Adeno-associated virus mutants with capsid protein fused to cell-penetrating peptides and their applications

Abstract

This invention discloses an adeno-associated virus (AAV) mutant fused with a cell-penetrating peptide and its applications. The invention also discloses an AAV capsid protein mutant or a functional fragment thereof, which, compared to the amino acid sequence of the parental or wild-type AAV capsid protein, has an inserted amino acid sequence of a cell-penetrating peptide into the amino acid sequence of the parental or wild-type AAV capsid protein. The AAV mutant fused with the cell-penetrating peptide comprises the AAV capsid protein mutant or its functional fragment. This invention directly inserts the cell-penetrating peptide into the AAV capsid protein via fusion expression, firmly fusing the peptide into the AAV capsid protein. This significantly improves the AAV's ability to transfect cells and its transduction efficiency, as well as gene expression efficiency, reducing the amount of virus required and thus reducing immunogenicity. This will facilitate the application of AAV viral gene vectors in gene therapy.

Description

Technical Field

[0001] This invention relates to an adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide, specifically to an adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide, and to the preparation, production, and application of the gene vector insect cell based on the adeno-associated virus mutant containing the capsid protein fused with the cell-penetrating peptide, belonging to the field of genetic engineering technology. Background Technology

[0002] Adeno-associated virus (AAV) has many advantages as a gene vector that other viral vectors and non-viral vectors do not possess: AAV is a non-pathogenic virus with low immunogenicity to the body and a wide host range (Xie Q, Bu W, Bhatia S, et al. The atomic structure of adeno-associated virus (AAV2), a vector for human gene therapy[J]. Proceeding of the National Academy of Sciences of the United States of America, 2002, 99(16): 10405-10; Weitzman MD, Linden RM. Adeno-associated virus biology[J]. Methods in molecular biology, 2011, 807: 1-23.). Adeno-associated virus (AAV) is a virus with a replication defect, belonging to the Parvoviridae family. This virus's genome contains only one DNA strand, and its viral capsid has an icosahedral structure (Martin KR, Klein RL, et al. Gene delivery to the eye using adeno-associated viral vectors[J].Methods.2002,28(2):267-275; Samulski RJ, Muzyczka N. AAV-Mediated Gene Therapy for Research and Therapeutic Purposes[J].Annu Rev Virol.2014,1:427-451; Srivastava A. In vivotissue-tropism of adeno-associated viral vectors[J].Curr Opin Virol,2016.21:75-80).

[0003] Viral gene vectors, especially AAV gene vectors, are widely used in biomedicine due to their superior advantages over other viral vectors. However, a current technical challenge in using AAV as a gene therapy vector is its insufficient cell transduction efficiency, requiring large viral loads.

[0004] The transduction efficiency of AAV within cells is a crucial factor in its application. The main factors affecting this efficiency include: firstly, viral receptors on the cell membrane surface prevent viral particles from successfully entering the cell; secondly, after the virus enters the cell via endocytosis and forms inclusion bodies, factors such as its ability to escape from these bodies, recognition by intracellular tyrosine kinases, phosphorylation of capsid protein tyrosine, and successful entry into the cell nucleus all play a role. One method to improve AAV transduction efficiency is to increase the AAV dosage; however, high doses may trigger an immune response and result in higher treatment costs. Currently, commonly used methods to improve transduction efficiency include amino acid modification of the AAV capsid surface, introduction of polypeptide fragments, and the action of protease inhibitors in vivo (Satkunanathan S, Thorpe R, Zhao Y. The function of DNAbinding protein nucleophosmin in AAV replication[J]. Virology, 2017, 510: 46-54; Berry GE, Asokan A. Cellular transduction mechanisms of adeno-associated viral vectors[J]. Current opinion in virology, 2016, 21: 54-60; Daya S, Berns KI. Genetherapy using adeno-associated viral vectors[J]. Clin Microbiol Rev, 2008, 21(4): 583-93). Cell-permeable peptides (CPPs) are generally small, basic polypeptides with a strong ability to deliver bioactive substances, such as proteins, plasmids, liposomes, and viruses, into cells and tissues without specific toxicity (Lin, C and Engbersen, JF. Effect of chemical functionalities in poly(amido amine)s for non-viral gene transfection. J Control Release, 2008, 132:267–272; Moreira, C, Oliveira, H, Pires, LR, S, Barbosa, MA and Pêgo, AP. Improving chitosan-mediated gene transfer by the introduction of intracellular buffe ring moieties into the chitosanbackbone. Acta Biomater, 2009, 5:2995–3006; Pack, DW, Putnam, D and Langer, R. Design of imidazole-containing endosomolytic biopolymers for gene delivery. Biotechnol Bioeng, 2000, 67:217–223). Commonly used transmembrane peptides include LAH4, Antp, and TAT-HA2. LAH4 is a preferred histidine-rich polypeptide family; its complex binds to the cell membrane to form an amphiphilic helical conformation.

[0005] Studies have shown that cell-permeable peptides (CPPs) can first increase the entry of AAV particles into cells by promoting endocytosis; they can also help AAV avoid recognition by intracellular tyrosine kinases, reduce phosphorylation levels, and decrease degradation by proteasomes; furthermore, the histidine on peptides like LAH4 can form a specific conformation under acidic pH conditions, escaping lysosomal recognition, and they are more likely to bind to anionic lipid membranes. This helical peptide can disrupt the lipid acyl chain, facilitating AAV escape from endosomals, thereby significantly improving the efficiency of AAV transduction in cells (Liu Y, Kim YJ, Ji M, Fang J, Siriwon N, Zhang LI, Wang P. Enhancing gene delivery of adeno-associated viruses by cell-permeable peptides. Mol Ther Methods Clin Dev. 2014 Feb 19; 1:12). Currently reported methods for CPPs to enhance AAV transduction efficiency involve mixing AAV viral particles and cell-permeable peptides and incubating them to form a complex.

[0006] The method of generating AAV viral particles and LAH4 complexes through physical incubation has several problems: First, the binding of AAV viral particles to LAH4 is physically unstable and can detach during cell transduction, failing to improve AAV transduction efficiency and posing a risk. Second, the incubation time significantly affects the binding rate, potentially resulting in incomplete binding. Furthermore, the large amount of AAV used during incubation and the need for additional LAH4 synthesis increase costs. Therefore, the application of physical incubation to bind viral particles and transmembrane peptides to improve AAV transduction efficiency is significantly limited. Summary of the Invention

[0007] The main objective of this invention is to provide an adeno-associated virus mutant with capsid protein fused with cell-penetrating peptides and its applications, in order to overcome the shortcomings of the prior art.

[0008] To achieve the aforementioned objectives, the technical solution adopted by this invention includes:

[0009] This invention provides an AAV capsid protein mutant or a functional fragment thereof, wherein the AAV capsid protein mutant has an inserted amino acid sequence of a cell-penetrating peptide into the amino acid sequence of the parental or wild-type AAV capsid protein compared to the parental or wild-type AAV capsid protein.

[0010] This invention also provides an isolated polynucleotide comprising a nucleic acid sequence encoding the aforementioned AAV capsid protein mutant or a functional fragment thereof.

[0011] This invention also provides a carrier containing the aforementioned isolated polynucleotides.

[0012] This invention also provides a host cell containing the aforementioned polynucleotides or vectors.

[0013] This invention provides an adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide, comprising the aforementioned AAV capsid protein mutant or a functional fragment thereof.

[0014] This invention also provides a recombinant adeno-associated virus particle, comprising:

[0015] The aforementioned AAV capsid protein mutant or its functional fragment; and

[0016] Exogenous polynucleotides encoding exogenous gene products.

[0017] This invention also provides a method for preparing an adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide, comprising: constructing a recombinant baculovirus vector containing the aforementioned isolated polynucleotides, and then using a baculovirus-insect cell production system to produce the adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide.

[0018] This invention also provides a pharmaceutical composition comprising an adeno-associated virus mutant or recombinant adeno-associated virus particle containing the aforementioned capsid protein fused with a cell-penetrating peptide; and a pharmaceutically acceptable excipient.

[0019] Compared with the prior art, the beneficial effects of the present invention are at least as follows:

[0020] This invention directly inserts a cell-penetrating peptide into the AAV capsid protein via fusion expression. This secure fusion of the peptide into the AAV capsid protein stably increases the proportion of AAV entering cells, significantly improving AAV transfection capacity and transduction efficiency, as well as gene expression efficiency. This reduces the amount of virus required, thereby decreasing immunogenicity. Compared to current technologies that bind AAV and the cell-penetrating peptide through incubation, this invention uses a fusion expression method. The cell-penetrating peptide binds to the AAV capsid protein at a high rate, without dissociation, and the fusion process is simple and cost-effective. This invention will facilitate the application of AAV viral gene vectors in gene therapy. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1A-Figure 1B The images are the recombinant plasmids pFastbacdual-inCap6-LAH4 and pFastbacdual-inCap6 from Example 1 of this invention.

[0023] Figure 2A This is an SDS-PAGE electrophoresis image of the recombinant viral capsid protein in Example 1 of this invention.

[0024] Figure 2B and Figure 2C The figures show the fluorescence microscopy and flow cytometry results of HepG2 cells transfected with rAAV6-EGFP and rAAV6-LAH4-EGFP in Example 1 of this invention.

[0025] Figures 3A-3D The figures shown are the fluorescence microscopy observation results and flow cytometry detection results of wild-type and mutant AAV-transfected human umbilical cord blood mesenchymal stem cells (MSCs) in Example 1 of this invention.

[0026] Figures 4A-4D The figures show the fluorescence microscopy and flow cytometry results of wild-type and mutant AAV-transfected human retinal pigment epithelial cells ARPE-19 in Example 1 of this invention.

[0027] Figures 5A-5D The figures show the fluorescence microscopy and flow cytometry results of wild-type and mutant AAV-transfected human Burkitt's lymphoma cell lines (Raji) in Example 1 of this invention.

[0028] Figures 6A-6D The figures show the fluorescence microscopy and flow cytometry results of wild-type and mutant AAV-transfected human acute T-cell leukemia cell lines (Jurkat) in Example 1 of this invention.

[0029] Figures 7A-7D The figures are the fluorescence microscopy observation results and flow cytometry detection results of wild-type and mutant AAV transfected human primary T cells in Example 1 of this invention. Detailed Implementation

[0030] As mentioned above, in view of the deficiencies of the prior art, the inventors of this case, through long-term research and extensive practice, have been able to propose the technical solution of this invention. The invention will be more fully understood through the following detailed description, which should be read in conjunction with the accompanying drawings. Detailed embodiments of the invention are disclosed herein; however, it should be understood that the disclosed embodiments are merely exemplary of the invention, which can be embodied in various forms. Therefore, the specific functional details disclosed herein should not be construed as limiting, but rather as the basis for the claims and as intended to teach those skilled in the art to employ the representative basis of the invention in different ways in any suitable detailed embodiment.

[0031] The following explains the definitions of some terms mentioned in this invention:

[0032] "AAV" is an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its derivatives. Unless otherwise required, the term includes subtypes and naturally occurring and recombinant forms. The abbreviation "rAAV" refers to recombinant adeno-associated virus, also known as recombinant AAV vector (or "rAAV vector"). The term "AAV" includes type 1 AAV (AAV-1), type 2 AAV (AAV-2), type 3 AAV (AAV-3), type 4 AAV (AAV-4), type 5 AAV (AAV-5), type 6 AAV (AAV-6), type 7 AAV (AAV-7), type 8 AAV (AAV-8), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and sheep AAV. "Primate AAV" refers to AAV that infects primates, "non-primate AAV" refers to AAV that infects non-primate mammals, and "bovine AAV" refers to AAV that infects bovine mammals, etc.

[0033] As used herein, “rAAV vector” refers to an AAV vector containing a polynucleotide sequence of non-AAV origin (i.e., a polynucleotide heterologous to AAV), typically the target sequence for cellular genetic transformation. Generally, the heterologous polynucleotide has at least one flanking position and usually two inverted terminal repeats (ITRs) of AAV. The term rAAV vector encompasses both rAAV vector particles and rAAV vector plasmids. rAAV vectors can be single-stranded (ssAAV) or self-complementary (scAAV).

[0034] "AAV virus," "AAV virus particle," or "rAAV vector particle" refers to a viral particle composed of at least one AAV capsid protein (typically all capsid proteins of wild-type AAV) and a capsid-modified polynucleotide rAAV vector. If the particle contains heterologous polynucleotides (i.e., polynucleotides other than the wild-type AAV genome, such as transgenes delivered to mammalian cells), it is usually referred to as an "rAAV vector particle" or simply "rAAV vector." Therefore, the generation of rAAV particles necessarily includes the generation of rAAV vectors, as the rAAV particles contain such vectors.

[0035] "Packaging" refers to a series of intracellular events that lead to the assembly and shell formation of AAV particles.

[0036] The term "helper virus" for AAV refers to a virus that allows mammalian cells to replicate and package AAV (e.g., wild-type AAV). Many such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses, and poxviruses (e.g., vaccinia). While subclass C type 5 adenoviruses are most commonly used, adenoviruses encompass many different subclasses. Many adenoviruses are known from human, non-human mammals, and avian sources and are available from repositories such as the ATCC. Viruses of the herpes family include, for example, herpes simplex virus (HSV) and Epstein-Barr viruses (EBV), as well as cytomegalovirus (CMV) and pseudorabies virus (PRV); these are also available from repositories such as the ATCC.

[0037] "Isolated" plasmids, nucleic acids, vectors, viruses, virions, host cells, or other substances refer to formulations of substances that do not naturally exist in said substance or similar substances, or that may be present at the time of initial preparation. Therefore, for example, purified counting can be used to prepare isolated substances to enrich them from a source mixture. The enrichment can be measured absolutely, such as by weight per volume of solution, or relative to a second potential interfering substance present in the source mixture. The enrichment of this disclosure embodiment is gradually isolated multiple times.

[0038] As used herein, the term "treatment" and the like refers to achieving the desired pharmacological and / or physiological effect. Such effect may be preventative in the complete or partial prevention of a disease or its symptoms and / or therapeutic in the partial or complete cure of a disease and / or side effects attributable to said disease. As used herein, "treatment" includes any treatment of a disease in mammals (particularly humans) and includes: (a) preventing the onset of a disease in subjects who may be susceptible or at risk of developing the disease but have not yet been diagnosed with it; (b) suppressing the disease, i.e., halting its development; and (c) alleviating the disease, i.e., causing disease remission.

[0039] In this invention, sequence alignment, determination of sequence identity percentage, and corresponding sequence positions can be performed using software known in the art, such as the BLAST program, CLUSTALW (http: / / www.ebi.ac.uk / clustalw / ), MULTALIN (http: / / prodes.toulouse.inra.fr / multalin / cgi-bin / multalin.pl), or MUSCLE (Multiple Sequence Alignment), using the default parameters indicated by these websites to probe (e.g., align) the obtained sequences. As used herein, when referring to a specific pair of aligned amino acid sequences, the term "identity" or "percentage identity" refers to the percentage of amino acid sequence identity, obtained by counting the number of identical matches in the alignment and dividing such number of identical matches by the length of the aligned sequence.

[0040] As used herein, the terms “recombinant AAV vector,” “recombinant AAV,” “recombinant AAV virus,” “recombinant AAV viral particle,” “recombinant AAV viral particle,” or “AAV gene expression vector” are used interchangeably and refer to genomic DNA encased in an AAV viral capsid containing heterologous nucleic acids. This vector can remove the Rep and Cap genes from the genome and replace them with heterologous polynucleotides expressing the target gene, enabling the expression of the carried genetic material elements in host cells through infection, transformation, transduction, or transfection. The vector may contain multiple elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, introns, kozak sequences, therapeutic genes, polyA sequences, selection elements, and reporter genes. Additionally, the vector may also contain an origin of replication.

[0041] For different therapeutic uses, the heteropolynucleotides (also referred to as "target polynucleotides") described herein can encode a variety of gene products (also referred to as "target gene products"). Typically, these heteropolynucleotides are located within recombinant AAV vectors and are side-attached by inverted terminal repeat (ITR) regions. Various heteropolynucleotides can be used in this invention to generate recombinant AAV vectors for a variety of different applications. These heteropolynucleotides include, but are not limited to, for example, (i) polynucleotides suitable for gene therapy to alleviate defects caused by the loss, deficiency, or suboptimal content of structural or functional proteins; (ii) polynucleotides transcribed into antisense molecules; (iii) polynucleotides transcribed into decoys that bind transcription or translation factors; (iv) polynucleotides encoding cellular regulators (such as cytokines); (v) polynucleotides that sensitize recipient cells to specific drugs (such as the herpesvirus thymidine kinase gene); (vi) polynucleotides used in cancer therapy, such as the E1A tumor suppressor gene or the p53 tumor suppressor gene for the treatment of various cancers; and (vii) polynucleotides encoding gene editing tools. To achieve expression of the target gene product in the recipient host cell, the polynucleotide can be operatively linked to a promoter (either its own or a heterologous promoter). Many suitable promoters are known in the art, and the choice depends on the desired expression level of the target polynucleotide; whether constitutive expression, inducible expression, cell-specific or tissue-specific expression are required, etc. Recombinant AAV vectors may also contain optional markers.

[0042] The purpose of this invention is to provide an adeno-associated virus (AAV) mutant that fuses capsid protein with cell-penetrating peptides (CPPs). The AAV-penetrating peptide mutant is produced in insect cells. Transducing cells with this AAV-penetrating peptide mutant can significantly improve AAV cell transduction efficiency and gene expression efficiency.

[0043] The following will provide a further explanation of the technical solution, its implementation process, and its principles, in conjunction with the accompanying drawings.

[0044] One aspect of this invention provides an AAV capsid protein mutant or a functional fragment thereof, wherein the AAV capsid protein mutant, compared with the amino acid sequence of the parental or wild-type AAV capsid protein, has an amino acid sequence of a cell-penetrating peptide inserted into the amino acid sequence of the parental or wild-type AAV capsid protein.

[0045] Further, the cell-penetrating peptide (such as LAH4) has the amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it, and the nucleotide sequence is as shown in SEQ ID NO:2 or a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0046] Furthermore, cell-penetrating peptides can enhance the ability of AAV transduced cells and improve gene expression efficiency. In this invention, the cell-penetrating peptide is LAH4, whose amino acid sequence is shown in SEQ ID NO:1, specifically KKALLALALHHLAHLALHLALALKKAC, and its nucleotide sequence is shown in SEQ ID NO:2, specifically AAGAAGGCGTTATTGGCGCTTGCCCTCCATCACCTGGCCCACTTAGCACTTCACTTAGCCCTCGCATTAAAGAAAGCGTGC.

[0047] In some embodiments, the parental or wild-type AAV capsid protein includes, but is not limited to, type 6 AAV capsid protein and type 2 AAV capsid protein.

[0048] Further, the AAV capsid protein mutant has the amino acid sequence shown in SEQ ID NO:10 or an amino acid sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it, and the nucleotide sequence is shown in SEQ ID NO:9.

[0049] One aspect of this invention also provides an isolated polynucleotide comprising a nucleic acid sequence encoding the aforementioned AAV capsid protein mutant or a functional fragment thereof.

[0050] One aspect of the present invention also provides a carrier comprising the aforementioned isolated polynucleotides.

[0051] Furthermore, the carrier is selected from shuttle carriers, expression carriers, or integration carriers, but is not limited thereto.

[0052] One aspect of the present invention also provides a host cell comprising the aforementioned polynucleotide or vector.

[0053] One aspect of this invention also provides an adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide, comprising the aforementioned AAV capsid protein mutant or a functional fragment thereof.

[0054] One aspect of this invention also provides a recombinant adeno-associated virus particle, comprising:

[0055] The aforementioned AAV capsid protein mutant or its functional fragment; and

[0056] Exogenous polynucleotides encoding exogenous gene products.

[0057] Furthermore, the exogenous polynucleotide has AAV ITR sequences at the 5' and 3' ends.

[0058] Furthermore, the exogenous polynucleotide also includes at least one of a promoter sequence, an enhancer sequence, an intron, a polyA sequence, and a reporter gene.

[0059] One aspect of this invention also provides a method for preparing an adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide, comprising: constructing a recombinant baculovirus vector containing the aforementioned isolated polynucleotides, and then using a baculovirus-insect cell production system to produce the adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide.

[0060] In this invention, the specific method of producing recombinant AAV virus using the baculovirus-insect cell production system can be found in references such as "Research on Recombinant AAV (rAAV) Baculovirus Production System, Lei Qiugang, Master's Thesis, Zhejiang Sci-Tech University, 2010-03-01".

[0061] The adeno-associated virus mutant of the capsid protein fused with cell-penetrating peptide of the present invention is obtained by linking the nucleic acid sequence encoding the cell-penetrating peptide with the nucleic acid sequence encoding the AAV capsid protein and then expressing them in a fusion manner.

[0062] Furthermore, cell-penetrating peptides can enhance the ability of AAV transduced cells and improve gene expression efficiency. In this invention, the cell-penetrating peptide is LAH4, whose amino acid sequence is shown in SEQ ID NO:1, specifically KKALLALALHHLAHLALHLALALKKAC, and its nucleotide sequence is shown in SEQ ID NO:2, specifically AAGAAGGCGTTATTGGCGCTTGCCCTCCATCACCTGGCCCACTTAGCACTTCACTTAGCCCTCGCATTAAAGAAAGCGTGC.

[0063] In some preferred embodiments, it is obtained by linking the nucleic acid sequence encoding LAH4 with the nucleic acid sequence encoding AAV capsid protein and then expressing them together.

[0064] In some preferred embodiments, it is obtained by inserting a nucleic acid sequence encoding LAH4 into amino acid position 139 of the protein encoding the parental or wild-type AAV capsid protein and then expressing it in a fusion manner.

[0065] The type 2 AAV capsid protein has the nucleotide sequence shown in SEQ ID NO:13 or a nucleotide sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; the type 2 AAV capsid protein has the amino acid sequence shown in SEQ ID NO:14 or an amino acid sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0066] The adeno-associated virus mutant of the type 2 AAV capsid protein fusion cell-penetrating peptide has the nucleotide sequence shown in SEQ ID NO:15 or a nucleotide sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; the adeno-associated virus mutant of the type 2 AAV capsid protein fusion cell-penetrating peptide has the amino acid sequence shown in SEQ ID NO:16 or an amino acid sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0067] The type 6 AAV capsid protein has the nucleotide sequence shown in SEQ ID NO:17 or a nucleotide sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; the type 6 AAV capsid protein has the amino acid sequence shown in SEQ ID NO:18 or an amino acid sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0068] The adeno-associated virus mutant of the fusion of type 6 AAV capsid protein with cell-penetrating peptide has the nucleotide sequence shown in SEQ ID NO:19 or a nucleotide sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; the adeno-associated virus mutant of the fusion of type 6 AAV capsid protein with cell-penetrating peptide has the amino acid sequence shown in SEQ ID NO:20 or an amino acid sequence that has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0069] This invention utilizes an insect cell-baculovirus system to package an adeno-associated virus mutant (hereinafter referred to as "AAV-penetrating peptide mutant") containing a capsid protein fused with a cell-penetrating peptide. Three plasmids were constructed based on the necessary conditions for AAV packaging (each containing the AAV genome, the AAV mutant capsid protein, and the AAV replication protein). The backbones of all three plasmids were derived from the pFastbacdual plasmid (purchased from Invitrogen), i.e., the target gene expression cassette was amplified by PCR, digested with enzymes, and ligated into the multiple cloning site (MCS) of the pFastbacdual plasmid.

[0070] The first plasmid involved in this invention is pFastbacdual-inCap6LA H4, which encodes the AAV6 mutant capsid protein. Using pFastbacdual-Cap6 plasmid as a template (Cao J, Liu X, Yuan Y, Wang F, Kong W, Shi G, Li W, Zhang C*. A rAAV2 / 6 Mutant with Enhanced Targeting for Mouse Retinal Müller Cells. Curr Eye Res. 2019 Aug 27:1-8), the nucleic acid sequence encoding LAH4 and the nucleic acid sequence encoding the AAV capsid protein (Cap) are fused and expressed by fusion PCR.

[0071] In this invention, LAH4 is inserted into amino acid position 139 of type 2 AAV (but not limited to) Cap protein (nucleotide sequence SEQ ID No. 13, amino acid sequence SEQ ID No. 14) (fusion nucleotide sequence SEQ ID No. 15, amino acid sequence SEQ ID No. 16). The six primers used are: SEQ ID No. 3 (the specific sequence content is CAGAAGAAGGCGTTATTGGCGCTTGCCCTCAGCAGCAGCACAGACCCTGCG), SEQ ID No. 4 (the specific sequence content is GCTGAGGGCAAGCGCCAATAACGCCTTCTTCTGGAGATTGACTGCCACAGTC), SEQ ID No. 5 (the specific sequence content is GGAACAGGCCTATGGCTGCCGATGGTTATC), SEQ ID No. 6 (the specific sequence content is GGAACAAGCTTTTACAGATTACGAGTCAG), SEQ ID No. 7 (the specific sequence content is GGGCAAGCGCCAATAACGCCTTCTTCATCTTAACAGGTTCCTCAACCAGG), and SEQ ID No. 8 (the specific sequence content is TAGCCCTCGCATTAAAGAAAGCGTGCGCTCCGGGAAAAAAGAGGCCGGTAG). The second-round PCR product was ligated into MSCs of the vector pFastbacdual by double digestion with StuI and HindIII to obtain pFastbacdual-Cap2 LAH4.

[0072] In this invention, LAH4 is inserted into amino acid position 139 (but not limited to) of type 6 AAV (but not limited to) Cap protein (nucleotide sequence SEQ ID No. 17, amino acid sequence SEQ ID No. 18) (fusion nucleotide sequence SEQ ID No. 19, amino acid sequence SEQ ID No. 20). The six primers used are: SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 9 (specific sequence content: GGAACAGGCCTATGGCTGCCGATGGTTATC), SEQ ID No. 10 (specific sequence content: GGAACAAGCTTTTACAGGGGACGGGTGAGG), SEQ ID No. 11 (specific sequence content: GGGCAAGCGCCAATAACGCCTTCTTCATCTTAGCACCTTCCTCAACCAG), and SEQ ID No. 12 (specific sequence content: GCCTCGCATTAAAGAAAGCGTGCGCTCCTGGAAAGAAACGTCCGGTAG). The second-round PCR product was ligated into MSCs of the vector pFastbacdual by double digestion with StuI and HindIII to obtain pFastbacdual-Cap6 LAH4.

[0073] The second plasmid involved in this invention is the AAV genomic plasmid pFastbacdual-ITR-EGFP, which contains two terminal inverted repeat sequences (ITR) of AAV serotype 2 (AAV2), and also contains a foreign gene expression cassette (including promoter, enhancer, intron, polyA sequence, and foreign gene expression cassette including the green fluorescent protein gene EGFP, etc.) expressed in eukaryotic cells.

[0074] The third plasmid involved in this invention is the plasmid pFastbacdual-inrep encoding the AAV replication protein (Rep), which includes the Rep gene expression cassette of AAV2, an intron sequence to enhance expression, etc. (Li Taiming et al., Preparation of AAV-ITR gene expression microcarriers by insect cells, Chinese Journal of Biotechnology, 2015, 31(8), 1232, 1.2.1, “Construction of pFastBacdual-ITR-EGFP plasmid”).

[0075] The AAV gene vector involved in this invention is obtained by production in insect cells:

[0076] First, the three recombinant plasmids pFastbacdual-Cap6 LAH4 / pFastbacdual-ITR-EGFP / pFastbacdual-inrep were transformed into E. coli DH10Bac competent cells using conventional methods. After two rounds of blue-white screening, colonies containing recombinant bacmids were white, and colonies that did not undergo recombination were blue. White colonies were selected for amplification, and the recombinant bacmids Bacmid-Cap6 LAH4 / Bacmid-ITR-EGFP / Bacmid-inrep were extracted.

[0077] Then, using insect cell transfection reagent, the three recombinant baculoviruses Bacmid-Cap6 LAH4 / Bacmid-ITR-EGFP / Bacmid-inrep were transfected into Sf9 cells. After 4–5 days, the cell supernatant was collected and filtered through a 0.22 μm filter to obtain P1 generation recombinant baculovirus Baculovirus-inCap6 LAH4 / Baculovirus-ITR-EGFP / Baculovirus-inrep. The P1 generation recombinant baculovirus was amplified by infecting Sf9 cells twice to obtain P3 generation recombinant baculovirus. The titer of the P3 generation baculovirus was determined using the plaque assay: virus titer (pfu / mL) = 1 / dilution factor × number of plaques × 1 / inoculation volume per well.

[0078] Finally, Sf9 cells were co-infected with three recombinant baculoviruses from generation P3 (Baculovirus-Cap6 LAH4 / Baculovirus-ITR-EGFP / Baculovirus-inrep) and packaged to obtain LAH4-rAAV6-EGFP.

[0079] Methods for purifying and concentrating high concentrations of recombinant AAV virus using CsCl density gradient centrifugation, methods for detecting LAH4-rAAV6-EGFP titers using quantitative real-time PCR, and methods for detecting LAH4-rAAV6-EGFP purity using SDS-PAGE were also developed.

[0080] To demonstrate the universality of this method across different AAV serotypes, pFastbacdual-Cap2LAH4 was constructed using the method described above, and LAH4-rAAV2-EGFP virus was packaged.

[0081] Another aspect of the present invention provides the use of the aforementioned capsid protein fused with cell-penetrating peptide adeno-associated virus mutant or recombinant adeno-associated virus particle in the preparation of gene therapy drugs.

[0082] Another aspect of the present invention provides a pharmaceutical composition comprising an adeno-associated virus mutant or recombinant adeno-associated virus particle containing the aforementioned capsid protein fused with a cell-penetrating peptide; and a pharmaceutically acceptable excipient.

[0083] In another aspect, the present invention relates to a pharmaceutical composition comprising a recombinant adeno-associated virus particle (component i) as disclosed herein and a pharmaceutically acceptable carrier / excipient (component ii). In some embodiments, component i comprises 0.1-99.9 wt%, preferably 10-99.9 wt%, more preferably 70-99 wt%, of the total weight of the pharmaceutical composition. Further, such excipients, carriers, diluents, and buffers comprise any agent that is administerable without adverse toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, and ethanol. These may include pharmaceutically acceptable salts, such as mineral salts such as hydrochloride, hydrobromide, phosphate, sulfate, etc.; and salts of organic acids such as acetate, propionate, malonate, benzoate, etc. Additionally, auxiliary substances, such as wetting agents or emulsifiers, pH buffers, etc., may be present in such media. A wide variety of pharmaceutically acceptable excipients are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been described in detail in a number of publications, including (for example) A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy," 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) HC Ansel et al., 7th edition, Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) AHKibbe et al., 3rd edition, Amer. Pharmaceutical Assoc.

[0084] Another aspect of the present invention provides the use of the aforementioned capsid protein fusion cell-penetrating peptide adeno-associated virus mutant or pharmaceutical composition in highly efficient transduced cells or in the expression of exogenous genes.

[0085] This invention relates to the efficient transduction of cells using AAV-permeable peptide mutants and the expression of exogenous genes:

[0086] Transfection of cells in vitro: Human retinal pigment epithelial cell line (ARPE-19) (adherent cell line), human Burkitt's lymphoma cell line (Raji) (suspension cell line), human umbilical cord blood mesenchymal stem cells (MSC) (primary adherent cells), and human acute T-cell leukemia cell line (Jurkat) (primary suspension cells) were seeded at appropriate cell densities in 24-well cell culture plates. Wild-type LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP) and rAAV6-EGFP (rAAV2-EGFP) viruses were used to infect cells at the same MOI. After 48 hours, the cells were observed under an inverted fluorescence microscope, and the proportion of fluorescent cells was detected by flow cytometry. Each group was replicated in at least three wells. This verified that the LAH4-rAAV6-EGFP gene vector infects cultured cells more efficiently than the wild-type rAAV6-EGFP gene vector.

[0087] In summary, this invention directly inserts cell penetrating peptides (CPPs) into the AAV capsid protein via fusion expression. This secure fusion of the penetrating peptides into the AAV capsid protein stably increases the proportion of AAV entering cells, significantly improving AAV transfection capacity and transduction efficiency, as well as gene expression efficiency. This reduces the amount of virus required, thereby decreasing immunogenicity. Compared to current technologies that bind AAV and cell penetrating peptides through incubation, this invention utilizes a fusion expression method. The cell penetrating peptides bind to the AAV capsid protein at a high rate, do not dissociate, and the fusion process is simple and cost-effective. This invention will facilitate the application of AAV viral gene vectors in gene therapy.

[0088] The following description, in conjunction with several preferred embodiments and accompanying drawings, further explains the technical solution of the present invention. However, the experimental conditions and set parameters described herein should not be considered as limitations on the basic technical solution of the present invention. Furthermore, the scope of protection of the present invention is not limited to the following embodiments. Unless otherwise specified, all reagents used in the following embodiments are well known to those skilled in the art and can be obtained through commercial purchases. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.

[0089] Example 1

[0090] The specific method in this embodiment includes the following steps:

[0091] 1. Preparation of pFastbacdual-Cap6-LAH4 recombinant plasmid vector

[0092] Using pFastbacdual-inCap6 plasmid as a template (Cao J, Liu X, Yuan Y, Wang F, Kong W, Shi G, Li W, Zhang C*. A rAAV2 / 6 Mutant with Enhanced Targeting for Mouse Retinal Müller Cells. Curr Eye Res. 2019 Aug 27:1-8), the nucleotide sequence encoded by LAH4 was inserted into the Cap6 sequence by fusion PCR.

[0093] The LAH4 double-stranded template was obtained by annealing with long primers LAH4-F1 and LAH4-R1 (SEQ3 and SEQ4).

[0094] The upstream PCR primers for the insertion site are AAV6-StuI-F (SEQ9) and AAV6-LAH4-R2 (SEQ11), and the downstream PCR primers are AAV6-LAH4-F2 (SEQ12) and AAV6-HindIII-R (SEQ10).

[0095] The three products were then amplified by AAV6-StuI-F (SEQ9) and AAV6-HindIII-R (SEQ10) to obtain the final fusion product.

[0096] 1. Preparation of pFastbacdual-Cap2-LAH4 recombinant plasmid vector

[0097] Using pFastbacdual-inCap2 plasmid as a template, the nucleotide sequence encoded by LAH4 was inserted into the Cap2 sequence by fusion PCR.

[0098] The LAH4 double-stranded template was obtained by annealing with long primers LAH4-F1 and LAH4-R1 (SEQ3 and SEQ4).

[0099] The upstream PCR primers for the insertion site were AAV2-StuI-F (SEQ5) and AAV2-LAH4-R2 (SEQ7), and the downstream PCR primers were AAV2-LAH4-F2 (SEQ8) and AAV2-HindIII-R (SEQ6).

[0100] The three products were then amplified by AAV6-StuI-F (SEQ5) and AAV6-HindIII-R (SEQ6) to obtain the final fusion product.

[0101] 2. Preparation of Recombinant Rod Particles

[0102] The three recombinant plasmids from the previous step were used to prepare recombinant Bacmids, as follows:

[0103] (1) Slowly melt 100 μL of DH10Bac competent cells on ice.

[0104] (2) Add 50 ng of plasmid DNA and mix gently.

[0105] (3) Place on ice for 30 minutes, subject to heat shock at 42°C for 90 seconds, and immediately place on ice for 2 minutes.

[0106] (4) Add 900 μL of SOC medium and shake at 37℃ and 225 rpm for 4 h.

[0107] (5) Add 40 μL of 2% (20 mg / mL) Blue-gal and 7 μL of 20% (200 mg / mL) IPTG to the center of a pre-prepared 90 mm agar plate containing 50 μg / mL kanamycin (Kan), 7 μg / mL gentamicin (Gen), and 10 μg / mL tetracycline (Tet). Distribute the solution evenly over the entire surface of the plate using a sterile spreader and incubate at room temperature until all liquid has disappeared.

[0108] (6) Dilute the cells 10-fold with SOC medium (10⁻¹, 10⁻², 10⁻³), and take 100 μL of each gradient and spread it on LB plates.

[0109] (7) After incubation at 37°C for 48 hours, pick 10 white clones and transfer them to a new LB agar plate (with the same antibiotics as above), and incubate at 37°C overnight. Select confirmed white clones and inoculate them into LB liquid medium (containing 50 μg / mL kanamycin (Kan), 7 μg / mL gentamicin (Gen), and 10 μg / mL tetracycline (Tet)).

[0110] (8) Place at 4℃ overnight to allow the blue color to fully develop during this period.

[0111] (9) If the white spot can be identified by PCR, it can be transfected with Sf9.

[0112] (10) Use the OMEGA kit to extract and isolate recombinant rod-like DNA. Follow the kit instructions for the experimental method. After measuring the rod-like DNA concentration, aliquot and freeze at -20°C to avoid repeated freeze-thaw cycles.

[0113] (11) Bacmid was identified by PCR. The primers used were: upstream primer 5'-CCC AGT CAC GAC GTT GTAAAA CG-3', and downstream primer 5'-GCT CTA GAT TAC TTG TAC AGC TCG TCC AT-3'.

[0114] (12) Take out the correctly identified Bacmid strain and inoculate it into 3 mL LB (Kan+, Gen+, Tet+) at a ratio of 1:300 and shake for 12 h. Then inoculate it into 150 mL LB (Kan+, Gen+, Tet+) at a ratio of 1:100 and shake for 16 h. Extract Bacmid in large quantities according to the instructions of the large / large plasmid extraction kit for transfection of cells to prepare baculovirus.

[0115] 3. Preparation of recombinant baculovirus

[0116] (1) Sf9 cell culture. Sf9 cells were seeded in six-well plates one day in advance at a density of 50% and in complete culture medium with 95% viability. The recombinant Bacmid DNA was incubated in a 70°C water bath for 20 min and centrifuged at 12000g for 10 min to collect the supernatant.

[0117] (2) Cell plating.

[0118] Ensure cell density is between 1.5 and 2.5 × 10⁻⁶. 6 Perform the procedure at a cell / mL ratio (antibiotic-free medium). Add 2 mL of additive-free Grace medium (antibiotic-free and serum-free) to each 6-well plate. Seed 8 × 10⁸ cells / mL. 5 Cells / mL Sf9 from step 1 (without changing the culture medium and washing the cells), allow the cells to adhere at room temperature for 15 min.

[0119] (3) Prepare transfection reagent.

[0120] a) Mix transfection reagent II, add 8 μL to 92 μL of additive-free basal culture medium (without antibiotics and serum), and vortex to mix.

[0121] b) Take 5 μL of rod-like DNA (500 ng / μL, ensuring the amount of rod-like DNA is 2-3 μg) and add it to 95 μL of additive-free basal culture medium (without antibiotics and serum), and mix gently.

[0122] c) Mix the two solutions together and incubate at room temperature for 30 minutes.

[0123] (4) Add the above DNA-Lipid mixture to the wells containing cells and incubate the cells at 27°C for 5 hours.

[0124] (5) Remove the culture medium from the plate and replace it with 2 mL of complete culture medium.

[0125] (6) Incubate at 27°C for 72 hours and observe signs of viral infection.

[0126] Separate P1:

[0127] After confirming that the cells are in the late infection stage (usually 4-5 days after transfection), collect 2 mL of virus-containing culture medium from each well into a sterile 15 mL centrifuge tube, centrifuge at 1000g for 5 min to remove cell debris.

[0128] The supernatant was filtered through a 0.22 μm filter into sterile 15 mL centrifuge tubes and stored at 4°C protected from light. For long-term storage, aliquots can be frozen at -80°C.

[0129] Virus amplification:

[0130] Take 10 mL of cells in suspension culture with an MOI of 0.05–0.1, at a density of 2 × 10⁻⁶ cells / mL. 6 Cells / mL; or cells in a 6-well plate at a density of 2 × 10⁶ cells / mL. 6 Cells / well, calculate the required P1 volume.

[0131] ①Sf9 cells were seeded in six-well plates, 2×10⁶ 6 Cells / well. Incubate at room temperature for 1 hour to allow them to adhere, then observe under a microscope.

[0132] ② Add an appropriate amount of P1 to each well and incubate at 27℃ for 48h~72h.

[0133] ③ Collect 2 mL of virus-containing culture in each well into a sterile 15 mL centrifuge tube and centrifuge at 1000 g for 5 min.

[0134] ④ Transfer the supernatant to a sterile 15mL centrifuge tube. The virus supernatant is P2. Store at 4℃ protected from light. For long-term storage, aliquot and freeze at -80℃.

[0135] ⑤ P3 can be obtained by amplification using the above method (the titer of P1 virus obtained is usually 1×10⁻⁶). 6 ~1×10 7 Between 1×10⁻⁶, the P2 titer is... 7 ~1×10 8 between).

[0136] Virus titer was determined using the plaque assay. Detailed experimental procedures are as follows:

[0137] ①2 mL / well of cells (5×10⁻⁶) 5 Cells ( / mL) were seeded into 6-well plates and incubated at room temperature for 1 hour to allow them to adhere. The degree of adhesion was then examined under a microscope after incubation.

[0138] ② Dissolve 4% agarose gel in a 70℃ water bath, and preheat 2×Grace gel and a 100mL sterile bottle in a 40℃ water bath.

[0139] ③ Serially dilute the baculovirus with serum-free basal medium: 10 -1 ~10 -8 .

[0140] ④ Discard the supernatant in the 6-well plate, quickly add the diluted virus, 1 mL / well (replicas), and incubate at room temperature for 1 h.

[0141] ⑤ Prepare the upper layer agar: add 20 mL of high-temperature inactivated FBS to 100 mL of 2×Grace, 25 mL of 2×Grace (containing FBS) + 12.5 mL of sterile water + 12.5 mL of 4% agarose gel to a preheated 100 mL sterile bottle, mix gently, and place in a 37℃ water bath for later use.

[0142] ⑥ Discard the supernatant from the 6-well plate, quickly add 2 mL of upper agar to prevent the bacterial layer from drying out, and let it stand for 10–20 minutes to solidify. Place the 6-well plate in a 27°C incubator and incubate for 5 days.

[0143] ⑦ Prepare a 1 mg / mL neutral red solution and filter it aseptically into a basic complete culture medium.

[0144] ⑧ Prepare neutral red top agar by mixing 1.5 mL of the above solution, 16.5 mL of basic complete culture medium, and 6 mL of 4% agar.

[0145] ⑨ Add 1 mL of neutral red agar four days after viral infection.

[0146] ⑩ Continue to place it in the incubator. After 4 to 5 days, you can observe the phage plaques, count the number of phage plaques, and obtain the virus titer.

[0147] Note: Virus titer (pfu / mL) = 1 / dilution factor × number of plaques × 1 / inoculation volume per well

[0148] 4. Packaging and purification of LAH4-rAAV6-EGFP virus

[0149] Insect Sf9 cells were co-infected with three baculoviruses: Baculovirus-inCap6-LAH4, Baculovirus-inRep (expressing the AAV replication protein Rep, essential for packaging), and Baculovirus-ITR-EGFP. Cells were collected after 72 hours. The supernatant culture medium was discarded, and cells were collected by pipetting with pre-cooled PBS at 4°C. Cells were incubated at -80°C for 30 minutes, followed by a 37°C water bath for 30 minutes, and this freeze-thaw cycle was repeated three times to ensure complete cell lysis and virus release. The rAAV virus was purified and concentrated using CsCl density gradient centrifugation.

[0150] 5. Detection of LAH4-rAAV6-EGFP viral purity and titer determination

[0151] The specific method for detecting the purity of rAAV virus using SDS-PAGE is as follows:

[0152] 1) Gel preparation: 10% separating gel (5mL / plate): ddH2O 1.3mL, 30% acrylamide mixture (29:1) 1.7mL, 1.0mol / L Tris-HCl (pH 8.8) 1.9mL, 10% SDS 0.05mL, 10% perthioamide 0.05mL, TEMED 0.002mL.

[0153] 5% stacking gel (2mL / plate): ddH2O 1.4mL, 30% acrylamide mixture (29:1) 0.33mL, 1.0mol / L Tris-HCl (pH 6.8) 0.25mL, 10% SDS 0.03mL, 10% perthiocyanate 0.03mL, TEMED 0.002mL.

[0154] 2) Glue preparation: Mix the separating glue and the concentrating glue separately, set up the glue pouring mold, add ddH2O to check for leakage, pour in ddH2O, add separating glue to about 3 / 4 full, fill and level the separating glue with ddH2O, after the glue solidifies, pour off the ddH2O, add concentrating glue to fill, insert the comb teeth, wait for the glue to solidify, and carefully remove the comb teeth.

[0155] 3) Sample loading and electrophoresis: Place the gel plate in the electrophoresis tank, add fresh electrophoresis buffer, add 4× loading buffer to the sample and boil in water for 10 min. After treatment, load 5 μL of marker, 12 μL of sf9 cell lysis buffer, and 12 μL of purified virus, respectively. Adjust the voltage to 60V and electrophoresis until the bands pass through the stacking gel. Then adjust the voltage to 120V until the bromophenol blue band appears on the gel plate.

[0156] 4) Coomassie Brilliant Blue staining and destaining: Carefully peel the gel from the gel plate, remove the stacking gel, add Coomassie Brilliant Blue R-250 staining solution, stain for 1 hour, recover the staining solution, and rinse with ddH2O to destain until clear bands appear.

[0157] The titer of rAAV virus was detected using quantitative real-time PCR, and the specific method is as follows:

[0158] 1) Constructing a standard curve: Sample copy number (copies / μL) = Sample concentration (ng / μL) × 10 -9 ×6.02×10 23 Calculate the required plasmid concentration using ×2 / (sample base pairs in bp × 648), based on a 10... 8 10 7 10 6 10 5 Copy number gradient dilution.

[0159] 2) Virus pretreatment: After purifying the virus, treat it with DNAase at 37℃ for 30 min, then denature it at 96℃ for 10 min, add proteinase K and treat it at 56℃ for 1 h, and finally denature it at 96℃ for 10 min to fully release the viral DNA.

[0160] 3) Real-time PCR detection, the reaction system is as follows, and the standard and sample are repeated three times.

[0161]

[0162]

[0163] The PCR reaction procedure is as follows:

[0164]

[0165] The viral sample copy number was calculated using real-time PCR software.

[0166] 6. LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP) in vitro transfection of cells

[0167] LAH4-rAAV6-EGFP transfection of the human hepatocellular carcinoma line HepG2: HepG2 cells were seeded in 24-well plates. When the cell density reached 70-80%, LAH4-rAAV6-EGFP was introduced at an MOI of 1E5. Simultaneously, wild-type rAAV6-EGFP was used as a control, infecting cells with the same number of viral particles. After 48 hours, cells were observed under an inverted fluorescence microscope, and the proportion of fluorescent cells was detected by flow cytometry. (See also...) Figure 2B and Figure 2C The diagram shows the fluorescence microscopy and flow cytometry results of HepG2 cells transfected with rAAV6-EGFP (wild type 6) and rAAV6-LAH4-EGFP (mutant 6) in this embodiment.

[0168] LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP) transfection of the human retinal pigment epithelial cell line (ARPE-19): ARPE-19 cells were seeded in 24-well plates. When the cell density reached 70-80%, adherent ARPE-19 cells were infected with LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP) at an MOI ratio of 3E4 / 1E4. Simultaneously, cells were infected with wild-type rAAV6-EGFP at the same number of viral particles as a control. After 48 hours, the cells were observed under an inverted fluorescence microscope, and the proportion of fluorescent cells was detected by flow cytometry. (See also...) Figure 4A and Figure 4BThe diagram shows the fluorescence microscopy and flow cytometry results of human retinal pigment epithelial cells ARPE-19 transfected with rAAV6-EGFP (wild-type 6) and rAAV6-LAH4-EGFP (mutant 6) in this embodiment. Please refer to... Figure 4C and Figure 4D The figure shows the fluorescence microscopy and flow cytometry results of human retinal pigment epithelial cells ARPE-19 transfected with Raav2-EGFP (i.e., wild type 2) and rAAV2-LAH4-EGFP (i.e. mutant 2) in this embodiment.

[0169] Human umbilical cord blood mesenchymal stem cells (MSCs) transfected with LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP): MSCs were seeded in 24-well plates. When the cell density reached 70-80%, cells were infected with rAAV6-LAH4-EGFP (LAH4-rAAV2-EGFP) at an MOI of 1E5. Simultaneously, wild-type rAAV6-EGFP was used as a control, infecting cells with the same number of viral particles. After 48 hours, cells were observed under an inverted fluorescence microscope, and the proportion of fluorescent cells was detected by flow cytometry. (See also...) Figure 3A and Figure 3B The diagram shows the fluorescence microscopy and flow cytometry results of human umbilical cord blood mesenchymal stem cells (MSCs) transfected with rAAV6-EGFP (wild-type 6) and rAAV6-LAH4-EGFP (mutant 6) in this embodiment. Please refer to... Figure 3C and Figure 3D The figure shows the fluorescence microscopy and flow cytometry results of human umbilical cord blood mesenchymal stem cells (MSCs) transfected with rAAV2-EGFP (wild type 2) and rAAV2-LAH4-EGFP (mutant 2) in this embodiment.

[0170] LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP) transfection of the human Burkitt's lymphoma cell line (Raji): 1E5 Raji cells were seeded into 96-well plates. Suspended Raji cells were infected with LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP) at an MOI of 1E5. Simultaneously, cells were infected with wild-type rAAV6-EGFP at the same number of viral particles as a control. After 6 hours, cells were transferred to 48-well plates, and culture medium was added to a final volume of 800 μl. After 48 hours, cells were observed under an inverted fluorescence microscope, and the proportion of fluorescent cells was detected by flow cytometry. (See also...) Figure 5A and Figure 5BThe diagram shows the fluorescence microscopy and flow cytometry results of human Burkitt's lymphoma cell line (Raji) transfected with rAAV6-EGFP (wild-type 6) and rAAV6-LAH4-EGFP (mutant 6) in this embodiment. Please refer to... Figure 5C and Figure 5D The diagram shows the fluorescence microscopy and flow cytometry results of human Burkitt's lymphoma cell line (Raji) transfected with rAAV2-EGFP (wild type 2) and rAAV2-LAH4-EGFP (mutant 2) in this embodiment.

[0171] Human acute T-cell leukemia cell line (Tlymphocyte) transfected with LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP): 5E5 T lymphocytes were seeded into 96-well plates. Suspended T lymphocytes were infected with LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP) at an MOI of 1E6. Simultaneously, cells were infected with wild-type rAAV6-EGFP at the same number of viral particles as a control. After 6 hours, the cells were transferred to 48-well plates, and culture medium was added to a final volume of 800 μl. After 48 hours, the cells were observed under an inverted fluorescence microscope, and the proportion of fluorescent cells was detected by flow cytometry.

[0172] Human T lymphocytes (Jurkat) transfected with LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP): 1E5 Jurkat cells were seeded into 96-well plates. Suspended Jurkat cells were infected with LAH4-rAAV6-EGFP (LAH4-rAAV2-EGFP) at an MOI of 1E5. Simultaneously, cells were infected with wild-type rAAV6-EGFP at the same number of viral particles as a control. After 6 hours, the cells were transferred to 48-well plates, and culture medium was added to a final volume of 800 μl. After 48 hours, the cells were observed under an inverted fluorescence microscope, and the proportion of fluorescent cells was detected by flow cytometry.

[0173] Please see Figure 6A and Figure 6B The diagram illustrates the fluorescence microscopy and flow cytometry results of human acute T-cell leukemia cell line (Jurkat) transfected with rAAV6-EGFP (wild-type 6) and rAAV6-LAH4-EGFP (mutant 6) in this embodiment. Please refer to [link to documentation]. Figure 6C and Figure 6D The results of fluorescence microscopy and flow cytometry analysis of human acute T-cell leukemia cell line (Jurkat) transfected with rAAV2-EGFP (i.e. wild type 2) and rAAV2-LAH4-EGFP (i.e. mutant 2) in this embodiment are shown.

[0174] Please see Figure 7A and Figure 7B The diagram illustrates the fluorescence microscopy and flow cytometry results of human primary T cells transfected with rAAV6-EGFP (wild-type 6) and rAAV6-LAH4-EGFP (mutant 6) in this embodiment. Please refer to [link to documentation]. Figure 7C and Figure 7D The results of fluorescence microscopy and flow cytometry analysis of human primary T cells transfected with rAAV2-EGFP (i.e., wild type 2) and rAAV2-LAH4-EGFP (i.e. mutant 2) in this embodiment are shown.

[0175] Figure 2A This is an SDS-PAGE electrophoresis image of the recombinant viral capsid protein (containing rAAV2-EGFP (i.e., wild type 2), rAAV2-LAH4-EGFP (i.e., mutant 2), rAAV6-EGFP (i.e., wild type 6), and rAAV6-LAH4-EGFP (i.e., mutant 6)) in an embodiment of the present invention.

[0176] As demonstrated by the above embodiments, this invention directly inserts the cell-penetrating peptide into the AAV capsid protein via fusion expression. This securely fuses the peptide into the AAV capsid protein, stably increasing the proportion of AAV entering cells. This significantly improves AAV's ability to transfect cells and its transduction efficiency, as well as gene expression efficiency, reducing the amount of virus required and thus lowering immunogenicity. Compared to current technologies that bind AAV and the cell-penetrating peptide through incubation, this invention uses a fusion expression method. This method results in a high binding rate between the cell-penetrating peptide and the AAV capsid protein, preventing dissociation, simplifying the fusion process, and saving costs.

[0177] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0178] Those skilled in the art should understand that the specific embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any other corresponding changes and modifications made in accordance with the technical concept of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. An AAV capsid protein mutant, wherein, compared with the amino acid sequence of a parental or wild-type AAV capsid protein, the mutant inserts an amino acid sequence of a cell-penetrating peptide into the amino acid sequence of the parental or wild-type AAV capsid protein, wherein the parental or wild-type AAV capsid protein is selected from either type 6 AAV capsid protein or type 2 AAV capsid protein; the cell-penetrating peptide is LAH4, whose amino acid sequence is shown in SEQ ID NO:1, or whose nucleotide sequence is shown in SEQ ID NO:2; When type 2 AAV capsid protein is selected, the nucleotide sequence of the type 2 AAV capsid protein is as shown in SEQ ID NO:13, or the amino acid sequence is as shown in SEQ ID NO:14; the nucleotide sequence of the adeno-associated virus mutant of the type 2 AAV capsid protein fused with cell-penetrating peptide is as shown in SEQ ID NO:15, or the amino acid sequence is as shown in SEQ ID NO:

16. When type 6 AAV capsid protein is selected, the nucleotide sequence of the type 6 AAV capsid protein is as shown in SEQ ID NO:17, or the amino acid sequence is as shown in SEQ ID NO:18; the nucleotide sequence of the adeno-associated virus mutant of the type 6 AAV capsid protein fused with cell-penetrating peptide is as shown in SEQ ID NO:19, or the amino acid sequence is as shown in SEQ ID NO:

20.

2. An isolated polynucleotide comprising a nucleic acid sequence encoding the AAV capsid protein mutant of claim 1.

3. A vector comprising the isolated polynucleotide of claim 2.

4. The carrier of claim 3, wherein: The carrier is selected from shuttle carriers, expression carriers, or integration carriers.

5. A host cell comprising the polynucleotide of claim 2 or the vector of claim 3 or 4.

6. An adeno-associated virus mutant comprising a capsid protein fused with a cell-penetrating peptide, wherein the AAV capsid protein mutant of claim 1 is included.

7. A recombinant adeno-associated virus particle comprising: The AAV capsid protein mutant of claim 1; and Exogenous polynucleotides encoding exogenous gene products.

8. The recombinant adeno-associated virus particle according to claim 7, characterized in that: The exogenous polynucleotide has AAV ITR sequences at the 5' and 3' ends.

9. The recombinant adeno-associated virus particle according to claim 8, characterized in that: The exogenous polynucleotide also includes at least one of a promoter sequence, an enhancer sequence, an intron, a polyA sequence, and a reporter gene.

10. A method for preparing an adeno-associated virus mutant containing a capsid protein fused with a cell-penetrating peptide, characterized in that... include: A recombinant baculovirus vector containing the isolated polynucleotides described in claim 2 was constructed, and then an adeno-associated virus mutant containing capsid protein fused with cell-penetrating peptides was produced using a baculovirus-insect cell production system.

11. The use of the adeno-associated virus mutant of the capsid protein fused with cell-penetrating peptide according to claim 6 or the recombinant adeno-associated virus particle according to any one of claims 7-9 in the preparation of gene therapy drugs.

12. A pharmaceutical composition, characterized in that... It comprises: an adeno-associated virus mutant of the capsid protein fused with a cell-penetrating peptide as described in claim 6 or a recombinant adeno-associated virus particle as described in any one of claims 7-9; and a pharmaceutically acceptable excipient.

Images