monoclonal antibodies. This method not only retains the natural pairing of heavy and light chains, but also has the characteristics of good gene diversity, high efficiency, and all-natural origin. It has also become an important strategy for the rapid development of diagnostic antibody raw materials and therapeutic antibody drug precursors. However, the success rate of high-throughput antibody gene recombination is still one of the difficulties faced by B cell cloning technology, that is, how to quickly and efficiently achieve large-scale recombinant vector construction after obtaining a large number of antibody genes through PCR.

[0003] One of the processes of B cell cloning technology is to clone the heavy chain and light chain genes of the antibody into an expression vector to obtain a large number of recombinant plasmids to transfect mammalian cells, such as HEK293 cells, CHO cells, etc., to express and produce genetically engineered antibodies. The traditional molecular cloning method uses the (double) enzyme digestion-dephosphorylation method to prepare the vector, and purifies the vector by gel recovery method or magnetic bead method. However, there have always been problems of incomplete enzyme digestion and incomplete dephosphorylation, which will cause the vector to self-link to produce empty vectors, thereby affecting the success rate of high-throughput recombination. In order to solve this problem, suicide genes such as ccdB can be introduced to make the host bacteria containing self-linked empty vectors unable to survive, thereby increasing the recombination positive rate.

[0004] The suicide gene ccdB encodes a toxin protein ccdB containing 101 amino acids. Intracellular and extracellular experiments have shown that ccdB can bind to the helicase-DNA complex and prevent the re-stitching of DNA gaps, resulting in double-stranded DNA damage, preventing the passage of DNA and RNA polymerases, affecting DNA replication and transcription, and thus leading to cell death. Due to the strong toxic effect of ccdB, ccdB can be constructed into an expression vector and then transformed into E. coli competent cells. The expression product of ccdB can inhibit the growth of ordinary E. coli, so only those E. coli that have successfully cloned foreign genes can grow normally, while the vectors that were not cut or self-circularized during cloning still contain the ccdB gene, so the E. coli transformed by them cannot grow after transformation. The clones that grow in this way are the desired clones containing foreign genes.

[0005] The introduction of suicide genes such as ccdB into vectors is a major advancement in molecular cloning technology. Compared with vectors without suicide genes, it can significantly reduce the proportion of self-ligated empty vectors and achieve a recombination success rate of more than 90%, but it still cannot completely eliminate empty vectors. This will still produce a small number of false positives in large-scale, high-throughput vector construction, bringing uncertainty to downstream expression, so the primers of the natural ccdB gene still cannot meet the needs of high-throughput recombinant antibody construction. Summary of the invention

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0007] The first aspect of the present invention provides an improved ccdB protein encoding gene, wherein the improved ccdB protein encoding gene has a nucleotide sequence shown in any one of SEQ ID NO.2 to SEQ ID NO.7.

[0008] In the present invention, the improved ccdB protein coding gene is obtained by codon optimization of ccdB protein. Codon plays a key role in the transfer process of mRNA of organism genetic information to protein. There are 61 codons encoding 20 different amino acids, among which only Met and Trp two kinds of amino acids are encoded by a codon, and other 18 kinds of amino acids are encoded by 2 or more codons, which are called synonymous codons. In the synthesis process of protein, the usage probability of synonymous codons is not the same. A certain species or a certain gene usually tends to use one or several specific synonymous codons, and these codons are called optimal codons, and this phenomenon is called codon preference.

[0009] In the present invention, according to the codon preference of Escherichia coli, the ccdB gene was codon optimized from three aspects: codon adaptation index (CAI), rare codons and GC content, and an improved ccdB protein encoding gene having the nucleotide sequence shown in SEQ ID NO.2 and SEQ ID NO.3 was obtained.

[0010] Codon Adaptation Index (CAI) refers to the degree of consistency between the usage frequency of synonymous codons and optimal codons in the coding region, and the value is between 0 and 1. CAI can be used to evaluate the expression level of exogenous genes in the host. The higher the CAI, the higher the expression level of the exogenous gene in the host2. Most organisms have certain preferences in the use of codons when synthesizing proteins. The most frequently used codons are called optimal codons, and those that are not frequently used are called rare codons. The GC content in the gene sequence will affect the stability of DNA, the secondary structure of mRNA, etc., and indirectly affect the expression and regulation of genes. The higher the rare codons and GC content in the gene sequence, the lower the efficiency of protein expression. Therefore, the expression efficiency of genes in host cells can be effectively improved by optimizing rare codons and GC content.

[0011] Furthermore, the inventors unexpectedly discovered that when the codon of P28 is CCT or CCA and the codon of W100 is GGT or GGA, the expression level of the ccdB gene is the highest and the suicide effect is the best, thereby obtaining an improved ccdB protein encoding gene having a nucleotide sequence shown in SEQ ID NO.4 to SEQ ID NO.7.

[0012] The second aspect of the present invention provides a biological material related to the improved ccdB protein encoding gene described in the first aspect of the present invention, which is any one of the following B1) to B7):

[0013] B1) an expression cassette containing the improved ccdB protein encoding gene according to claim 1;

[0014] B2) a recombinant vector containing the improved ccdB protein encoding gene according to claim 1;

[0015] B3) a recombinant vector containing the expression cassette described in B1);

[0016] B4) a recombinant microorganism containing the improved ccdB protein encoding gene according to claim 1;

[0017] B5) a recombinant microorganism containing the expression cassette described in B1);

[0018] B6) a recombinant microorganism containing the recombinant vector described in B2);

[0019] B7) A recombinant microorganism containing the recombinant vector described in B3).

[0020] In the present invention, the expression cassette refers to a DNA molecule including a promoter, a target gene and a terminator.

[0021] In some embodiments of the present invention, the vector is selected from the group consisting of a pcDNA vector, a pTT5 vector, a pCMV vector, a pCEP vector, a pBV vector and a pSV2 vector. In some specific embodiments of the present invention, the vector is a pBV vector.

[0022] In some embodiments of the present invention, the recombinant microorganism is a bacterium. Further, the bacterium is Escherichia coli, and further, the Escherichia coli is selected from the group consisting of DH5α, Top10 and JM109. In some preferred embodiments of the present invention, the Escherichia coli is DH5α.

[0023] The third aspect of the present invention provides use of the improved ccdB protein encoding gene described in the first aspect of the present invention or the biomaterial described in the second aspect of the present invention in preparing a target protein.

[0024] A fourth aspect of the present invention provides a method for preparing a target protein, comprising:

[0025] S1, obtaining a recombinant vector containing the improved ccdB protein encoding gene according to the first aspect of the present invention, and setting a first restriction site and a second restriction site at both ends of the improved ccdB protein encoding gene respectively;

[0026] S2, setting the same first restriction site and second restriction site at both ends of the target protein encoding gene;

[0027] S3, using the endonucleases corresponding to the first restriction site and the second restriction site to perform double restriction digestion on the recombinant vector and the target protein encoding gene, and connecting the target protein encoding gene to the recombinant vector, and the successfully connected plasmid is a positive plasmid;

[0028] S4, transforming the ligation product into host cells, and screening the recombinant cells containing the positive plasmid using the plate method and expressing them.

[0029] By using this method, in the recombinant vector successfully connected with the coding gene of the target protein, the suicide gene, i.e. the improved ccdB protein coding gene, is replaced by the coding gene of the target protein, so that the corresponding host cell can grow on the plate. On the contrary, after the recombinant vector without the coding gene of the target protein is transformed into the host cell, the suicide gene, i.e. the improved ccdB protein coding gene, can still be expressed, so that the host cannot grow. In this way, the positive clone rate can be improved, and the efficiency of obtaining positive recombinant hosts can be improved.

[0030] In some embodiments of the present invention, the specific steps of obtaining the recombinant vector in step S1 are as follows:

[0031] S11, obtaining an empty vector comprising the first restriction enzyme cutting site and the second restriction enzyme cutting site;

[0032] S12, linearizing the empty vector using endonucleases corresponding to the first restriction site and the second restriction site to obtain a linearized vector;

[0033] S13, using T4 DNA ligase to connect the improved ccdB protein encoding gene with the linearized vector to obtain the recombinant vector.

[0034] In some embodiments of the present invention, the vector is selected from the group consisting of a pcDNA vector, a pTT5 vector, a pCMV vector, a pCEP vector, a pBV vector and a pSV2 vector. In some specific embodiments of the present invention, the vector is a pBV vector. Further, the first restriction site is a Hind III restriction site, and the second restriction site is a Kpn I restriction site.

[0035] Those skilled in the art can use any method to obtain the recombinant vector. The core idea is: without the recombinant vector of the target protein encoding gene, the corresponding host cells are all limited to the expression of the improved ccdB protein encoding gene (suicide gene) and cannot survive and grow. And the vector containing the target protein encoding gene, the corresponding host cells cannot express the improved ccdB protein encoding gene, so that they can survive and grow. As long as it does not violate this idea, any improved technical solution made by those skilled in the art should fall into the protection scope of the present invention.

[0036] In the present invention, there is no limitation on the type and kind of the target protein, and the method of the present invention is applicable as long as it can be expressed in a host cell.

[0037] In some embodiments of the present invention, the target protein is a monoclonal antibody-associated protein.

[0038] Further, the monoclonal antibody-related protein is selected from the group consisting of the full length or part of the heavy chain region of a monoclonal antibody, the full length or part of the light chain region of a monoclonal antibody, a single-chain antibody, a single-domain antibody, a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a Fv fragment, a scFv fragment, and a Fd fragment. In some specific embodiments of the present invention, the monoclonal antibody-related protein is the full length of the heavy chain variable region or the full length of the light chain variable region.

[0039] Beneficial effects of the present invention

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] (1) The expression efficiency of the improved ccdB protein encoding gene of the present invention is unexpectedly improved in bacteria including Escherichia coli.

[0042] (2) The improved ccdB protein encoding gene of the present invention is used to prepare a recombinant vector. When the target protein encoding gene is not successfully connected, the empty vector contains the ccdB gene and expresses it efficiently, making it impossible for the host bacteria to grow on the plate culture medium. In this way, all colonies grown on the plate culture medium are transformants that are correctly connected to the target protein encoding gene, and the connection efficiency is close to 100%.

[0043] (3) The use of the improved ccdB protein encoding gene or its related biological materials described in the present invention to prepare monoclonal antibody-related proteins can greatly improve the conversion positive cloning rate, is suitable for the development and production of high-throughput monoclonal antibodies, and has very good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The CAI distribution of the sequences before and after optimization is shown. A: Seq1; B: Seq2; C: Seq3; D: Seq4; E: Seq5; F: Seq6; G: Seq7.

[0045] Figure 2 The GC content distribution of the sequences before and after optimization is shown. A: Seq1; B: Seq2; C: Seq3; D: Seq4; E: Seq5; F: Seq6; G: Seq7.

[0046] Figure 3 The distribution of rare codons in the sequences before and after optimization is shown.

[0047] Figure 4 The growth of cells after transformation by constructing vectors with optimized sequences before and after is shown. A: positive plasmid; B: original vector 1; C: optimized vector 2; D: optimized vector 3; E: optimized vector 4; F: optimized vector 5; G: optimized vector 6; H: optimized vector 7.

[0048] Figure 5 The PCR amplification results of the antibody heavy chain in the examples of the present invention are shown.

[0049] Figure 6 The PCR amplification results of the antibody light chain in the examples of the present invention are shown.

[0050] Figure 7 The double restriction enzyme electrophoresis of heavy chain and light chain plasmids constructed by the original vector is shown. Among them, the * indicates a false positive plasmid; Lanes 1 to 3 are Figure 5Lane 1 is the plasmid constructed with the original vector, and lanes 4 to 6 are Figure 6 Lane 1 is the plasmid constructed with the original vector; Lanes 7 to 9 are Figure 5 Lane 2 is the plasmid constructed with the original vector, and lanes 10 to 12 are Figure 6 Lane 2 is the plasmid constructed with the original vector; Lanes 13 to 15 are Figure 5 Lane 3 is the plasmid constructed with the original vector, and lanes 16 to 18 are Figure 6 Lane 3 is the plasmid constructed with the original vector; Lanes 19 to 21 are Figure 5 Lane 4 is the plasmid constructed with the original vector, and lanes 22 to 24 are Figure 6 Lane 4 is the plasmid constructed with the original vector.

[0051] Figure 8 The heavy chain and light chain plasmid double restriction enzyme electrophoresis diagram of optimized vector 2 is shown. Among them, the * indicates a false positive plasmid; lanes 1 to 3 are Figure 5 Lane 1 is the plasmid constructed with the optimized vector 2, and lanes 4 to 6 are Figure 6 Lane 1 is the plasmid constructed with the optimized vector 2; Lanes 7 to 9 are Figure 5 Lane 2 is the plasmid constructed with the optimized vector 2, and lanes 10 to 12 are Figure 6 Lane 2 is the plasmid constructed with the optimized vector 2; Lanes 13 to 15 are Figure 5 Lane 3 is the plasmid constructed with the optimized vector 2, and lanes 16 to 18 are Figure 6 Lane 3 is the plasmid constructed with the optimized vector 2; Lanes 19 to 21 are Figure 5 Lane 4 is the plasmid constructed with the optimized vector 2, and lanes 22 to 24 are Figure 6 Lane 4 shows the plasmid constructed with optimized vector 2.

[0052] Fig. 9 The heavy chain and light chain plasmid double restriction enzyme electrophoresis diagram of optimized vector 3 is shown. Among them, the * indicates a false positive plasmid; lanes 1 to 3 are Figure 5 Lane 1 is the plasmid constructed with the optimized vector 3, and lanes 4 to 6 are Figure 6 Lane 1 is the plasmid constructed with the optimized vector 3; Lanes 7 to 9 are Figure 5 The sample in lane 2 and the plasmid constructed with optimized vector 3, lanes 10 to 12 are Figure 6 Lane 2 is the plasmid constructed with the optimized vector 3; Lanes 13 to 15 are Figure 5 Lane 3 is the plasmid constructed with the optimized vector 3, and lanes 16 to 18 are Figure 6 Lane 3 is the plasmid constructed with the optimized vector 3; Lanes 19 to 21 are Figure 5Lane 4 is the plasmid constructed with the optimized vector 3, and lanes 22 to 24 are Figure 6 Lane 4 is the plasmid constructed with the optimized vector 3.

[0053] Fig.10 The heavy chain and light chain plasmid double restriction enzyme electrophoresis diagram of optimized vector 4 is shown. Among them, the * indicates a false positive plasmid; lanes 1 to 3 are Figure 5 The sample in lane 1 and the plasmid constructed with optimized vector 4, lanes 4 to 6 are Figure 6 Lane 1 is the plasmid constructed with the optimized vector 4; Lanes 7 to 9 are Figure 5 Lane 2 is the plasmid constructed with the optimized vector 4, and lanes 10 to 12 are Figure 6 Lane 2 is the plasmid constructed with the optimized vector 4; Lanes 13 to 15 are Figure 5 Lane 3 is the plasmid constructed with the optimized vector 4, and lanes 16 to 18 are Figure 6 Lane 3 is the plasmid constructed with the optimized vector 4; Lanes 19 to 21 are Figure 5 Lane 4 is the plasmid constructed with the optimized vector 4, and lanes 22 to 24 are Figure 6 Lane 4 is the sample with the plasmid constructed from optimized vector 4.

[0054] Fig.11 The heavy chain and light chain plasmid double restriction enzyme electrophoresis diagram of optimized vector 5 is shown. Among them, the * indicates a false positive plasmid; lanes 1 to 3 are Figure 5 Lane 1 is the plasmid constructed with the optimized vector 5, and lanes 4 to 6 are Figure 6 Lane 1 is the plasmid constructed with the optimized vector 5; Lanes 7 to 9 are Figure 5 Lane 2 is the plasmid constructed with the optimized vector 5, and lanes 10 to 12 are Figure 6 Lane 2 is the plasmid constructed with the optimized vector 5; Lanes 13 to 15 are Figure 5 Lane 3 is the plasmid constructed with the optimized vector 5, and lanes 16 to 18 are Figure 6 Lane 3 is the plasmid constructed with the optimized vector 5; Lanes 19 to 21 are Figure 5 Lane 4 is the plasmid constructed with the optimized vector 5, and lanes 22 to 24 are Figure 6 Lane 4 is the sample with the plasmid constructed from optimized vector 5.

[0055] Fig.12 The heavy chain and light chain plasmid double restriction enzyme electrophoresis diagram of optimized vector 6 is shown. Among them, the * indicates a false positive plasmid; lanes 1 to 3 are Figure 5 Lane 1 is the plasmid constructed with the optimized vector 6, and lanes 4 to 6 are Figure 6 Lane 1 is the plasmid constructed with the optimized vector 6; Lanes 7 to 9 are Figure 5Lane 2 is the plasmid constructed with the optimized vector 6, and lanes 10 to 12 are Figure 6 Lane 2 is the plasmid constructed with the optimized vector 6; Lanes 13 to 15 are Figure 5 Lane 3 is the plasmid constructed with the optimized vector 6, and lanes 16 to 18 are Figure 6 Lane 3 is the plasmid constructed with the optimized vector 6; Lanes 19 to 21 are Figure 5 Lane 4 is the plasmid constructed with the optimized vector 6, and lanes 22 to 24 are Figure 6 Lane 4 samples are plasmids constructed with optimized vector 6.

[0056] Fig.13 The heavy chain and light chain plasmid double restriction enzyme electrophoresis diagram of optimized vector 7 is shown. Among them, the * indicates a false positive plasmid; lanes 1 to 3 are Figure 5 Lane 1 is the plasmid constructed with the optimized vector 7, and lanes 4 to 6 are Figure 6 Lane 1 is the plasmid constructed with the optimized vector 7; Lanes 7 to 9 are Figure 5 Lane 2 is the plasmid constructed with the optimized vector 7, and lanes 10 to 12 are Figure 6 Lane 2 is the plasmid constructed with the optimized vector 7; Lanes 13 to 15 are Figure 5 Lane 3 is the plasmid constructed with the optimized vector 7, and lanes 16 to 18 are Figure 6 Lane 3 is the plasmid constructed with the optimized vector 7; Lanes 19 to 21 are Figure 5 Lane 4 is the plasmid constructed with the optimized vector 7, and lanes 22 to 24 are Figure 6 The plasmid of sample 4 and optimized vector 7 was constructed.

[0057] Fig.14 Transformed S-RBD plates of the original vector 1 and optimized vector 7 are shown.

[0058] Fig.15 The double restriction enzyme electrophoresis of the S-RBD plasmids constructed by the original vector 1 and the optimized vector 7 is shown. The * indicates a false positive plasmid. Lanes 1 to 4 are plasmids constructed by the original vector 1, and lanes 5 to 8 are plasmids constructed by the optimized vector 7. DETAILED DESCRIPTION

[0059] Unless otherwise indicated, implied from the context, or customary in the prior art, all parts and percentages in this application are based on weight, and the test and characterization methods used are all current as of the filing date of this application. Where applicable, the contents of any patent, patent application or publication referred to in this application are fully incorporated herein by reference, and their equivalent patent families are also incorporated by reference, especially the definitions of synthesis techniques, product and processing designs, polymers, comonomers, initiators or catalysts disclosed in these documents in the art. If the definition of a specific term disclosed in the prior art is inconsistent with any definition provided in this application, the definition of the term provided in this application shall prevail.

[0060] The numerical ranges in this application are approximate values, so unless otherwise specified, they may include values ​​outside the range. Numerical ranges include all values ​​from the lower limit to the upper limit increased by 1 unit, provided that there is an interval of at least 2 units between any lower value and any higher value. For example, if the recorded component, physical or other properties are 100 to 1000, it means that all single values ​​are clearly listed, such as 100, 101, 102, etc., and all subranges, such as 100 to 166, 155 to 170, 198 to 200, etc. For a range containing a value less than 1 or containing a fraction greater than 1 (such as 1.1, 1.5, etc.), 1 unit is appropriately regarded as 0.0001, 0.001, 0.01 or 0.1. For a range containing a single digit less than 10 (such as 1 to 5), 1 unit is generally regarded as 0.1. These are only specific examples of what is intended to be expressed, and all possible combinations of the numerical values ​​between the lowest and highest values ​​listed are considered to be clearly recorded in this application.

[0061] The terms "comprising", "including", "having" and their derivatives do not exclude the presence of any other components, steps or processes, and are irrelevant to whether these other components, steps or processes are disclosed in this application. To eliminate any doubt, unless explicitly stated, all compositions using the terms "comprising", "including", or "having" in this application may include any additional additives, adjuvants or compounds. On the contrary, except for those necessary for operating performance, the term "essentially consisting of..." excludes any other components, steps or processes from the scope of any description of the term below. The term "consisting of..." does not include any components, steps or processes that are not specifically described or listed. Unless explicitly stated, the term "or" refers to the listed individual members or any combination thereof.

[0062] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments.

[0063] Example

[0064] The following examples are used to demonstrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors that can be used to implement the present invention and therefore can be considered as preferred embodiments of the present invention. However, it will be appreciated by those skilled in the art based on this specification that many modifications may be made to the specific embodiments disclosed herein and still achieve the same or similar results without departing from the spirit or scope of the present invention.

[0065] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the disclosure and materials cited therein are hereby incorporated by reference.

[0066] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many technical equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the claims.

[0067] The molecular biology experimental methods not specifically described in the following examples are all carried out in accordance with the specific methods listed in the book Molecular Cloning Experiment Guide (4th Edition) (J. Sambrook, MR Green, 2017), or in accordance with the kits and product instructions. Other experimental methods are conventional methods unless otherwise specified. The instruments and equipment used in the following examples are conventional laboratory instruments and equipment unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0068] Example 1 ccdB coding sequence optimization

[0069] 1. Optimization using CAI and GC content

[0070] (1) The nucleotide sequence of the ccdB original sequence Seq1 (X00594.1) is as follows (SEQ ID NO.1):

[0071] ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTAC CCGGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAA

[0072] Submit to the Codon Optimization Database in the required format ( http: / / 111.203.21.178 / codon / newjob.html )middle.

[0073] (2) The sequences automatically optimized by the database were further adjusted for individual codons, and the nucleotide sequences of the adjusted sequences Seq2 to Seq7 were shown as SEQ ID NO.2 to SEQ ID NO.7, respectively.

[0074] Seq2 (SEQ ID NO.2):

[0075] ATGCAATTTAAAGTTTATACTTACAAACGTGAATCTCGTTACCGTCTGTTCGTAGATGTGCAGAGCGACATTATCGATACTCCGGGTCGTCGTATGGTGATCCCGCTGGCATCCGCTCGTCTGCTGTCTGATAAAGTTTCTCGCGAACTGTAT CCGGTAGTTCACATCGGTGACGAATCTTGGCGTATGATGACTACCGATATGGCCTCTGTTCCGGTAAGCGTTATTGGTGAAGAGGTAGCTGACCTGTCTCACCGTGAAAACGACATCAAAAACGCTATTAACCTGATGTTCTGGGGTATCTAA

[0076] Seq3 (SEQ ID NO.3):

[0077] ATGCAGTTCAAAGTATACACCTACAAACGTGAATCTCGTTACCGTCTGTTCGTTGATGTGCAATCCGATATTATTGATACTCCGGGTCGCCGTATGGTTATTCCACTGGCCTCTGCTCGTCTGCTGTCTGACAAAGTATCTCGTGAACTGTACCCGGTTGTGCATATCGGCGACGAAAGCTGGCGTATGATGACTACCGACATGGCTAGCGTTCCGGTTTCCGTAATCGGTGAGGAAGTTGCGGATCTGTCCCACCGCGAAAACGATATCAAAAACGCAATCAACCTGATGTTCTGGGGCATCTAA

[0078] Seq4(SEQ ID NO.4):

[0079] ATGCAATTTAAAGTTTATACTTACAAACGTGAATCTCGTTACCGTCTGTTCGTAGATGTGCAGAGCGACATTATCGATACTCCTGGTCGTCGTATGGTGATCCCGCTGGCATCCGCTCGTCTGCTGTCTGATAAAGTTTCTCGCGAACTGTATCCGGTAGTTCACATCGGTGACGAATCTTGGCGTATGATGACTACCGATATGGCCTCTGTTCCGGTAAGCGTTATTGGTGAAGAGGTAGCTGACCTGTCTCACCGTGAAAACGACATCAAAAACGCTATTAACCTGATGTTCTGGGGTATCTAA

[0080] Seq5(SEQ ID NO.5):

[0081] ATGCAATTTAAAGTTTATACTTACAAACGTGAATCTCGTTACCGTCTGTTCGTAGATGTGCAGAGCGACATTATCGATACTCCAGGTCGTCGTATGGTGATCCCGCTGGCATCCGCTCGTCTGCTGTCTGATAAAGTTTCTCGCGAACTGTATCCGGTAGTTCACATCGGTGACGAATCTTGGCGTATGATGACTACCGATATGGCCTCTGTTCCGGTAAGCGTTATTGGTGAAGAGGTAGCTGACCTGTCTCACCGTGAAAACGACATCAAAAACGCTATTAACCTGATGTTCTGGGGAATCTAA

[0082] Seq6(SEQ ID NO.6):

[0083] ATGCAATTTAAAGTTTATACTTACAAACGTGAATCTCGTTACCGTCTGTTCGTAGATGTGCAGAGCGACATTATCGATACTCCTGGTCGTCGTATGGTGATCCCGCTGGCATCCGCTCGTCTGCTGTCTGATAAAGTTTCTCGCGAACTGTATCCGGTAGTTCACATCGGTGACGAATCTTGGCGTATGATGACTACCGATATGGCCTCTGTTCCGGTAAGCGTTATTGGTGAAGAGGTAGCTGACCTGTCTCACCGTGAAAACGACATCAAAAACGCTATTAACCTGATGTTCTGGGGAATCTAA

[0084] Seq7(SEQ ID NO.7):

[0085] ATGCAATTTAAAGTTTATACTTACAAACGTGAATCTCGTTACCGTCTGTTCGTAGATGTGCAGAGCGACATTATCGATACTCCAGGTCGTCGTATGGTGATCCCGCTGGCATCCGCTCGTCTGCTGTCTGATAAAGTTTCTCGCGAACTGTAT CCGGTAGTTCACATCGGTGACGAATCTTGGCGTATGATGACTACCGATATGGCCTCTGTTCCGGTAAGCGTTATTGGTGAAGAGGTAGCTGACCTGTCTCACCGTGAAAACGACATCAAAAACGCTATTAACCTGATGTTCTGGGGTATCTAA

[0086] Among them, Seq2 and Seq3 were adjusted to further improve CAI, reduce rare codons and GC content. Seq4 to Seq7 also adjusted the codons of individual amino acids. Among them, Seq4 and Seq5 adjusted the codon of P28. The codon of P28 in Seq4 was CCT, and the codon of P28 in Seq5 was CCA; Seq6 and Seq7 adjusted the codon of W100. The codon of W100 in Seq6 was GGA, and the codon of W100 in Seq7 was GGT.

[0087] (3) The online tool https: / / www.novoprolabs.com / tools / codon-optimization was used to evaluate the sequences before and after adjustment. The CAI and GC content evaluation results are shown in Table 1 and Figure 1 , Figure 2 shown.

[0088] Table 1 CAI and GC content of sequences before and after optimization

[0089]

[0090] The results show:

[0091] After optimization, the CAI of Seq2 and Seq3 increased from 0.5 to 0.85, an increase of 70%. The CAI of Seq4 to Seq7 was also above 0.8. Further research has shown that when CAI>0.8, it can be considered that the sequence can be well expressed in the host cell.

[0092] After optimization, the GC content of Seq2 and Seq3 was also reduced to less than 50%, and the distribution was more uniform. The GC content of Seq4 to Seq7 was further reduced compared with Seq2 and Seq3. The uniform distribution of GC content will help improve the expression level.

[0093] For rare codons, Figure 3 It can be seen that after optimization, the rare codons with a usage frequency of less than 30% in Seq2 and Seq3 were removed, and the content of codons with a usage frequency of more than 50% was further increased. The usage frequency of rare codons in Seq4 to Seq7 remained basically unchanged.

[0094] The gene synthesis company was commissioned to synthesize the optimized Seq2 to Seq7 for subsequent experiments.

[0095] Example 2 Construction of optimized gene sequence expression vector

[0096] (1) The original vector 1 containing Seq1 is linearized with a suitable restriction endonuclease. The original vector 1 includes but is not limited to pcDNA, pTT5, pCMV, pCEP, pBV and pSV2 vectors, and the corresponding restriction sites are BamH I, EcoRI, Hind III, Kpn I and Not I, etc. In this example, the pBV vector is selected, and the corresponding restriction sites are Hind III and Kpn I.

[0097] (2) Connect the optimized Seq2 to Seq7 with the linearized original vector 1 according to the ratio in the following table;

[0098] Components Volume (μL) T4 DNA Ligase Buffer (5×) 2 T4 DNA Ligase 1 Linearized vector (original vector 1) 1 Optimized Seq2~Seq7 3 <![CDATA[ddH2O]]> 3

[0099] (3) The ligated product was transformed into ccdB-tolerant Escherichia coli competent cells (such as DB3.1), then spread onto LB plates containing ampicillin resistance and cultured at 37°C overnight;

[0100] (4) On the next day, a single clone was picked from the plate and inoculated into a test tube containing LB liquid medium and cultured overnight at 37°C with shaking at 200 rpm;

[0101] (3) On the third day, the plasmid containing the optimized Seq2 to Seq7 was extracted according to the instructions of the DNA plasmid extraction kit; the plasmid was sent to a sequencing company for sequencing, and the sequencing results were compared and analyzed with the optimized Seq2 to Seq7 to determine that the extracted plasmids contained the optimized Seq2 to Seq7.

[0102] The plasmids containing the optimized Seq2 to Seq7 were numbered as optimized vectors 2 to 7, respectively.

[0103] Example 3 Optimization of the suicide effect test of vectors 2 to 7

[0104] Take equal amounts of original vector 1, optimized vectors 2 to 7 and positive plasmid (without ccdB gene), such as 10 ng each, transform them into DH5α competent cells that are intolerant to ccdB gene, then spread them on LB plates containing ampicillin resistance and culture at 37°C overnight.

[0105] The next day, the plates were taken out to observe the growth of colonies. The growth of colonies on the plates coated with the positive plasmid, the original vector 1 containing the natural ccdB gene sequence, and the optimized vectors 2 to 7 were as follows: Figure 4 And as shown in Table 2.

[0106] Table 2 Growth of bacterial colonies on coated plates

[0107]

[0108] Compared with the number of colonies on the plate with positive plasmid ( Figure 4 A, i.e., control), the original carrier 1 plate ( Figure 4 B) The number of colonies decreased significantly, indicating that the ccdB suicide gene played a role, but there were still 10 to 20 colonies. Figure 4 There are only a few colonies (less than 5) in C and D. The optimized vector 4 to 7 ( Figure 4 There was almost no colony growth on the plates of E, F, G and H. This indicates that codon optimization plays a role, the expression level of ccdB gene is increased, and the suicide effect is improved. In addition, when the codon of P28 is CCT (Seq4) or CCA (Seq5) and the codon of W100 is GGA (Seq6) or GGT (Seq7), the expression level of ccdB gene is the highest and the suicide effect is the best.

[0109] Example 4 Animal Immunization

[0110] (1) Mixing Ki-67 immunogen with Freund's adjuvant to immunize rabbits; mixing p16 immunogen with Freund's adjuvant to immunize balb / c mice;

[0111] (2) 7-10 days after the fourth immunization, serum was collected for titer testing;

[0112] (3) 7-30 days after the fifth immunization, anticoagulated blood, spleen, and thymus were collected;

[0113] (4) Anticoagulated blood was used to separate lymphocytes by density gradient centrifugation;

[0114] (5) Lymphocytes were isolated from spleen or thymus according to the methods described in the literature (Methods Mol Biol. 2015; 1318: 15-28. doi: 10.1007 / 978-1-4939-2742-5_2; Int Rev Immunol. 1990; 6(2-3): 117-26. doi: 10.3109 / 08830189009056623).

[0115] Example 5 Construction of heavy chain and light chain optimized expression vectors

[0116] (1) The Ki-67 and p16 lymphocytes obtained in Example 4 were screened for positive B cell clones using the method disclosed in Chinese invention patent CN106350485A, and lysate was prepared using the method disclosed in Chinese invention patent CN110229777A.

[0117] (2) Transfer 80 μL of B cell lysate to a TurboCapture tube and incubate on a shaker at room temperature for 1 h.

[0118] (3) After incubation, remove the liquid from the TurboCapture tube and wash the tube three times with 100 μL TCW.

[0119] (4) Configure the RT system according to the following table:

[0120]

[0121]

[0122] (5) Add 80 μL of RT system to the TurboCapture tube, place it in the PCR instrument, and run the program:

[0123]

[0124] (6) After the RT program is completed, remove the TurboCapture tube and aspirate the liquid in the tube, then wash the tube three times with 100 μL TCW.

[0125] (7) Use Mouse Ig-Primer Set Kit (Sigma-Aldrich, Catalog No. 69831) to prepare the PCR system according to the following table:

[0126] Components Volume (μL) 10×Buffer 8 Mg2+ 4 dNTPs(10mM) 4 Forward Primer 4 Reverse primer 4 Taq DNA polymerase 2 <![CDATA[H2O]]> 54 total 80

[0127] (8) Add 80 μL of PCR system to the TurboCapture tube, place it in the PCR instrument, and run the program:

[0128]

[0129] (9) After the PCR process is completed, the PCR product is removed and cleaned by magnetic bead method.

[0130] i. Take the magnetic beads out of the 4-degree refrigerator 30 minutes before the experiment and equilibrate to room temperature. Invert 6-8 times before use to mix the magnetic beads;

[0131] ii. Prepare 80% ethanol according to the number of samples;

[0132] iii. 80% ethanol was added to two 96-well round-bottom square well plates 2.2, 200 μL per well. The two well plates were numbered 3 and 4 respectively;

[0133] iv. Add deionized water to another 96-well round-bottom square well plate, 120 μL per well, numbered 6;

[0134] v. Take out another 96-well round-bottom square plate, add 80 μL of PCR product to each well, and then add 50 μL of magnetic beads, numbered 1;

[0135] vi. Insert the four boards into the slots according to their numbers;

[0136] vii. Run the magnetic bead cleaning program for about 30 minutes;

[0137] viii. After the procedure is completed, remove plate 6, determine the sample concentration and perform electrophoresis. Figure 5 and Figure 6 shown.

[0138] (10) The original vector 1 and optimized vectors 2 to 7 containing Seq1 were linearized using corresponding restriction endonucleases respectively;

[0139] (11) The purified PCR products were homologously recombined with the original vector 1 and optimized vectors 2 to 7, respectively, and the system was as follows:

[0140] Components Volume (μL) Super Fusion Clone Mix (2×) 5 Linearized vector (original vector 1 or optimized vector 2-7) 1 Purification of PCR products 1 <![CDATA[ddH2O]]> 3

[0141] (12) After ligation, transform into competent E. coli cells, spread on LB plates containing ampicillin resistance, and culture at 37°C overnight.

[0142] (13) The next day, three single colonies were picked from each plate and inoculated into LB liquid medium containing ampicillin resistance and cultured overnight at 37°C with shaking at 200 rpm.

[0143] (14) Perform magnetic bead plasmid extraction. The extracted plasmid is double-digested as follows:

[0144] Components Volume (μL) 10× Enzyme Digestion Buffer 1 Hind III 0.5 KpN 0.5 Plasmids 1 <![CDATA[ddH2O]]> 7

[0145] (15) Incubate at 37°C for 30–60 min.

[0146] (16) The digested products were detected by agarose gel electrophoresis. Figures 7 to 13 .

[0147] Depend on Figure 7 It can be seen that the expression vector constructed using the original vector 1 has false positives in lanes 3, 11, 13, and 22. Figure 8 It can be seen that the expression vector constructed using optimized vector 2 has only false positive in lane 3. However, the expression vectors prepared using optimized vectors 3 to 7 have no false positive ( Figure 9-13 ).

[0148] Example 6 Construction of optimized expression plasmid for the novel coronavirus spike protein S-RBD

[0149] This example provides optimized expression of the novel coronavirus spike protein S-RBD. The cDNA template was donated by Shanghai Jiao Tong University and the sequence is as follows (SEQ ID No. 8):

[0150] TCATTCACCGTGGAGAAGGGTATTTACCAAACTTCAAACTTCCGTGTTCAGCCAACTGAGTCCATCGTCAGATTCCCATCAATTACTAATCTTTGTCCATTCGGTGAGGTCTTCTCTGCTACTAGATTCGCTTCCGTTTACGCTTGGAATCGTAAGAGAATCTCTAACTGTGTCGCCGATTATTCCGTTCTCTACAACTCTGCATCTTTCAGTACGTTTAAGTGTTACGGCGTATCCCCAACCAAGCTAAACGACCTATGCTTTACCAACGTGTACGCTGATTCTTTCGTTATCAGAGGAGACGAAGTTAGACAAATTGCTCCAGGTCAAACAGGTAAGATAGCTGATTACAACTACAAACTACCAGATGATTTTACTGGTTGTGTTATTGCTTGGAACTCCAACAACCTGGACTCTAAGGTTGGAGGTAACTACAACTACCTTTATAGATTATTCAGAAAGTCTAATCTCAAGCCTTTCGAGAGGGACATTTCTACTGAGATTTACCAAGCTGGATCTACCCCTTGTAACGGAGTCGAAGGTTTCAACTGCTACTTTCCACTCCAATCCTACGGTTTTCAACCTACCAACGGAGTTGGTTACCAACCTTATAGAGTGGTTGTTCTCTCTTTTGAGCTGCTTCATGCTCCAGCAACCGTCTGTGGCCCTAAAAAGTCTACCAACTTGGTTAAAAATAAGTGCGTTAACTTCAACTTTAACGGTCTAACTGGAACTGGTGTCCTAACCGAATCAAACAAAAAGTTCCTGCCATTCCAACAATTCGGCAGAGACATCGCAGATACTACAGATGCCGTCAGAGACCCACAGACTTTGGAAATTCTC

[0151] 1. Primer design

[0152] Forward primer (SEQ ID No.9):

[0153] 5'-AAGCTTATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTTCATTCACCGTGGAG-3'

[0154] Reverse primer (SEQ ID No.10):

[0155] 5'-GGTACCTCTCGCTTCAATGGTGATGGTGATGATGGAGAATTTCCAAAGTC-3'

[0156] The 6 bases AAGCTT at the 5' end of the forward primer are HindIII restriction site, and the 6 bases GGTACC at the 5' end of the reverse primer are KpnI restriction site; box sequence: start codon and stop codon, single underline sequence: signal peptide; double underline sequence: 6×His tag sequence; bold sequence: primer and template binding sequence.

[0157] 2. PCR Amplification

[0158] a) (1) PCR system

[0159] Components Volume (μL) 10×Buffer 5 <![CDATA[Mg 2+ ]]> 2.5 dNTPs(10mM) 2.5 Forward Primer 2.5 Reverse primer 2.5 Taq DNA polymerase 1.2 <![CDATA[H2O]]> 33.8 total 50

[0160] b) (2) PCR procedure

[0161]

[0162] ix. After the PCR process is completed, the PCR product is taken out and cleaned by magnetic beads using the same method as in Example 5.

[0163] 3. Connect

[0164] a) The original vector 1 and optimized vector 7 containing Seq1 were linearized with restriction endonucleases Hind III and Kpn I, respectively.

[0165] b) The purified PCR products were connected with the original vector 1 and the optimized vector 7 by homologous recombination, and the system was as follows:

[0166] Components Volume (μL) Super Fusion Clone Mix (2×) 5 Linearized vector (original vector 1 or optimized vector 2-7) 1 Purification of PCR products 1 <![CDATA[ddH2O]]> 3

[0167] 4. Conversion

[0168] a) After ligation, transform into competent E. coli cells, apply to LB plates containing ampicillin resistance, and culture at 37°C overnight. Fig.14 ,The results showed that no clones grew out of the plasmid constructed using the optimized vector 7, ,indicating a good suicide effect.

[0169] 5. Cultivation

[0170] b) The next day, four single colonies were picked from each plate and inoculated into LB liquid culture medium containing ampicillin resistance, and cultured overnight at 37°C with shaking at 200 rpm.

[0171] 6. Double enzyme digestion

[0172] c) Perform magnetic bead plasmid extraction. The extracted plasmid is double-digested as follows:

[0173] Components Volume (μL) 10× Enzyme Digestion Buffer 1 Hind III 0.5 KpN 0.5 Plasmids 1 <![CDATA[ddH2O]]> 7

[0174] d) Incubate at 37°C for 30-60 min; the digested product is detected by agarose gel electrophoresis. Fig.15 As shown, it can be seen that the original vector 1 has some false positives, while the plasmid of the optimized vector 7 was recombinantly expressed and positive clones were obtained, and the positive clone rate was very high.

[0175] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. An improved ccdB protein encoding gene, characterized in that: The nucleotide sequence of the improved ccdB protein encoding gene is shown in SEQ ID NO.

7.

2. The biological material related to the improved ccdB protein encoding gene according to claim 1 is any one of the following B1) to B7): B1) an expression cassette containing the improved ccdB protein encoding gene according to claim 1; B2) a recombinant vector containing the improved ccdB protein encoding gene according to claim 1; B3) a recombinant vector containing the expression cassette described in B1); B4) a recombinant microorganism containing the improved ccdB protein encoding gene according to claim 1; B5) a recombinant microorganism containing the expression cassette described in B1); B6) a recombinant microorganism containing the recombinant vector described in B2); B7) A recombinant microorganism containing the recombinant vector described in B3).

3. The biomaterial according to claim 2, characterized in that The vector is one selected from the group consisting of a pcDNA vector, a pTT5 vector, a pCMV vector, a pCEP vector, a pBV vector and a pSV2 vector.

4. The biomaterial according to claim 2, characterized in that The recombinant microorganism is a bacterium.

5. The biomaterial according to claim 4, characterized in that The bacteria is Escherichia coli, and further, the Escherichia coli is selected from one of the group consisting of DH5α, Top10 and JM109.

6. Use of the improved ccdB protein encoding gene according to claim 1 or the biomaterial according to claim 2 in preparing a target protein.

7. A method for preparing a target protein, characterized in that: include: S1, obtaining a recombinant vector containing the improved ccdB protein encoding gene according to claim 1, and setting a first restriction site and a second restriction site at both ends of the ccdB protein encoding gene respectively; S2, setting the same first restriction site and second restriction site at both ends of the target protein encoding gene; S3, using the endonucleases corresponding to the first restriction site and the second restriction site to perform double restriction digestion on the recombinant vector and the target protein encoding gene, and connecting the target protein encoding gene to the recombinant vector, and the successfully connected plasmid is a positive plasmid; S4, transforming the ligation product into host cells, and screening the recombinant cells containing the positive plasmid using the plate method and expressing them.

8. The method for preparing a target protein according to claim 7, characterized in that: The specific steps of step S1 to obtain the recombinant vector are as follows: S11, obtaining an empty vector comprising the first restriction enzyme cutting site and the second restriction enzyme cutting site; S12, linearizing the empty vector using endonucleases corresponding to the first restriction site and the second restriction site to obtain a linearized vector; S13, using T4 DNA ligase to connect the improved ccdB protein encoding gene with the linearized vector to obtain the recombinant vector.

9. The method for preparing a target protein according to claim 7 or 8, characterized in that: The target protein is a monoclonal antibody-related protein.

10. The method for preparing a target protein according to claim 9, characterized in that: The monoclonal antibody-related protein is selected from the group consisting of the full-length or partial fragment of the monoclonal antibody heavy chain region, the full-length or partial fragment of the monoclonal antibody light chain region, single-chain antibodies, single-domain antibodies, Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, scFv fragments and Fd fragments.

Images