Primers and detection methods for detecting porcine DNA

Abstract

This invention provides primer pairs for detecting porcine genomic DNA, detection reagents or kits containing the primer pairs of this invention, and a method for detecting porcine genomic DNA using the primer pairs, wherein the primer pairs specifically bind to the sequence shown in SEQ ID NO:1. The PCR detection method using the primer pairs is simple, rapid, highly sensitive, and can distinguish between interfering DNAs such as bovine, CHO, Vero, human, NSO, MDCK, E. coli, Pichia pastoris, and Sf9.

Description

Technical Field

[0001] This invention relates to the field of biological detection. Specifically, this invention relates to primers and detection methods for detecting residual porcine DNA in biological materials. Background Technology

[0002] Biological extracellular matrix (ECM) is widely used in regenerative medicine and tissue engineering. Naturally derived ECM possesses a natural three-dimensional structure, is rich in collagen and growth factors, and provides a microenvironment that induces cell adhesion, proliferation, and diffusion, promoting the restoration of normal tissue structure and function. Biological ECM is primarily derived from human or mammalian tissues and organs, such as dermis, bladder, small intestine, and pericardium. Due to the wide availability and high biocompatibility of porcine tissues and organs, they are a major raw material for decellularized matrix. Biomaterials composed of porcine decellularized matrix are used clinically for the repair and regeneration of tissues and organs such as blood vessels, skin, intestines, and heart. Medical device products include biological hernia repair patches, oral repair membranes, biological patches, and wound dressings.

[0003] Decellularization and sterilization processes are used to remove cellular components and harmful microorganisms from animal tissues. These residual cellular components and nucleic acids are major causes of immunogenicity risks during implantation, and in severe cases, can lead to inflammatory reactions, intense pain, and non-infectious edema. Therefore, evaluating the effectiveness of decellularization is a crucial measure for the quality and safety control of biomaterials. Currently, the decellularization results are mainly assessed by quantitatively detecting residual cellular components, such as double-stranded DNA, in the decellularized matrix biomaterials. Domestic industry standards for animal-derived medical devices, such as YY / T 0771, and the "Technical Review Guidelines for the Registration of Animal-Derived Medical Devices" all stipulate risk management requirements for medical devices manufactured using animal tissues or their derivatives.

[0004] Nucleic acid-based molecular biology techniques, such as quantitative real-time PCR (qPCR), utilize specifically fluorescently labeled TaqMan probes to quantitatively detect and analyze residual DNA in samples. The probes, carrying fluorescent groups, continuously excite fluorescence signals during thermal cycling. By monitoring changes in the accumulated fluorescence signal, the increase in PCR products is reflected, thereby achieving quantitative analysis of the target DNA. qPCR technology offers advantages such as high specificity, high accuracy, and high speed.

[0005] Currently, the detection of porcine components mainly focuses on the food industry, including meat products and gelatin, with limited application in medical devices using animal-derived biomaterials for residual DNA detection. Furthermore, porcine qPCR target design typically uses single-copy genes or mitochondrial genes, whose low copy numbers or inconsistencies within cells can lead to quantitative bias or false negatives, making them unsuitable for the quantitative detection of trace residual DNA in biological materials. Highly repetitive sequences in mammals such as pigs can be repeated over hundreds of thousands of times and are uniformly stable across chromosomes. Therefore, quantitative real-time PCR methods based on highly repetitive sequence targets can significantly improve the sensitivity, specificity, and accuracy of detection. This can be used to establish a quantitative qPCR method for detecting trace residual porcine DNA in biological materials, effectively reducing and avoiding safety risks associated with its application in clinical or aesthetic medical devices. Summary of the Invention

[0006] The purpose of this invention is to provide a primer pair with high sensitivity and high specificity for detecting porcine DNA residues in biological materials, as well as a detection reagent or PCR kit containing said primer pair.

[0007] Another object of the present invention is to provide a method or PCR method for detecting porcine DNA residues in biological materials using primer pairs or detection reagents provided by the present invention.

[0008] In a first aspect, the present invention provides a primer pair for detecting porcine genomic DNA, the primer pair comprising a forward primer and a reverse primer, wherein the forward primer binds to positions 2-30, preferably positions 5-24, of the sequence shown in SEQ ID NO:1 on the porcine genomic DNA; wherein the reverse primer binds to positions 120-150, preferably positions 127-143, of the sequence shown in SEQ ID NO:1 on the porcine genomic DNA; and the amplification product obtained by the primer pair has a length of 139-149 bp.

[0009] In a preferred embodiment, the lengths of the forward and reverse primers are 16–22 bp; preferably 20 bp.

[0010] In a preferred embodiment, the Tm temperature of the forward and reverse primers is 58–60°C, and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≤2°C.

[0011] In a specific implementation, the primer pair includes the forward primer as shown in SEQ ID NO:2 and the reverse primer as shown in SEQ ID NO:3.

[0012] In a second aspect, the present invention provides a detection reagent comprising the primer pair described in the first aspect.

[0013] In a preferred embodiment, the detection reagent further comprises a probe.

[0014] In a preferred embodiment, the probe is as shown in SEQ ID NO:4.

[0015] In a third aspect, the present invention provides a detection kit comprising the primer pair described in the first aspect or the detection reagent described in the second aspect, and optionally further comprising instructions for use in detecting porcine DNA using the primer pair or the detection reagent.

[0016] In a specific implementation, the detection reagent further includes a probe.

[0017] In a preferred embodiment, the probe is as shown in SEQ ID NO:4.

[0018] In a specific implementation, the forward primer in the primer pair is shown as SEQ ID NO:2, the reverse primer is shown as SEQ ID NO:3, and the probe is shown as SEQ ID NO:4.

[0019] In a preferred embodiment, the detection sensitivity of the detection reagent is 10 fg / reaction.

[0020] In a fourth aspect, the present invention provides a method for detecting porcine genomic DNA, the method comprising: performing PCR on a sample to be tested using the primer pair described in the first aspect, the detection reagent described in the second aspect, or the detection kit described in the third aspect, and detecting the PCR amplification products.

[0021] In a fifth aspect, the present invention provides a PCR kit comprising a container and the primer pair described in the first aspect located within the container.

[0022] In a preferred embodiment, the lengths of the forward and reverse primers are 16–22 bp; preferably 20 bp.

[0023] In a preferred embodiment, the Tm temperature of the forward and reverse primers is 58–60°C, and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≤2°C.

[0024] In a preferred embodiment, the kit also contains probes.

[0025] In a preferred embodiment, the probe is as shown in SEQ ID NO:4.

[0026] In a preferred embodiment, the detection sensitivity of the detection reagent is 10 fg / reaction.

[0027] In a preferred embodiment, the kit also contains a standard control.

[0028] In a sixth aspect, the present invention provides a PCR method, comprising the steps of:

[0029] In a PCR detection system, the target product is amplified using the primer pairs described in the first aspect.

[0030] In a preferred embodiment, the lengths of the forward and reverse primers are 16–22 bp; preferably 20 bp.

[0031] In a preferred embodiment, the Tm temperature of the forward and reverse primers is 58–60°C, and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≤2°C.

[0032] In a preferred embodiment, the kit also contains probes.

[0033] In a preferred embodiment, the probe is as shown in SEQ ID NO:4.

[0034] In a seventh aspect, the present invention provides the use of the primer pair described in the first aspect, the detection reagent described in the second aspect, or the detection kit described in the third aspect for detecting the presence of porcine genomic DNA in a test subject.

[0035] In a preferred embodiment, the test subject is a porcine decellularized matrix; preferably, it is a decellularized matrix derived from the dermis, bladder, small intestine, and pericardium of pigs, including but not limited to biological hernia repair patches, oral repair membranes, biological patches, wound dressings, collagen, pericardial bioprosthetic valves, ophthalmic implants, artificial skin, and medical suture materials.

[0036] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0037] Figure 1 The amplification curves of the reference sample are shown, in which the primer pairs used are SEQ ID NO:2 and SEQ ID NO:3.

[0038] Figure 2 The standard curve of the reference sample is shown, in which the primer pair used is SEQ ID NO:2 and SEQ ID NO:3.

[0039] Figure 3-5The amplification curves for concentrations of 3 fg / μL, 1 fg / μL and 0.2 fg / μL in the sensitivity assay are shown, with the primer pairs used being SEQ ID NO:2 and SEQ ID NO:3. Detailed Implementation

[0040] Through in-depth and extensive research, the inventors unexpectedly discovered that primers designed targeting the sequence shown in SEQ ID NO:1 of the pig genome can not only detect residual porcine DNA with high sensitivity, but also distinguish interfering DNA from bovine and other sources. The method of this invention is simple, rapid, and highly specific and sensitive. Based on this, the present invention was completed.

[0041] The primer pairs of the present invention

[0042] The term "primer" as used herein has the meaning conventionally understood by those skilled in the art. The porcine genomic DNA-specific primers of this invention are not designed for the exogenous gene itself or the viral vector itself, but rather for the region shown in SEQ ID NO:1 on the porcine genomic DNA. In other words, the primers of this invention can specifically bind to the region shown in SEQ ID NO:1 on the porcine genomic DNA.

[0043] In view of the teachings of this invention and common knowledge in the art, those skilled in the art should understand that various primer pairs can be designed for the segment shown in SEQ ID NO:1. Therefore, the primer pairs of this invention are not limited to the primer pairs specifically obtained in the embodiments.

[0044] In a specific embodiment, the forward primer of the present invention binds to positions 2-30, preferably positions 5-24, of the sequence shown in SEQ ID NO:1; the reverse primer binds to positions 120-150, preferably positions 127-143, of the sequence shown in SEQ ID NO:1, and the amplification product obtained by the primer pair has a length of 139-149 bp.

[0045] In a preferred embodiment, the lengths of the forward and reverse primers are 16–22 bp; preferably 20 bp.

[0046] In a preferred embodiment, the Tm temperature of the forward and reverse primers is 58–60°C, and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≤2°C.

[0047] In a specific embodiment, the primer pair of the present invention includes the forward primer as shown in SEQ ID NO:2 and the reverse primer as shown in SEQ ID NO:3.

[0048] probe

[0049] As used herein, the term "primer" has the meaning conventionally understood by those skilled in the art: a short segment of single-stranded DNA or RNA used to detect a complementary nucleic acid sequence.

[0050] Based on the teachings of this invention and common knowledge in the art, those skilled in the art should understand that, knowing the primer pairs, they can independently design probes based on the template sequence between the binding sites of the forward and reverse primers, and test the technical effect of the probes with the primer pairs. In specific embodiments, those skilled in the art can design probes as needed; the probes can be in a liquid phase or immobilized on a solid phase; they can bind before or after amplification. Therefore, the probes of this invention are not limited to the probes specifically disclosed in the embodiments. The primer pairs of this invention are also not limited to use in conjunction with the probes specifically disclosed in the embodiments.

[0051] In a specific embodiment, the probe of the present invention is shown in SEQ ID NO:4.

[0052] The detection reagent of the present invention

[0053] This invention also provides a detection reagent for detecting porcine genomic DNA, the detection reagent comprising the primer pairs of this invention and other components required for PCR, such as Taq enzyme, dNTPs, and Mg. 2+ etc.

[0054] In a specific embodiment, the detection reagent of the present invention comprises the forward primer shown in SEQ ID NO:2, the reverse primer shown in SEQ ID NO:3, and the probe shown in SEQ ID NO:4.

[0055] In a specific embodiment, the detection sensitivity of the detection reagent of the present invention reaches 10 fg / reaction.

[0056] Based on the primer pairs or detection reagents of the present invention, the present invention further provides a method for detecting porcine genomic DNA, the method comprising: performing PCR on the sample to be tested using the primer pairs or detection reagents of the present invention, and detecting the PCR amplification products.

[0057] Based on the primer pairs of the present invention, the present invention also provides a PCR kit, the kit comprising a container and the primer pairs or detection reagents of the present invention located in the container.

[0058] In a specific embodiment, the PCR kit of the present invention also contains other necessary components for performing PCR and instructions for use in PCR detection. In a preferred embodiment, the kit also contains a standard control.

[0059] Based on the primer pairs of the present invention, the present invention also provides a PCR method for amplifying target products using the primer pairs of the present invention.

[0060] biomaterials

[0061] The primer pairs, detection reagents, or detection kits of this invention can be used to detect residual porcine DNA in biological materials. The biological materials described herein are biologically derived extracellular matrix. In a preferred embodiment, the biologically derived extracellular matrix is ​​a decellularized porcine matrix. In specific embodiments, the decellularized porcine matrix is ​​derived from the decellularized matrix of the dermis, bladder, small intestine, and pericardium of pigs, including but not limited to biological hernia repair patches, oral repair membranes, biological patches, wound dressings, collagen, pericardial bioprosthetic valves, implanted corneas, artificial skin, and medical suture materials.

[0062] The advantages of this invention include:

[0063] 1. The primer pairs or detection reagents of the present invention can detect porcine genomic DNA with high sensitivity;

[0064] 2. The primer pairs or detection reagents of the present invention can distinguish interfering DNAs such as bovine, CHO, Vero, human, NSO, MDCK, E. coli, Pichia pastoris, and Sf9;

[0065] 3. The detection method of the present invention is simple and quick to operate, and has high specificity and sensitivity.

[0066] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2001), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated.

[0067] Example

[0068] Materials and Methods

[0069] 1. The porcine genomic DNA reference material was obtained from Huzhou Shenke Biotechnology Co., Ltd.

[0070] 2. Sample pretreatment reagents

[0071] The sample pretreatment reagents were from Huzhou Shenke Biotechnology Co., Ltd., and included proteinase K, proteinase K buffer, magnetic beads, binding solution, glycogen, yeast tRNA, washing solution A, washing solution B, and elution solution.

[0072] 3. qPCR detection system

[0073] The qPCR detection kit is from Huzhou Shenke Biotechnology Co., Ltd., and includes qPCR reaction buffer, DNA dilution solution, primers, probes, DNA standards, and internal quality control.

[0074] 4. Instrument: Applied Biosystems 7500 Real-Time PCR System.

[0075] Experimental operation and process

[0076] 1. Sample pretreatment

[0077] 1) Accurately weigh 5-10 mg of the sample and record the weight, then place it into a 1.5 mL DNase-free sterile centrifuge tube.

[0078] 2) After processing the sample into small fragments as much as possible, add 1000 μL of proteinase K buffer and 200 μL of proteinase K, and add DEPC water to a final volume of 2000 μL. Digest in a metal bath at 56°C for 1 hour, until the sample is completely digested and no visible particulate matter remains.

[0079] 3) After digestion, take 200 μL of sample and add 200 μL of working binding buffer, 9 μL of glycogen, and 0.2 μL of yeast tRNA, and mix well.

[0080] 4) Add 200 μL isopropanol and 30 μL magnetic beads, shake to mix for 5 min, centrifuge quickly for 10 s, and place on a magnetic rack. After the solution is clear and the magnetic beads have completely separated, gently open the tube cap and carefully aspirate the supernatant.

[0081] 5) Add 700 μL of washing solution A, vortex to mix, then centrifuge rapidly for 10 seconds and place on a magnetic rack. After the solution becomes clear and the magnetic beads are completely separated, aspirate the supernatant.

[0082] 6) Add 700 μL of washing buffer B, vortex to mix, then centrifuge rapidly for 10 seconds and place on a magnetic rack. After the solution becomes clear and the magnetic beads are completely separated, aspirate the supernatant.

[0083] 7) Centrifuge again quickly for 10 seconds, place on a magnetic rack, and remove any remaining liquid after the magnetic beads have completely separated.

[0084] 8) Open the tube cap and dry at room temperature for 5-10 seconds to remove residual ethanol. Observe carefully during the drying process to prevent the magnetic beads from becoming too dry, so that they do not completely dissolve during elution.

[0085] 9) Add 150 μL of elution buffer, gently shake to mix the magnetic beads and elution buffer, incubate in a 70°C water bath for 7 min, shaking once every 2 min during the water bath, and shaking to mix 2-3 times.

[0086] 10) Centrifuge quickly for 10 seconds, place on a magnetic rack, and after the magnetic beads separate, transfer the supernatant to a new centrifuge tube.

[0087] 2. Detection

[0088] 2.1 Preparation of Reference Materials

[0089] The reference sample was genomic DNA extracted from porcine kidney cells at a concentration of 100 ng / μL.

[0090] 2.2 Preparation of Standard Curve Samples

[0091] The reference sample was serially diluted 10-fold using DNA dilution buffer to prepare standard solutions of 3000 pg / μL, 300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL, and 0.03 pg / μL.

[0092] 2.3 qPCR reaction system

[0093] The detection system consists of 30 μL of qPCR reaction solution and 10 μL of template.

[0094] Take 10 μL of the sample to be tested, the template-free control, and the standard curve sample, and add them to 20 μL of qPCR reaction solution, setting up 3 replicates. After adding the samples, centrifuge briefly for 3 seconds and then place them in the qPCR instrument. Set the reaction program as follows: 95℃ pre-denaturation for 10 min; 95℃ for 15 s, 60℃ for 40 s, 40 cycles; reaction volume 30 μL.

[0095] 2.4 Plotting Standard Curves

[0096] After amplification, a threshold line is set, and the amplification efficiency, slope, R2, and detection values ​​of each sample are read from the standard curve.

[0097] 2.5 Result Determination

[0098] a) Correlation coefficient R of the standard curve equation 2 It should be greater than 0.990, and the slope should be between -3.1 and -3.8 (i.e., the amplification efficiency should be between 83.3% and 110%).

[0099] b) The Ct value was not detected or was ≥35 in the template-free control (NTC).

[0100] Example 1. Design of primer pairs and probes

[0101] The inventors designed primer pairs and probes for detecting residual porcine DNA using the following target sequences:

[0102] 1. Target sequence

[0103] The following sequences in the pig genome were selected as the target sequences for qPCR:

[0104] AGGGAGTTCCCATCGTGGCTCAGTGGTAACGAACCTGACTAGTATCCATGAGGATGCAGATTCAATCCCTGGCCTTNCTCAGTGGGTTAAGGATCCNGCATTGCTGTGAGNTGTGGTGTAGGTCNCAGATGCGGCTCGGATCCCGTGTTGCTGTGGCTGTGGTGTAGGCCGCAGCTACAGCTCCGATTNGACCCCTAGCCTGGGAACCTCCATATGCCGCGGGTGNGGCCCT (SEQ ID NO:1)

[0105] 2. Primer and probe design

[0106] For the sequence shown in SEQ ID NO:1, the inventors designed the following primer pairs and probes:

[0107] Forward primer: AGTTCCCATCGTGGCTCAGT (SEQ ID NO:2);

[0108] Reverse primer: GGATCCGAGCCGCATCT (SEQ ID NO:3);

[0109] Probe: FAM-ATCCATGAGGATGCAGATT-MGB (SEQ ID NO:4).

[0110] Example 2. Detection of linear range

[0111] The inventors tested the linear range of the primer pairs of this invention. The specific experimental procedure is as described in the "Experimental Operation and Procedure" section above.

[0112] The experimental results showed that the concentration range for detecting porcine DNA was 30 ng / reaction to 300 fg / reaction (see Table 1), and the standard curve parameter R... 2 : 0.999, amplification efficiency of 99.16% (e.g. Figure 1 (as shown in Figure 2).

[0113] Table 1. Mean Ct values ​​of the standard curve amplification

[0114] Standard Curve Mean Ct value St1 (30ng / reaction) 13.39 St2 (3ng / reaction) 16.70 St3 (300 pg / reaction) 20.09 St4 (30 pg / reaction) 23.48 St5 (3 pg / reaction) 26.78 St6 (300 fg / reaction) 30.07

[0115] Example 3. Specificity Detection

[0116] DNA from multiple cell species, including bovine, CHO, Vero, human, NSO, MDCK, E. coli, Pichia pastoris, and Sf9, was used for interference experiments. qPCR amplification was performed using 30 ng / reaction of interfering DNA as a template. The results showed that none of the nine interfering DNAs (30 ng / reaction) had detectable Ct values ​​(see Table 2), indicating that qPCR detection had good specificity.

[0117] Table 2. Detection Ct values ​​of 9 interfering DNAs

[0118] DNA interference Mean Ct value of qPCR detection ox Undet. CHO Undet. Vero Undet. people Undet. NS0 Undet. MDCK Undet. E. coli Undet. Pichia pastoris Undet. Sf9 Undet.

[0119] Example 4. Determination of detection sensitivity

[0120] 1. In this embodiment, the inventors measured the sensitivity of the detection system of the present invention.

[0121] Porcine genomic DNA reference samples were diluted to concentrations of 3 fg / μL, 1 fg / μL, and 0.2 fg / μL, with eight replicates per concentration and three independent experiments performed. A total of 24 data points were collected. Results showed that all 24 tests at 1 fg / μL yielded detectable values ​​and clear amplification curves (see Table 3). Figure 3-5 The detection sensitivity can reach 1 fg / μL, or 10 fg / reaction.

[0122] Table 3. Sensitivity test data results (24 tests)

[0123]

[0124]

[0125] Example 5. Detection of actual samples

[0126] In this embodiment, the detection system of the present invention was used to quantitatively detect porcine DNA residues in absorbable biomembranes and lyophilized porcine type I collagen samples. The results showed that the residual porcine DNA in the absorbable biomembrane extract was below the quantitative range of the standard curve, and the residual amount of porcine DNA in the lyophilized porcine type I collagen was 0.2 ng / mg (see Table 4).

[0127] Table 4. Actual sample test results

[0128]

[0129] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A primer pair for detecting porcine genomic DNA, said primer pair comprising a forward primer and a reverse primer, The forward primer is shown in SEQ ID NO:2, and the reverse primer is shown in SEQ ID NO:

3.

2. A detection reagent comprising the primer pair of claim 1.

3. A detection kit comprising the primer pair of claim 1 or the detection reagent of claim 2, and optionally further comprising instructions for use in detecting porcine DNA using the primer pair or the detection reagent.

4. The detection kit as described in claim 3, characterized in that, The detection reagent also includes a probe.

5. The detection kit as described in claim 4, characterized in that, The forward primer in the primer pair is shown in SEQ ID NO:2, the reverse primer is shown in SEQ ID NO:3, and the probe is shown in SEQ ID NO:

4.

6. A method for detecting porcine genomic DNA, the method comprising: Using the primer pair described in claim 1, the detection reagent described in claim 2, or the detection kit described in any one of claims 3-5, PCR is performed on the sample to be tested, and the PCR amplification products are detected.

7. A PCR kit comprising a container and a primer pair of claim 1 located in the container.

8. A PCR method, comprising the following steps: In a PCR detection system, the target product is amplified using the primer pair described in claim 1.

9. The use of the primer pair of claim 1, the detection reagent of claim 2, or the detection kit of any one of claims 3-5, for detecting the presence of porcine genomic DNA in a test subject.

Images