Molecular marker combination, primer pair, kit and application thereof for identifying wheat haplotype and / or thousand-grain weight trait

Abstract

The present invention belongs to the field of genetic engineering, and specifically relates to a molecular marker combination, a primer pair, a kit and its application for identifying haplotypes and / or thousand-grain weight traits of wheat. The molecular markers described in the present invention can distinguish Hap1 haplotype, Hap2 haplotype and Hap3 haplotype wheat, and the average thousand-grain weight of Hap2 haplotype wheat varieties is significantly higher than that of Hap1 and Hap3 haplotypes, and Hap2 is an excellent haplotype with high thousand-grain weight. Accordingly, the present invention can further distinguish high thousand-grain weight wheat from low thousand-grain weight wheat. The present invention uses CASP molecular marker primer pairs to detect the allelic variation of TabHLH39‑5B genes related to haplotype and thousand-grain weight in wheat. The identification can be completed by DNA extraction, PCR specific amplification, and enzymatic detection, which can accelerate the breeding process of high-yield wheat varieties.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a molecular marker combination, a primer pair, a kit and applications thereof for identifying wheat haplotypes and / or thousand-grain weight traits. Background Art

[0002] Wheat (Triticum aestivum L.) is an important food crop that provides about 20% of human calorie consumption. Wheat grain yield depends on the number of ears per acre, the number of grains per ear, and grain weight. When the number of ears per unit area and the number of grains per ear reach the optimal level, increasing grain weight is crucial to further improve wheat yield.

[0003] Starch is the main component of wheat grains, accounting for about 75% of the dry weight of wheat grains. Starch synthesis is a complex process, which is catalyzed by six major functional enzymes: AGP-glucose pyrophosphorylase (AGPase), granule-bound starch synthase (GBSS), starch synthase (SS), starch branching enzyme (BE), starch debranching enzyme (DBE) and starch phosphorylase (PHO). AGPase is an important enzyme in the biosynthesis of starch, which catalyzes the conversion of glucose-1-phosphate (G-1-P) into adenosine diphosphate (ADP-Glc). Amylose is mainly synthesized by GBSS, while the synthesis of amylopectin is synergistically synthesized by AGPase, SS, BE and DBE. PHO is believed to act on the surface of granules and play an important role in the phosphorylation process.

[0004] In higher plants, AGPase is a heterotetrameric enzyme composed of two larger regulatory subunits (AGPL) and two smaller catalytic subunits (AGPS), encoded by TaAGPS1a, TaAGPS1b, TaAGPS2, TaAGPL1 and TaAGPL2. In most dicotyledonous plants, AGPase is active only in plastids, but it is mainly present in the cytoplasm of the endosperm of cereal grains, such as in barley, rice and corn, where it accounts for 85%, 90% and 95% of the total AGPase activity, respectively, indicating that cytoplasmic AGPase plays a vital role in starch synthesis in these crops.

[0005] Transcription factors regulate the expression of downstream genes by specifically binding to cis-acting elements upstream of target genes, thereby regulating the growth and development of cereal crops and the response to adverse stress. In wheat, existing research has mainly focused on the expression patterns of genes encoding starch synthesis-related enzymes, while there has been little research on upstream transcription factors that regulate the expression of starch synthesis-related enzyme genes. Currently, researchers have screened a transcription factor TabHLH39 by analyzing the cis-acting elements upstream of the promoter of the starch synthesis gene TaAGPL1 and using yeast single-hybrid technology. Developing functional markers based on the transcription factor TabHLH39, conducting haplotype analysis, and performing association analysis with the thousand-grain weight trait to find excellent haplotypes is of great significance for improving wheat thousand-grain weight and obtaining new high-yield wheat varieties. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker combination, a primer pair, a kit and an application thereof for identifying wheat haplotypes and / or thousand-grain weight traits, detect excellent allelic variation of wheat TabHLH39-5B gene, screen and identify wheat haplotypes and wheat thousand-grain weight traits, and improve the breeding efficiency of high thousand-grain weight wheat germplasm.

[0007] The present invention provides molecular markers for identifying wheat haplotypes and / or 1000-grain weight traits, wherein the wheat haplotypes are Hap1 haplotype, Hap2 haplotype and Hap3 haplotype;

[0008] The molecular markers include a first InDel molecular marker, a second InDel molecular marker, a first SNP molecular marker and a second SNP molecular marker; the first InDel molecular marker is located at -1215bp of the promoter region of the wheat TabHLH39-5B gene, and there is a 12bp base deletion as shown in the nucleotide sequence of SEQ ID NO.1; the second InDel molecular marker is located at -1489bp of the promoter region of the wheat TabHLH39-5B gene, and there is a 275bp base deletion as shown in the nucleotide sequence of SEQ ID NO.2; the first SNP molecular marker is located at -1807bp of the promoter region of the wheat TabHLH39-5B gene, and there is a G / - polymorphism; the second SNP molecular marker is located at -1805bp of the promoter region of the wheat TabHLH39-5B gene, and there is a C / T polymorphism; the nucleotide sequence of the promoter region of the TabHLH39-5B gene is as shown in SEQ ID As shown in No.3; the promoter region of the TabHLH39-5B gene is located at -1992bp to -1bp.

[0009] The present invention also provides a primer pair for identifying the molecular marker combination described in the above scheme, comprising an upstream primer CAPS-F with a sequence shown in SEQ ID NO.4 and a downstream primer CAPS-R with a sequence shown in SEQ ID No.5.

[0010] The present invention also provides a kit for identifying the molecular marker combination described in the above scheme, comprising the primer pair described in the above scheme.

[0011] The present invention also provides a method for identifying wheat haplotypes, comprising the following steps:

[0012] Using the primers described in the above scheme to perform PCR amplification on the genomic DNA of the material to be tested, to obtain a PCR amplification product;

[0013] The PCR amplification product is digested with restriction endonuclease Apa I to obtain a digestion product;

[0014] When the enzyme cleavage product is a single 1780 bp band, the material to be tested is a Hap3 haploid wheat material;

[0015] When the enzyme cleavage product includes two short fragments of 1879 bp and 188 bp, the material to be tested is a Hap1 haploid wheat material;

[0016] When the enzyme cleavage product includes two short fragments of 1591 bp and 188 bp, the material to be tested is a Hap2 haploid wheat material.

[0017] Preferably, the reaction system used for PCR amplification includes, in 50 μL, 200 ng of genomic DNA of the material to be tested, 0.3 μL of 10 μM upstream primer CAPS-F, 0.3 μL of 10 μM downstream primer CAPS-R, 25 μL of 2×KOD OneTMPCRMasterMix, and the remainder of ddH 2 O;

[0018] The procedure of the PCR amplification reaction is: the first stage is pre-denaturation at 94°C for 3 minutes; the second stage is denaturation at 98°C for 10 seconds, annealing at 59°C for 30 seconds, extension at 68°C for 3 minutes, and 32 cycles; the third stage is final extension at 68°C for 5 minutes.

[0019] The present invention also provides the use of the molecular marker combination, the primer pair, the kit or the method described in the above scheme in wheat breeding.

[0020] Preferably, in the application, Hap2 haploid wheat material is selected for breeding.

[0021] The present invention also provides the use of the molecular marker combination, the primer pair, the kit or the method described in the above scheme in screening high thousand-grain weight wheat.

[0022] The present invention also provides a method for molecular marker-assisted breeding of high thousand-grain weight wheat, which uses the primer pairs described in the above scheme to molecularly mark the target wheat and screen Hap2 haploid wheat materials.

[0023] The present invention provides molecular markers for identifying wheat haplotypes and / or 1000-grain weight traits, wherein the wheat haplotypes are Hap1 haplotypes, Hap2 haplotypes and Hap3 haplotypes; the molecular markers include a first InDel molecular marker, a second InDel molecular marker, a first SNP molecular marker and a second SNP molecular marker; the first InDel molecular marker is located at -1215 bp of the promoter region of the wheat TabHLH39-5B gene, and has a 12 bp base deletion as shown in the nucleotide sequence of SEQ ID NO.1; the second InDel molecular marker is located at -1489 bp of the promoter region of the wheat TabHLH39-5B gene, and has a nucleotide sequence as shown in SEQ ID NO. NO.2 shows a 275bp base deletion; the first SNP molecular marker is located at -1807bp in the promoter region of the wheat TabHLH39-5B gene, and there is a G / - polymorphism, where - indicates a deletion mutation; the second SNP molecular marker is located at -1805bp in the promoter region of the wheat TabHLH39-5B gene, and there is a C / T polymorphism.

[0024] Compared with the Hap1 haplotype, the Hap2 haplotype and the Hap3 haplotype contain two InDels: -1215bp contains a 12bp base deletion, as shown in SEQ ID NO.1; -1489bp contains a 275bp base deletion, named large fragment 1, as shown in SEQ ID NO.2. Therefore, InDel-1489 / -1215 can be used to distinguish the Hap1 haplotype from the Hap2 haplotype / Hap3 haplotype; CAPS1807 / 1805 distinguishes the Hap3 haplotype from the Hap1 / Hap2 haplotype. There are two SNP markers between the Hap1 haplotype and the Hap2 haplotype: there is a G / - polymorphism at the -1807bp position in the promoter region of the wheat TabHLH39-5B gene, and a C / T polymorphism at the -1805bp position, that is, the two sites are located in the sequence (GGGCCC), GGGCCC can be recognized and cut by the restriction endonuclease Apa I, and GG-CTC cannot be cut, that is, the Hap1 haplotype and the Hap 2 haplotype are located in the sequence GGGCCC, which can be recognized and cut by the restriction endonuclease Apa I, while the Hap3 haplotype cannot be cut.

[0025] The molecular markers of the present invention can distinguish Hap1 haplotype, Hap2 haplotype and Hap3 haplotype wheat, and the average thousand-grain weight of Hap2 haplotype wheat varieties is significantly higher than that of Hap1 and Hap3 haplotypes, and Hap2 is an excellent haplotype with high thousand-grain weight. Based on this, the present invention can further distinguish high thousand-grain weight wheat from low thousand-grain weight wheat.

[0026] The present invention adopts CASP molecular marker primer pairs to detect the allelic variation of TabHLH39-5B gene related to haplotype and 1000-grain weight in wheat. The sample can be identified through simple DNA extraction, PCR specific amplification and enzymatic detection, which is convenient for identifying wheat haplotypes and detecting and screening wheat varieties or strains with high 1000-grain weight, and can greatly accelerate the breeding process of high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0028] Figure 1 The PCR amplification results of the TabHLH39-5B coding region and promoter, wherein (a) is the PCR amplification result of the TabHLH39-5B promoter, and (b) is the PCR amplification result of the TabHLH39-5B coding region fragment;

[0029] Figure 2 The variant sites and three haplotypes (Hap1-3) of the promoter and coding region of TabHLH39-5B in common hexaploid wheat;

[0030] Figure 3 Thousandkernel weight (TKW) analysis of TabHLH39-5B in two haploid wheat materials;

[0031] Figure 4 Development of molecular markers for the TabHLH39-5B promoter haplotype Cleaved amplified polymorphic sequences (CAPS);

[0032] Figure 5 The comparison results of TabHLH39-5B promoter sequences in allohexaploid (AABBDD) wheat materials;

[0033] Figure 6 This is the alignment result of the coding region sequence of TabHLH39-5B genome in allohexaploid (AABBDD) wheat materials. DETAILED DESCRIPTION

[0034] The present invention provides molecular markers for identifying wheat haplotypes and / or 1000-grain weight traits, wherein the wheat haplotypes are Hap1 haplotype, Hap2 haplotype and Hap3 haplotype;

[0035] The molecular markers include a first InDel molecular marker, a second InDel molecular marker, a first SNP molecular marker and a second SNP molecular marker; the first InDel molecular marker is located at -1215bp in the promoter region of the wheat TabHLH39-5B gene, and there is a 12bp base deletion in the nucleotide sequence as shown in SEQ ID NO.1; the second InDel molecular marker is located at -1489bp in the promoter region of the wheat TabHLH39-5B gene, and there is a 275bp base deletion in the nucleotide sequence as shown in SEQ ID NO.2; the first SNP molecular marker is located at -1807bp in the promoter region of the wheat TabHLH39-5B gene, and there is a G / - polymorphism; the second SNP molecular marker is located at -1805bp in the promoter region of the wheat TabHLH39-5B gene, and there is a C / T polymorphism.

[0036] In the present invention, the nucleotide sequence with 12 bp base deletion shown in SEQ ID NO.1 is specifically: cccctctcccct.

[0037] In the present invention, the nucleotide sequence with 275 bp base deletion shown in SEQ ID NO.2 is specifically:

[0038] ctggtcacaatgggcaagaacataagctagtaacttcacacatccctagactatgttactacctccatagtgggtaggaacatctatgtagtgtcatgcaatgatgtatttattaggttatagactcattgtttcttg gaatgtgtgatgttccggtaacttagctagttaccacaagcacctctctcttcattaaatacgtgccacataagcaaagttgtattgaagtgtgtgatgttactcctaagttcctccccactgtgaccagccttagg.

[0039] In the present invention, the nucleotide sequence of the promoter region of the TabHLH39-5B gene is shown in SEQ ID No. 3, specifically:

[0040]

[0041] The accession number of the TabHLH39-5B gene coding region sequence in the wheat genome gene bank (http: / / plants.ensembl.org / Triticum_aestivum / Info / Index) is TraesCS5B02G380200, and the CDS sequence of the TabHLH39-5B gene coding region is shown in SEQ ID No. 6, specifically:

[0042]

[0043] The present invention also provides a primer pair for identifying the molecular marker combination described in the above scheme, comprising an upstream primer CAPS-F with a sequence shown in SEQ ID NO.4 and a downstream primer CAPS-R with a sequence shown in SEQ ID No.5.

[0044] In the present invention, the nucleotide sequence of the upstream primer CAPS-F shown in SEQ ID NO.4 is specifically: gcccccaagtaatacccaat, and the nucleotide sequence of the downstream primer CAPS-R shown in SEQ ID No.5 is specifically: tcaagattcaagagcaaacc. The primer pair of the present invention can detect the allelic variation of the TabHLH39-5B gene related to haplotype and 1000-grain weight in wheat, detect and screen wheat varieties or strains with high 1000-grain weight, and greatly accelerate the breeding process of high-yield wheat varieties.

[0045] The present invention also provides a kit for identifying the molecular marker combination described in the above scheme, comprising the primer pair described in the above scheme. In the present invention, the kit preferably also includes a PCR amplification reagent and an enzyme cleavage reagent; the enzyme cleavage reagent preferably includes a restriction endonuclease Apa I. In the present invention, the restriction endonuclease Apa I is preferably purchased from Dalian Bao Biotechnology Co., Ltd.

[0046] The present invention also provides a method for identifying wheat haplotypes, comprising the following steps:

[0047] Using the primers described in the above scheme to perform PCR amplification on the genomic DNA of the material to be tested, to obtain a PCR amplification product;

[0048] The PCR amplification product is digested with restriction endonuclease Apa I to obtain a digestion product;

[0049] When the enzyme cleavage product is a single 1780bp band, the material to be tested is a Hap3 haploid wheat material; when the enzyme cleavage product includes two short fragments of 1879bp and 188bp, the material to be tested is a Hap1 haploid wheat material; when the enzyme cleavage product includes two short fragments of 1591bp and 188bp, the material to be tested is a Hap2 haploid wheat material.

[0050] The present invention first extracts genomic DNA from the material to be tested. The material to be tested described in the present invention is preferably wheat. The present invention has no special requirements on the type of wheat, and any type of wheat can be used. The present invention has no special restrictions on the method for extracting genomic DNA from the wheat to be tested, and the conventional plant cell genome extraction method in the art can be used. In the specific implementation process of the present invention, the wheat leaves or other tissues to be tested are used as materials, and the CTAB method is used for extraction. The CTAB method described in the present invention is carried out according to conventional methods.

[0051] After obtaining the genomic DNA of the material to be tested, the present invention uses the genomic DNA of the material to be tested as a template and utilizes the primers described in the above scheme to perform PCR amplification on the genomic DNA of the material to be tested to obtain a PCR amplification product.

[0052] In the present invention, the reaction system used for PCR amplification is based on 50 μL, preferably including: 200 ng of genomic DNA of the material to be tested, 0.3 μL of 10 μM upstream primer CAPS-F, 0.3 μL of 10 μM downstream primer CAPS-R, 25 μL of 2×KOD OneTMPCR MasterMix and the remainder of ddH 2 O; the KOD OneTM PCRMasterMix was purchased from Toyobo Biotechnology Co., Ltd. The concentration of the wheat genomic DNA in the present invention is preferably 100-200 ng / μL; the OD of the genomic DNA 260 / OD 280 The ratio is preferably 0.6-0.8; the procedure of the PCR amplification reaction is: the first stage is pre-denaturation at 94°C for 3 minutes; the second stage is denaturation at 98°C for 10 seconds, annealing at 59°C for 30 seconds, extension at 68°C for 3 minutes, and 32 cycles; the third stage: final extension at 68°C for 5 minutes.

[0053] After the PCR amplification is completed, the PCR amplification product is preferably stored at 4° C. The present invention uses DNA of different haploid wheat varieties as templates and uses the primer pair to amplify the promoter region fragments (-2067bp to -1bp) of the TabHLH39-5B gene in different haploid wheats, and single amplification bands can be obtained, wherein the length of the Hap 1 haploid amplification fragment is 2067bp, the length of the Hap 2 haploid amplification fragment is 1779bp, and the length of the Hap 3 haploid amplification fragment is 1780bp.

[0054] After obtaining the PCR amplification product, the amplification product is recovered and the concentration is determined. The present invention uses restriction endonuclease Apa I to digest the PCR amplification product to obtain a digestion product; after obtaining the digestion product, the present invention detects the polymorphism of the digestion product, and judges the allelic variation type of the TabHLH39-5B gene in wheat according to the detection result. The detection of the present invention is preferably analyzed by agarose gel electrophoresis. When the digestion product is a single 1780bp band, the material to be tested is a Hap3 haplotype wheat material; when the digestion product includes two short fragments of 1879bp and 188bp, the material to be tested is a Hap1 haplotype wheat material; when the digestion product includes two short fragments of 1591bp and 188bp, the material to be tested is a Hap2 haplotype wheat material.

[0055] In the present invention, the reaction system used for the enzyme digestion is based on 10 μL, preferably including: 300 ng of PCR amplification product, 0.5 μL of Apa I, 1 μL of buffer, 1 μL of BSA, supplemented with ddH 2 0 to 10 μL.

[0056] The present invention also provides the use of the molecular marker combination, the primer pair, the kit or the method described in the above scheme in wheat breeding; in the present invention, Hap2 haploid wheat material is selected for breeding in the application.

[0057] The present invention also provides the use of the molecular marker combination, the primer pair, the kit or the method described in the above scheme in screening high thousand-grain weight wheat.

[0058] The present invention also provides a method for molecular marker-assisted breeding of high thousand-grain weight wheat, using the primer pairs described in the above scheme to molecularly mark the target wheat, and screening Hap2 haploid wheat materials for subsequent screening.

[0059] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0060] Example 1

[0061] 1. Materials

[0062] In this example, 252 common wheat varieties were selected, and the detailed information is shown in Table 1. The high-fidelity PCR enzyme KOD OneTM PCR Master Mix used for PCR amplification was purchased from Toyobo Biotechnology Co., Ltd., the blunt-end cloning vector ZT4-Blunt was purchased from Zhuangmeng Biotechnology Co., Ltd., and the Apa I restriction endonuclease was purchased from Dalian Bao Biotechnology Co., Ltd. Other drugs were domestic analytical grade.

[0063] Table 1 Hexaploid wheat varieties used in this example

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071] 2. Primer Design

[0072] First, based on the sequence differences of the three copies 5A, 5B, and 5D of the TabHLH39 gene in the wheat genome database, 5B-specific promoter amplification primers (TabHLH39-5B-Promoter-SF: gcccccaagtaatacccaat, as shown in SEQ ID NO.4 / SR: tcaagattcaagagcaaacc, as shown in SEQ ID NO.5) and coding region amplification primers TabHLH39-5B-CDS-SF: tttcgttgtttgattcttgc, as shown in SEQ ID NO.7 / SR: gctgcgacctttcatttc, as shown in SEQ ID NO.8) were designed. Primer synthesis and sequencing were completed by Henan Shangya Biotechnology Co., Ltd.

[0073] 3. Extraction of Wheat Genomic DNA

[0074] The total DNA of wheat was extracted by CTAB method. First, the wheat leaves or other tissues were quickly frozen and ground with liquid nitrogen, and 1 mL of preheated CTAB extraction solution was added, and the mixture was incubated in a 65°C water bath for 1 hour. After centrifugation at 12000g for 10 minutes at room temperature, the supernatant was taken and an equal volume of chloroform:isoamyl alcohol (24:1) was added and oscillated. After centrifugation at 12000g for 10 minutes, the supernatant was transferred to a new tube, 2 times the volume of anhydrous ethanol was added to mix, and the mixture was allowed to stand at -20°C for 30 minutes. The supernatant was removed by centrifugation again, and the mixture was washed twice with 75% ethanol. After drying, 100 μL of sterile water was added to dissolve the DNA.

[0075] 4. Amplification and sequencing of the promoter and coding region of TabHLH39-5B gene

[0076] The target fragment was amplified using the high-fidelity PCR enzyme KOD OneTM PCR Master Mix. The two pairs of primers TabHLH39-5B-Promoter-SF / SR and TabHLH39-5B-CDS-SF / SR were used to amplify the promoter and coding domain sequences of TabHLH39-5B using 199 hexaploid wheat DNA as templates. The PCR system included: 25μL 2×KOD OneTM PCRMasterMix, 0.3μL of each 10μM upstream and downstream primers, 200ng DNA template, and ddH 2 O to a total volume of 50 μL. The PCR reaction program was: first step, 94°C for 3 min; second step, 98°C for 10 s, 59°C for 30 s, 68°C for 3 min, 32 cycles; third step, 68°C for 5 min. The amplification results are shown in Figure 1 As shown, the promoter amplified fragment of TabHLH39-5B is 2067 bp, and the coding region amplified fragment is 2183 bp. The PCR amplified target fragments of 199 varieties were recovered and connected with the ZT4-Blunt cloning vector, transformed into Escherichia coli, and more than three positive clones were picked and sequenced with universal primers T7-F / R.

[0077] 5. Sequence alignment and haplotype analysis of the promoter and coding regions of TabHLH39-5B gene

[0078] The sequencing results were spliced ​​and aligned using DNAMAN software (http: / / www.lynnon.com). The alignment results of the TabHLH39-5B promoter sequence in allohexaploid (AABBDD) wheat materials are shown in Figure 2. Figure 5 ; The alignment results of the coding region sequence of TabHLH39-5B genome in allohexaploid (AABBDD) wheat materials are shown in Figure 6 The sequence alignment results showed that there were three SNPs (110bp T / G, 752bpA / C, 1165bpA / G) in the coding region of TabHLH39-5B in 252 wheat varieties (1-1776bp). One SNP (752bpA / C) was located in the exon, but it would not cause changes in the encoded amino acids and was a nonsense mutation site. There were 10 SNP polymorphic variation sites in the promoter region (-2067bp to -1bp). The haplotype of the promoter was identified using DnaSP 5.10 software (http: / / www.ub.edu / DnaSP). The results showed that these 13 SNPs were closely linked to form three haplotypes, named TabHLH39-5B-Hap1, TabHLH39-5B-Hap2, TabHLH39-5B-Hap3 ( Figure 2 ).

[0079] 6. Analysis of Thousand-Grain Weight of Different Haploid Wheat Varieties in Hexaploid Wheat

[0080] The thousand-grain weight of different haploid wheat varieties in hexaploid wheat is shown in Appendix 1 for detailed information. The results of the analysis (Table 2) are as follows Figure 3 As shown, the average thousand-grain weight of Hap2 haplotype wheat varieties is significantly higher than that of Hap1 and Hap3 haplotypes, indicating that Hap2 is an excellent haplotype with high thousand-grain weight.

[0081] Table 2 Thousand-grain weight of hexaploid wheat TabHLH39-5B haplotype

[0082]

[0083] Note: a and b in Table 2 indicate **(significant difference).

[0084] 7. CAPS molecular marker development

[0085] Since the differences between the three haplotypes of TabHLH39-5B are single base differences (SNP) and insertion and deletion differences (InDel), restriction amplification polymorphism (CAPS) molecular markers can be developed based on these differences. First, the sequence differences of the three haplotypes of TabHLH39-5B were analyzed based on the differences in insertion and deletion (InDel). Compared with Hap1, Hap2 / Hap3 contains 2 InDels: -1215bp contains a 12bp base deletion, as shown in SEQ ID NO.1; -1489bp contains a 275bp base deletion, named large fragment 1, as shown in SEQ ID NO.2. Therefore, InDel-1489 / -1215 can be used to distinguish Hap1 from Hap 2 / Hap3.

[0086] The sequence differences of the three haplotypes of TabHLH39-5B were analyzed using dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html). Two SNPs in Hap1 / Hap 2: -1807bp (G / -) and -1805bp (C / T), that is, the two sites are located in the sequence (GGGCCC). GGGCCC can be recognized and cut by the restriction endonuclease Apa I, while GG-CTC cannot be cut. That is, Hap1 and Hap2 are located in the sequence GGGCCC, which can be recognized and cut by the restriction endonuclease Apa I, while Hap 3 cannot be cut. Molecular markers were developed based on the sequence differences here and named CAPS-1807 / -1805. Using DNA of different haplotype wheat varieties as templates, TabHLH39-5B fragments (-2067bp to -1bp) in different haplotype wheat were amplified, and single amplified bands were obtained, including Hap 1 (2067bp), Hap 2 (1779bp), and Hap 3 (1780bp). The purified PCR product was digested with Apa I restriction endonuclease purchased from Dalian Bao Biotechnology Co., Ltd. The reaction system used for the digestion included: 300ng of PCR amplification product, 0.5μL of Apa I, 1μL of buffer, 1μL of BSA, and ddH 2 The results of electrophoresis showed that the amplified product of the Hap3 haplotype wheat variety remained a single 1780bp band after enzyme digestion, while the amplified product of the Hap1 haplotype material became two fragments of 1879bp and 188bp after enzyme digestion, and the amplified product of the Hap2 haplotype material became two fragments of 1591bp and 188bp after enzyme digestion. Therefore, the CAPS-1807 / -1805 molecular marker can distinguish Hap3 from Hap 1 / Hap 2 and can be used in the molecular design breeding of new wheat varieties with high thousand-grain weight.

[0087] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Identify a molecular marker combination for wheat haplotype and / or 1000-grain weight trait, wherein the wheat haplotype is Hap1 Haplotype, Hap2 Haplotype and Hap3 A haplotype characterized by The molecular markers include a first InDel molecular marker, a second InDel molecular marker, a first SNP molecular marker and a second SNP molecular marker; The first InDel molecular marker is located in wheat TabHLH39-5B At -1215 bp in the gene promoter region, there is a 12 bp base deletion as shown in the nucleotide sequence of SEQ ID NO.1; The second InDel molecular marker is located in wheat TabHLH39-5B At -1489 bp in the gene promoter region, there is a 275 bp base deletion as shown in the nucleotide sequence of SEQ ID NO.2; The first SNP molecular marker is located in wheat TabHLH39-5B There is a G / - polymorphism at -1807bp in the gene promoter region; The second SNP molecular marker is located in wheat TabHLH39-5B There is a C / T polymorphism at -1805bp in the gene promoter region; Said TabHLH39-5B The nucleotide sequence of the gene promoter region is shown in SEQ ID No.3; TabHLH39-5B The gene promoter region is located at -1992 bp ~ -1 bp.

2. A method for identifying wheat haplotypes, characterized in that: The steps include: Using the primers for identifying the molecular marker combination according to claim 1, PCR amplification is performed on the genomic DNA of the material to be tested to obtain a PCR amplification product; Use restriction enzyme Apa 1. digesting the PCR amplification product to obtain a digestion product; When the enzyme digestion product is a single 1780 bp band, the material to be tested is Hap 3 haploid wheat materials; When the enzyme digestion product includes two short fragments of 1879 bp and 188 bp, the material to be tested is Hap 1 haploid wheat material; When the enzyme digestion product includes two short fragments of 1591 bp and 188 bp, the material to be tested is Hap 2 haploid wheat materials; The primer pair includes an upstream primer CAPS-F whose sequence is shown in SEQ ID NO.4 and a downstream primer CAPS-R whose sequence is shown in SEQ ID No.

5.

3. The method according to claim 2, characterized in that The reaction system used for the PCR amplification includes, in 50 μL, 200 ng of genomic DNA of the material to be tested, 0.3 μL of 10 μM upstream primer CAPS-F, 0.3 μL of 10 μM downstream primer CAPS-R, 25 μL of 2×KOD OneTM PCR Master Mix, and the balance of ddH2O; The procedure of the PCR amplification reaction is as follows: the first stage is pre-denaturation at 94°C for 3 min; the second stage is denaturation at 98°C for 10 s, annealing at 59°C for 30 s, extension at 68°C for 3 min, and 32 cycles; the third stage is final extension at 68°C for 5 min.

4. The molecular marker combination according to claim 1, the primer pair for identifying the molecular marker combination according to claim 1, the kit for identifying the molecular marker combination according to claim 1, or the method according to claim 2 or 3 in screening Hap2 Application in haploid wheat materials; The primer pair comprises an upstream primer CAPS-F having a sequence shown in SEQ ID NO.4 and a downstream primer CAPS-R having a sequence shown in SEQ ID No.5; and the kit comprises the primer pair.

5. Use of the molecular marker combination according to claim 1, the primer pair for identifying the molecular marker combination according to claim 1, the kit for identifying the molecular marker combination according to claim 1, or the method according to claim 2 or 3 in screening high thousand-grain weight wheat; The primer pair comprises an upstream primer CAPS-F having a sequence shown in SEQ ID NO.4 and a downstream primer CAPS-R having a sequence shown in SEQ ID No.5; and the kit comprises the primer pair.

6. A method for molecular marker-assisted breeding of high thousand-grain weight wheat, characterized in that: Detect target wheat using the primer pair for identifying the molecular marker combination of claim 1, and screen Hap2 Haploid wheat material; the primer pair comprises an upstream primer CAPS-F whose sequence is shown in SEQ ID NO.4 and a downstream primer CAPS-R whose sequence is shown in SEQ ID No.5.

Images