Mutants of RML lipase and their applications

Abstract

The present invention discloses an RML lipase mutant and its application. The amino acid sequence of the RML lipase mutant is shown as SEQ ID NO.2. Compared with the wild-type lipase, the optimal reaction temperature of the mutant changes from the original 45°C to 20°C, and the specific activity at the optimal reaction temperature of 20°C is increased to 5 times that of the wild-type lipase, and the optimal reaction pH shows an obvious acid shift. The RML lipase mutant of the present invention better meets the temperature and activity requirements of lipases in the detergent industry and has good application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of enzyme engineering, and in particular relates to a mutant of Rhizomucor miehei lipase (RML) with high activity at low temperature and its application in preparing detergents. Background Art

[0002] Bioenzyme preparations as detergent additives are a major technological advancement in the development of the synthetic detergent industry. They promote the sustainable development of the detergent industry and are a key solution to energy conservation, consumption reduction, environmental protection, and emission reduction in the laundry industry. Their role is primarily reflected in the following aspects: First, as active biocatalysts, enzymes are inherently non-toxic and highly biodegradable, thus minimizing environmental impact. Second, enzymes are suitable for low-temperature environments, allowing consumers to wash at low temperatures and reducing energy consumption during the laundry process. Third, enzyme preparations offer excellent cleaning results, enhancing the overall detergency of laundry detergents and addressing issues such as poor detergency caused by the absence of alkaline additives.

[0003] Low-temperature washing is crucial for reducing energy consumption. Washing temperatures vary widely around the world. For example, washing in Asia, such as China and Japan, is done at room temperature, while in winter the temperature can drop as low as 10°C. Low-temperature washing is also emphasized to save energy, which requires that the lipase action and stability temperature be selected between 10-40°C.

[0004] Enzymes used in detergents include alkaline proteases, cellulases, amylases, and lipases. Lipases, among them, hydrolyze lipids and can remove oils and stains. A widely used lipase in synthetic detergents is the alkaline lipase Lipolase, launched by the Danish company Novo in the late 1980s. This lipase has a high optimum temperature, limiting its application. A survey shows that 75% of detergents in Europe currently incorporate lipase, while approximately 55% of laundry detergents in Japan and 33% in the United States do. Given global resource scarcity and growing public awareness of energy conservation and environmental protection, promoting the use of energy-saving, environmentally friendly, green, and efficient detergents is imperative.

[0005] Currently, several Chinese companies and R&D institutions are investing in the development and promotion of low-temperature detergents, launching a series of low-temperature instant detergents. To adapt to this trend, further development and application of lipases suitable for low-temperature detergent formulations is urgently needed. Screening for lipases with efficient catalytic activity at low temperatures is of great significance.

[0006] Low-temperature lipases can be obtained mainly through two approaches: (1) first obtain valuable low-temperature microorganisms from the natural environment (mostly cold environment), and then further improve their activity through sample collection → enrichment culture → streak separation → plate purification → selection of culture medium → shake flask rescreening (enzyme activity determination); (2) mutagenesis, breeding, gene cloning, etc. of the already developed valuable lipase-producing strains to improve their activity in low-temperature environments and catalytic efficiency for substrates.

[0007] However, there are few types of cold-resistant lipases reported so far, which cannot meet application requirements. Summary of the Invention

[0008] Based on this, one of the objects of the present invention is to provide a RML lipase mutant having high activity at medium and low temperatures.

[0009] The specific technical solutions for achieving the above-mentioned invention objectives include the following:

[0010] A RML lipase mutant, the amino acid sequence of the RML lipase mutant is shown in SEQ ID NO.2.

[0011] The present invention also provides a gene encoding the RML lipase mutant, whose nucleotide sequence is shown in SEQ ID NO.3, or its nucleotide sequence is the reverse sequence of SEQ ID NO.3.

[0012] The present invention also provides the use of the RML lipase mutant or the gene encoding the RML lipase mutant in the preparation of detergents.

[0013] In some embodiments, the cleaning product is a detergent.

[0014] The present invention also provides a detergent comprising the RML lipase mutant.

[0015] The present invention also provides a recombinant expression vector into which the coding gene of the RML lipase mutant is inserted.

[0016] The present invention also provides a recombinant engineering bacterium transformed with the above recombinant expression vector.

[0017] In some embodiments, the host strain of the recombinant engineered bacteria is Pichia pastoris.

[0018] The present invention also provides the use of the above-mentioned recombinant expression vector or the above-mentioned recombinant engineered bacteria in the preparation of detergents.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] In the present invention, a special polypeptide gene is fused with the Rhizomucor miehei lipase RML encoding gene to obtain an RML lipase mutant. Compared with the wild-type RML lipase, the optimal reaction temperature of the RML lipase mutant is changed from the original 45°C to 20°C, and the RML lipase mutant has a higher specific activity in the temperature range of 10°C to 35°C, and its specific activity is 5 times that of the wild-type lipase; in addition, the optimal reaction pH of the RML lipase mutant of the present invention is 5.0, and an obvious acid shift occurs (the optimal pH of the wild-type lipase is 8.0), indicating that the RML lipase mutant of the present invention is an acidic lipase; therefore, the RML lipase mutant of the present invention has good application prospects for preparing detergents. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is an electrophoresis detection diagram of the purified RML lipase mutant in Example 1 of the present invention.

[0022] Figure 2 These are the results of the effect of pH on the enzyme activity of wild-type and mutant RML lipase in Example 4 of the present invention.

[0023] Figure 3 These are the results of the effect of temperature on the enzyme activity of wild-type and mutant RML lipase in Example 5 of the present invention. DETAILED DESCRIPTION

[0024] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0026] Rhizomucor miehei lipase (RML) is a mesophilic lipase with an optimum temperature of 45°C and an optimum pH of 8.0 for hydrolyzing triglycerides. It exhibits the highest catalytic efficiency at these optimal conditions. To enhance the application effectiveness of RML, current RML mutants are being designed primarily to improve its thermal stability and methanol tolerance. For example, Li et al. introduced single-point mutations and disulfide bonds into RML using various computational methods. In a mutant library consisting of 36 mutants, 24 exhibited enhanced thermal stability. The optimal mutant had a 12.5-fold increase in half-life at 70°C and a 39% higher catalytic efficiency than the wild-type. Sanches et al. immobilized the lipase RML by forming a cross-linked polymer with PAA and aldehyde-dextran, creating a "nanoencapsulated" structure. This method increased the stability of the immobilized RML by 439-fold, while also exhibiting superior recycling and thermal stability. Tian et al. employed a semi-rational design approach to modify the α-helix of RML by N-glycosylation, resulting in an optimal mutant with an enzyme activity 66.81 times that of the wild-type and significantly improved methanol tolerance. The yield of biodiesel production using this mutant increased to 90.46%. The inventors of the present invention modified RML lipase to make it more suitable for use in detergents.

[0027] In one aspect of the present invention, a mutant of RML lipase (whose amino acid sequence is shown in SEQ ID NO.1) is provided (whose amino acid sequence is shown in SEQ ID NO.2, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.3). This mutant changes the optimal reaction temperature of RML lipase from 45°C to 20°C, and its specific activity at 20°C is increased to 5 times that of the wild-type lipase, which is more in line with the temperature requirements for lipase in the detergent industry and has good application prospects.

[0028] Amino acid sequence of RML lipase (SEQ ID NO. 1):

[0029] VPIKRQSNSTVDSLPPLIPSRTSAPSSSPSTTDPEAPAMSRNGPLPSDVETKYGMALNATSYPDSVVQAMSIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTFVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFGINTGLCTHHHHHH

[0030] Amino acid sequence of the RML lipase mutant (SEQ ID NO.2):

[0031] VPIKRQSNSTVDSLPPLIPSRTSAPSSSPSTTDPEAPAMSRNGPLPSDVETKYGMALNATSYPDSVVQAMSIDGGIRAATSQEINELTYYTTLSANSYCRTVIPGATWDCIHCDATEDLKIIKTWSTLIYDTNAMVARGDSEKTIYIVFRGSSSIRNWIADLTFVPVSYPPVSGTKVHKGFLDSYGEVQNELVATVLDQFKQYPSYKVAVTGHSLGGATALLCALDLYQREEGLSSSNLFLYTQGQPRVGDPAFANYVVSTGIPYRRTVNERDIVPHLPPAAFGFLHAGEEYWITDNSPETVQVCTSDLETSDCSNSIVPFTSVLDHLSYFQATDACNAGGFSWRRYREAESVDKRATMTDAELEKKLNSYVQMDKEYVKNNQARSHHHHHH

[0032] Nucleotide sequence encoding the RML lipase mutant (SEQ ID NO.3):

[0033]

[0034] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0035] Example 1 Construction of RML lipase mutant expression vector

[0036] The polypeptide (whose nucleotide sequence is SEQ ID NO. 4) was fused with the nucleotide gene sequence (parent) of RML lipase using fusion PCR technology to obtain a mutant expression vector.

[0037] The nucleotide sequence of the polypeptide (SEQ ID NO.4):

[0038] CAAGCTACTGACGCATGTAACGCAGGTGGCTTTTCCTGGAGAAGATATAGAGAGGCTGAATCTGTCGATAAGAGAGCAACTATGACTGACGCCGAGTTGGAAAAGAAGCTAAACTCTTACGTGCAAATGGATAAAGAGTATGTCAAGAACAATCAGGCCAGGTCC

[0039] The specific steps include:

[0040] (1) Design 3 pairs of primers for the peptide sequence (as shown in Table 1)

[0041] Table 1 Primer list

[0042]

[0043]

[0044] (2) Using the lipase plasmid pPICZαA-RML (stored at South China University of Technology) as a template and the primer pairs shown in Table 1 as primers, fusion PCR amplification was performed. The PCR amplification reaction system is shown in Table 2.

[0045] Table 2 Reaction system

[0046]

[0047] The PCR reaction program was as follows: pre-denaturation at 98°C for 3 min; 30 cycles of denaturation at 98°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 3 min; and extension at 72°C for 5 min.

[0048] (3) PCR products were tested by 1% agarose gel electrophoresis. After the PCR products were confirmed, Dpn I was added to remove the methylated original template strand. The enzyme digestion system was: 8 μL PCR product, 1 μL buffer, 1 μL enzyme solution, and the enzyme digestion reaction conditions were 37°C for 1 hour.

[0049] (4) The enzyme-digested product was transformed into Escherichia coli Top10. After overnight culture at 37°C, a single clone was picked and cultured in LB liquid culture medium. The plasmid was extracted and sequenced to determine whether the target polypeptide had been correctly fused with the parent gene.

[0050] In this example, three lipase mutant vectors were designed and successfully constructed (i.e., expression vectors containing RML lipase mutant encoding genes, hereinafter, the vector constructed by amplification with primer pair 1 is named RML lipase mutant 1, the vector constructed by amplification with primer pair 2 is named RML lipase mutant 2, and the vector constructed by amplification with primer pair 3 is named RML lipase mutant 3).

[0051] Example 2 Preparation and purification of RML lipase mutant enzyme protein

[0052] The following steps are involved:

[0053] 1. The three expression vectors containing the lipase mutant encoding genes constructed in Example 1 were transformed into the genome of Pichia pastoris X-33 using electroporation to obtain genetically engineered bacteria.

[0054] 2. Inoculate the genetically engineered bacteria into the YPG first-level seed culture medium for expansion. When the OD value reaches 1.6-2, transfer it to the second-level YPG seed culture medium and culture for 12-16 hours.

[0055] 3. Inoculate the seed liquid into the fermentation tank culture medium at a ratio of 1:10 for high-density fermentation. Induce expression when the wet weight of the bacteria reaches 150-180g / L. The inducer is methanol. Harvest the bacteria after 72-108h of induction. Centrifuge the bacterial liquid at 10000rpm for 20min and collect the supernatant, which is the crude enzyme liquid.

[0056] 4. The crude enzyme solution of the RML lipase mutant was concentrated and desalted with 20 mM pH 7.4 PBS buffer, loaded onto an anion exchange chromatography column (Q FF, GE Healthcare) at a flow rate of 2 mL / min, and then eluted with 20 mM pH 7.4 PBS buffer (containing 300 mM NaCl) to obtain the purified RML lipase mutant.

[0057] 5. To ensure stable protein storage, the target protein was salted and placed in 20 mM PBS buffer at pH 7.4. After the above steps, a RML lipase mutant with a purity of more than 90% was obtained. The SDS-PAGE test results were as follows: Figure 1 As shown, lanes 1 to 3 represent mutants 1 to 3. As can be seen from the figure, the RML lipase mutants achieved good purification results, with protein molecular weights of approximately 30 kDa, 28 kDa, and 32 kDa, respectively.

[0058] 6. Target protein concentration determination: Mix 20 μL of the protein solution to be tested with 200 μL of Bradford reagent and react at room temperature for 5 minutes before measuring the A 595 , combined with the standard curve, the protein concentrations of the RML lipase mutants were calculated to be 0.93 mg / mL, 0.82 mg / mL, and 0.68 mg / mL, respectively.

[0059] Example 3 Lipase activity determination of RML lipase mutants

[0060] The enzyme activity was determined by alkaline titration method.

[0061] Definition of enzyme activity: Under certain reaction conditions, the amount of enzyme required to catalyze the hydrolysis of substrate to produce 1 μmol fatty acid per minute is defined as one enzyme activity unit, expressed as U, i.e. 1U.

[0062] The enzyme activity was calculated by the following formula:

[0063]

[0064] Where: X is the specific enzyme activity, U / mg; V1: the volume of sodium hydroxide consumed by the experimental group, mL; V0: the volume of sodium hydroxide consumed by the control group, mL; t: reaction time, min; c: the protein concentration of the reaction enzyme solution, mg / mL; v: the volume of enzyme solution added to the reaction, mL.

[0065] The specific method is:

[0066] 1. Add 4 mL of olive oil emulsion and 5 mL of buffer to a 50 mL stoppered Erlenmeyer flask and preheat in a constant temperature water bath shaker for 5 min. Add 1 mL of pure RML lipase wild-type or RML lipase mutant enzyme solution to the experimental group and 1 mL of the corresponding inactivated enzyme solution to the control group. React at 200 rpm for 5 min, and then add 15 mL of 95% ethanol to terminate the reaction.

[0067] 2. After the reaction is completed, add 2 drops of 1% phenolphthalein solution and titrate with 0.05 mol / L NaOH standard solution. Calculate the volume of NaOH consumed and then calculate the lipase activity unit.

[0068] In this example, the specific lipase activities of wild-type RML lipase and three RML lipase mutants were measured. The results are shown in Table 3.

[0069] Table 3 Results of enzyme activity determination of wild-type and mutant RML lipase

[0070]

[0071]

[0072] As shown in Table 3, the lipase activities of the three RML lipase mutants constructed in the present invention were all improved compared to the wild-type RML lipase, reaching 4.8, 3.7, and 1.7 times that of the wild-type, respectively. Among them, RML lipase mutant 1 had the highest specific lipase activity, at 63.18 U / mg, and was the optimal mutant in the present invention. Its amino acid sequence is shown in SEQ ID NO. 2, and the nucleotide sequence encoding this lipase mutant is shown in SEQ ID NO. 3.

[0073] Example 4 Determination of the Optimal Reaction pH of RML Lipase Mutants

[0074] This example determined the optimal reaction pH of the best mutant of the present invention, namely RML lipase mutant 1. Specifically, the following steps were included:

[0075] 1. Lipase activity was determined at 20°C using olive oil emulsion as substrate in 20 mM reaction buffers (pH 3.0-5.0 citric acid-disodium hydrogen phosphate buffer, pH 6.0-7.0 disodium hydrogen phosphate-sodium dihydrogen phosphate buffer) with pH values of 3.0, 4.0, 5.0, 6.0, and 7.0, respectively. Each experiment was repeated three times.

[0076] 2. Draw a graph with pH as the horizontal axis and enzyme activity as the vertical axis.

[0077] The results are as follows Figure 2 As shown, from Figure 2 It can be seen that the optimal reaction pH of the RML lipase mutant of the present invention is 5.0, compared with the optimal pH of the wild-type RML lipase being 8.0.

[0078] Example 5 Determination of the Optimal Reaction Temperature of RML Lipase Mutants

[0079] This example determined the optimal reaction temperature of the best mutant of the present invention, namely RML lipase mutant 1. Specifically, the following steps were included:

[0080] 1. Lipase activity was measured using olive oil emulsion as substrate in 20 mM reaction buffer (citric acid-disodium hydrogen phosphate buffer) at 5°C, 10°C, 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, and 50°C, respectively. Each experiment was repeated three times.

[0081] 2. Draw a graph with temperature as the horizontal axis and enzyme activity as the vertical axis.

[0082] The results are as follows Figure 3 As shown, from Figure 3 It can be seen that the optimal reaction temperature of the RML lipase mutant of the present invention is 20°C, which is 25°C lower than the optimal temperature of RML lipase of 45°C. In addition, the RML lipase mutant has a high specific enzyme activity (over 40 U / mg) over a wide temperature range (10°C to 35°C), indicating that the RML lipase mutant of the present invention can achieve good catalytic effect at lower temperatures.

[0083] Example 6 Effect of RML lipase mutants as detergents

[0084] The washing performance of the RML lipase mutant of the present invention was tested using national standard sebum-stained cloth (JB-03).

[0085] 1. Cut the national standard sebum stain cloth into 6cm×6cm size.

[0086] 2. Prepare washing solutions with different formulas

[0087] Control group: 2g / L commercial detergent

[0088] Experimental group: 2 g / L commercial detergent + 0.7% pure RML lipase mutant enzyme, stirred evenly.

[0089] 3. Washing process: Use a fully automatic whiteness meter to detect the whiteness value of the dirty cloth to be tested. Add the dirty cloth to the control group and experimental group solutions respectively, wash at a speed of 120 rpm and 30°C for 20 minutes, rinse three times in clean water, spin dry, and dry, then measure the whiteness value of the washed dirty cloth. All experiments are repeated twice.

[0090] 4. Experimental results

[0091] Control group: The whiteness value of the dirty cloth before washing was 29.71, and the whiteness value after washing was 41.25

[0092] Experimental group: The whiteness value of the dirty cloth before washing was 29.57, and the whiteness value after washing was 46.71

[0093] The whiteness value of the experimental group increased by 17.14. Compared with the control group, the decontamination ratio of the experimental group (whiteness value increase of the experimental group / whiteness value increase of the control group) was 1.49.

[0094] The results of this example show that adding the RML lipase mutant of the present invention to a detergent can significantly improve the detergency of the detergent.

[0095] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0096] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. An RML lipase mutant, characterized in that the amino acid sequence of the RML lipase mutant is shown in SEQ ID NO.

2.

2. The coding gene of the RML lipase mutant according to claim 1.

3. The coding gene according to claim 2, characterized in that the nucleotide sequence of the coding gene is shown in SEQ ID NO.

3.

4. The application of the RML lipase mutant according to claim 1, or the coding gene of the RML lipase mutant according to claim 2 or 3 in the preparation of detergents.

5. The application according to claim 4, characterized in that the detergent is a washing agent.

6. A washing agent, characterized in that it comprises the RML lipase mutant according to claim 1.

7. A recombinant expression vector into which the coding gene of the RML lipase mutant of claim 2 or 3 is inserted.

8. A recombinant engineering bacterium into which the recombinant expression vector according to claim 7 is transferred.

9. The recombinant engineering bacterium according to claim 8, characterized in that the host bacterium of the recombinant engineering bacterium is Pichia pastoris.

10. The application of the recombinant expression vector according to claim 7, or the recombinant engineering bacterium according to claim 8 or 9 in the preparation of detergents.

Images