A method for increasing the secretion rate of foreign protein expressed in silkworm cells

Abstract

A method for increasing the secretion rate of foreign proteins expressed in silkworm cells, extracting cDNA obtained by reverse transcription of all RNA from silkworm BmN cells, and synthesizing the cDNA using the reverse transcribed cDNA as a template license plate Gene, then the SEQ ID NO. license plate Gene transfer into silkworm BmN cells can increase the secretion rate of foreign proteins expressed in silkworm cells. The present invention can effectively increase the secretion efficiency of foreign proteins expressed in silkworm cells, provide new research directions and ideas for increasing the secretion rate of foreign proteins expressed in silkworm cells, and provide a reference for the study of the mechanism of signal peptides involved in protein secretion.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and in particular relates to a method for improving the secretion rate of foreign protein expressed by silkworm cells. Background Art

[0002] With the improvement of people's living standards and the enhancement of health awareness, the demand for various recombinant protein drugs for treatment or health care has been rising year by year. At the same time, the output value of the biotechnology industry, which produces recombinant proteins for treatment such as vaccines, immunoglobulins, antibodies and protein factors, has been growing strongly, and its position in the biopharmaceutical industry has become increasingly prominent. Therefore, in recent years, research on increasing the expression of recombinant proteins, especially secretory proteins and membrane proteins whose expression levels have always been low, has received widespread attention.

[0003] Many proteins need to be secreted outside the cell or localized on the membrane to exert their biological functions, and a number of studies have shown that the expression efficiency of membrane proteins and secretory proteins is low (S Chakrabarti, M Robert-Guroff, F Wong-Staal, et al. Expression of the HTLV-III envelope gene by a recombinantvaccinia virus. 1986 Nature. 320 (6062): 535-7. doi: 10.1038 / 320535a0.). In recent years, there are many studies and patents on improving the expression of secretory proteins in yeast cells, insect cells and mammalian cells. Zhang Xinran et al. once disclosed a method for increasing the expression of secretory exogenous proteins in Pichia pastoris, by co-expressing HAC1, ERO1 double genes or HAC1, ERO1, BIP three genes in Pichia pastoris cells, effectively increasing the expression of secretory exogenous proteins in Pichia pastoris [ZL2014103955743]. There are also studies reporting that the use of signal peptide sequences of proteins that effectively target the endoplasmic reticulum of insect cells, such as the Autographa californica nuclear polyhedrosis virus (AcMNPV) GP64 protein or bee venom signal peptide, can greatly improve the expression and secretion rate of membrane proteins [De Pinheiro CGM, Pedrosa M d O, Teixeira NC, et al., 2016. Optimization of canine interleukin-12 production using a bacμLo virus insect cell expression system. BMC Res. Wang BZ, Liu W, Kang SM, et al., 2007. Incorporation of High Levels of Chimeric Human Immunodeficiency VirusEnvelope Glycoproteins into Virus-Like Particles. J. Virol. 81(20)]. Silkworms have a long history of breeding in my country. Silkworm larvae are large, have no flight ability, and can be raised in a sterile manner. Therefore, they are suitable as "biofactories" for the production of recombinant proteins and have many advantages. Since Smith et al. expressed interferon in silkworm cells in 1983, there have been thousands of proteins expressed in silkworm cells, larvae and pupae.In 2020, Japanese scholars R Fujita and others successfully expressed the secretory SARS-CoV-2 S protein in the silkworm hemolymph [Ryosuke Fujita, Masato Hino, Takeru Ebihara, et al. Efficient production of recombinant SARS-CoV-2 spike protein using the baculovirus-silkworm system. 2020. Biochem Biophys Res Commun, 529 (2): 257-262. doi: 10.1016.], providing theoretical information for further application in the preparation of detection kits and vaccines for the new coronavirus. If the secretion of secretory proteins can be increased, the cost of protein expression can be reduced, thereby reducing the cost of its wide application in medicine, antigen preparation, detection kits, and other applications. Summary of the invention

[0004] Technical problem to be solved: The present invention discloses a method for improving the secretion rate of exogenous proteins expressed in silkworm cells. The spz gene is synthesized by using cDNA synthesized by reverse transcription of total RNA of silkworm BmN cells as a template to construct a pIZ / V5-spz recombinant plasmid. After transfecting BmN cells for 72 hours, the secretion rate of exogenous proteins in the cells can be significantly improved.

[0005] Technical solution: Application of the spz gene shown in SEQ ID NO.1 in improving the secretion rate of foreign proteins expressed in silkworm cells.

[0006] Application of a cell line stably expressing the spz gene shown in SEQ ID NO.1 in improving the secretion rate of foreign protein expressed by silkworm cells.

[0007] Application of a baculovirus vector stably expressing the spz gene shown in SEQ ID NO.1 in improving the secretion rate of foreign protein expressed in silkworm cells.

[0008] A method for improving the secretion rate of foreign proteins expressed in silkworm cells comprises extracting cDNA obtained by reverse transcription of all RNA of silkworm BmN cells, synthesizing spz gene by using the reverse transcribed cDNA as a template, and then transferring the spz gene shown in SEQ ID NO.1 into silkworm BmN cells.

[0009] Beneficial effects: The present invention first discovered that total RNA extracted from BmN cells was reverse transcribed to obtain cDNA, and the spz gene synthesized using cDNA as a template and the pIZ / V5 vector were used to construct a transient expression recombinant plasmid and transfect BmN cells, which can significantly increase the secretion rate of exogenous protein after 72 hours. The method is simple to operate, low in cost, easy to promote, and can significantly improve the secretion efficiency of exogenous proteins expressed in silkworm cells. The present invention can effectively improve the secretion efficiency of exogenous proteins expressed in silkworm cells, provide a new research direction and idea for improving the secretion rate of exogenous proteins expressed in silkworm cells, and provide a reference for the study of the mechanism of signal peptides involved in protein secretion. The method provided by the present invention is simple and clear, easy to understand, simple to operate, and efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 After using pIZ / V5-SP-Luc and pIZ / V5-Luc to transfect BmN cells to screen stable cell lines, the recombinant plasmid pIZ / V5-spz was transferred into BmN cells, and the pIZ / V5 empty vector was used as a control. The total expression level of luciferase was measured after 72 hours.

[0011] Figure 2 After using pIZ / V5-SP-Luc and pIZ / V5-Luc to transfect BmN cells to screen stable cell lines, the recombinant plasmid pIZ / V5-spz was transferred into BmN cells, and pIZ / V5 empty vector was used as a control. The supernatant secretion amount was measured after 72 hours.

[0012] Figure 3 It is the secretion rate calculated using the supernatant secretion amount and the total expression amount after 72 hours. DETAILED DESCRIPTION

[0013] Liu Na et al. (18Additional Amino Acids of the Signal Peptide ofthe Bombyx mori Nucleopolyhedrovirus GP64 Activates Immunoglobulin Binding Protein (BiP) Expression by RNA seq Analysis [J]. Current Microbiology, 2020. doi: 10.1007 / s00284-020-02309-4.) transfected siRNA targeting BiP in BmN cells, and used the randomly disrupted siRNA sequence (NC) as a control. After 24 hours, the RNA was extracted and reverse transcribed, and the interference efficiency of BiP was detected by qPCR technology. The results showed that siRNA significantly reduced the expression level of BiP in the host cells. After determining that BiP in the host cells was effectively interfered, pIZ / V5-SP-Luc was transfected, and the empty vector pIZ / V5-Luc was used as the control group. After 72 hours, the supernatant and cell samples were collected respectively, and the samples were fully lysed with cell lysis buffer to detect their luciferase activity. The results showed that the protein secretion rate increased significantly after BiP interference compared with the control group.

[0014] Example 1

[0015] 1. Cell lines and plasmids

[0016] BmN cells were maintained by the Key Laboratory of Silkworm Genetic Improvement, Ministry of Agriculture and Rural Affairs, and cultured at 27°C in TC-100 medium containing 10% fetal bovine serum (Thermo Fisher Scientific).

[0017] In order to facilitate the statistics of the secretion rate described in the present invention, the luciferase reporter gene was fused with the signal peptide (SP) of Bombyx mori nuclear polyhedrovirus GP64 to construct the recombinant plasmid pIZ / V5-SP-Luc, and pIZ / V5-Luc was used as the control (the construction process is shown in the reference: Na Liu, Jinshan Huang, Lin Liu, Frank Boadi, et al., 2021, 18Additional Amino Acids of the Signal Peptide of the Bombyx moriNucleopolyhedrovirus GP64 Activates ImmunoglobμLin Binding Protein(BiP)Expression by RNA-seq Analysis. Current Microbiology. 78:490–501.). After transfection of BmN cells, the clonal cell lines stably expressing SP-Luc and Luc were screened.

[0018] 2. Construction of transient expression vector carrying Spz gene

[0019] 1) Collect BmN cells in the logarithmic growth phase and extract total cellular RNA. The specific operation is as follows:

[0020] ① Remove the culture medium, add 2 mL PBS to wash, centrifuge at 4000 rpm for 10 min, discard the supernatant, and add 1 mL TRIZOL to suspend it;

[0021] ② Add 200 μL of chloroform and shake vigorously manually until it turns milky pink, let it stand on ice for 2 to 3 minutes, and centrifuge at 12,000 rpm and 4°C for 15 minutes;

[0022] ③ Aspirate the supernatant, add an equal volume of isopropanol, mix well (gently invert up and down to mix well), incubate on ice for 10 minutes, centrifuge at 12000 rpm, 4℃ for 15 minutes, and discard the supernatant;

[0023] ④Add 2 volumes of 75% ethanol-DEPC, mix well, centrifuge at 7500 rpm for 5 min, and discard the supernatant;

[0024] ⑤ Repeat step (4) once;

[0025] ⑥ Dry at room temperature on a clean bench for 5 minutes

[0026] ⑦ Add 20-50 μL RNaes-free ddH2O, measure the concentration, and run the gel to check whether the extraction is correct (take 5 μL, 180V, 7min).

[0027] 2) Reverse transcription to synthesize cDNA, the specific operation is as follows:

[0028] ① Removal of genomic DNA

[0029] Prepare the following system in an RNase-free centrifuge tube:

[0030]

[0031] Mix by gently pipetting and incubate at 42°C for 2 min.

[0032] ②Prepare the reverse transcription reaction system

[0033] Leave 16 μL of reaction solution in the reaction tube ①, add 4 μL of 5×HisriptⅢqRT super Mix, and mix by pipetting.

[0034] ③Reverse transcription reaction

[0035] Incubate at 37℃ for 15min, then transfer to 85℃ for 5s. Store at -20℃ for subsequent PCR reaction.

[0036] 3) PCR amplification of spz gene and cloning of the amplified gene into pIZ / V5-His vector and restriction enzyme digestion identification

[0037] Design a pair of primers with the following sequences:

[0038] F:CGC GAATTC ATGTCACTTATACTAAGAGCTTT

[0039] Protective base EcoRⅠ Tm: 60℃; GC content: 30%

[0040] R:GCG TCTAGA CTAAGTATGGTTTGATTCGATG

[0041] Protective base XbaⅠ Tm: 60℃; GC content: 36%

[0042] The cDNA synthesized by reverse transcription was used as a template to amplify the Spz gene by PCR, and the amplified gene was cloned into the pIZ / V5-His vector and used after enzyme digestion and identification.

[0043] PCR amplification of spz gene: The reaction conditions of the PCR instrument are set as follows: 98℃-5min, 98℃-10s, 55℃-15s, 72℃-10s, 72℃-7min; 35 cycles. The system is as follows:

[0044]

[0045] PCR product identification: prepare gel, take 50μL product and add 5μL 10×locating buffer, mix well and spot all samples, add 5μL DL2000 maker, 120V, run gel for 20min, and recover gel if the identification is correct.

[0046] PCR product gel recovery:

[0047] ①Put the gel block containing the target fragment cut from the agarose gel into an EP tube;

[0048] ② Add 500 μL Buffer B2 and incubate in a 50°C water bath for 5 to 10 minutes to dissolve;

[0049] ③ Transfer the sol solution into the adsorption column, centrifuge at 8000xg for 1 min, and discard the liquid in the collection tube;

[0050] ④Add 500μL Wash Solution, centrifuge at 9000xg for 1min, pour out the liquid in the collection tube, and repeat once

[0051] ⑤ Centrifuge the empty adsorption column at 9000xg for 1 min;

[0052] ⑥ Place the adsorption column in a new 1.5mL centrifuge tube, let it stand for 5 minutes, add 30μL Eliution Buffer to the center of the adsorption membrane, let it stand for 1 minute at room temperature, centrifuge for 1 minute, and save the DNA solution in the tube. The measured concentration is 98.7ng / μL (OD260 / 280=1.86).

[0053] Restriction digestion and ligation of Spz and pIZ / V5:

[0054] spz enzyme digestion system

[0055]

[0056] pIZ / V5 restriction enzyme system

[0057]

[0058] The conditions for SPZ digestion were 37°C water bath for 15 min, and the digestion products were directly recovered (see the instructions of the PCR product recovery kit for details). The concentration after recovery was measured to be 20.6 ng / μL.

[0059] The pIZ / V5 plasmid digestion conditions were 37°C water bath for 15 minutes, gel running identification and recovery (130V, 15 minutes, DL15000 maker), and the concentration after recovery was 7.3ng / μL. After recovery, ligation was performed at 25°C for 10 minutes. The ligation system was as follows:

[0060]

[0061] (Note: The ratio of spz to the amount of carrier substance (n) should be 4:1)

[0062] Transformation of ligation products:

[0063] ① Add 50-100 μL of competent cells to the ligation product (pre-cooled) and place on ice for 30 minutes;

[0064] ② Heat shock in a 42℃ water bath for 90s, then immediately place on ice for 2min;

[0065] ③ Add 800 μL LB medium and shake to recover for 1 hour;

[0066] ④ Centrifuge the revived bacteria at 7000 rpm for 2 min;

[0067] ⑤ Discard the supernatant until it reaches 100 μL, then aspirate and suspend, and apply to a plate containing solid LB medium (containing zeocin antibiotics);

[0068] ⑥ Place in a 37℃ incubator for culture.

[0069] Plasmid extraction: Pick a single colony into 4 mL LB liquid medium, add 0.8 μL zeocin, and shake overnight.

[0070] ① Take 1.5 mL of overnight culture solution, centrifuge at 8000×g for 2 min, collect the bacteria, and discard the culture medium;

[0071] ② Add 250 μL Buffer P1 to the precipitate to thoroughly suspend the bacteria;

[0072] ③ Add 250 μL Buffer P2, immediately gently invert the centrifuge tube 5 to 10 times to mix, and let stand at room temperature for 2 to 4 minutes;

[0073] ④ Add 350 μL Buffer P3 and immediately gently invert the tube 5 to 10 times to mix;

[0074] ⑤ Centrifuge at 12000×g for 10 min, transfer the supernatant into the adsorption column, centrifuge at 8000×g for 1 min, and discard the liquid in the collection tube;

[0075] ⑥ Add 500 μL Wash Solution, centrifuge at 9000×g for 1 min, and discard the liquid in the collection tube;

[0076] ⑦Repeat step ⑥ once;

[0077] ⑧ Centrifuge the empty adsorption column at 9000×g for 1 min;

[0078] ⑨ Place the adsorption column in a clean 1.5mL centrifuge tube and let it stand for 5 minutes. Add 50μL Eliution Buffer to the center of the adsorption membrane and let the DNA solution stand at room temperature.

[0079] Enzyme digestion identification: 37℃ for 15min, the enzyme digestion system is as follows:

[0080]

[0081] After the enzyme digestion is completed, run the gel for identification, take 5μL sample, and use DL5000 maker as a reference (5μL), 130V, 15min.

[0082] 3. Screening of BmN clone cell lines stably expressing SP-Luc and Luc

[0083] Refer to Invitrogen TM pIZ / V5-His vector kit (Thermofisher.cn), see the instructions for details, the steps are as follows:

[0084] ① BmN cells were maintained by the Key Laboratory of Silkworm Genetic Improvement of the Ministry of Agriculture and Rural Affairs and cultured at 27°C in TC-100 medium containing 10% fetal bovine serum (Thermo Fisher Scientific).

[0085] ② The luciferase reporter gene was fused with the signal peptide (SP) to construct the recombinant plasmid pIZ / V5-SP-Luc, with pIZ / V5-Luc as the control;

[0086] ③ Transfect the recombinant plasmids into BmN cells respectively;

[0087] ④ 48h after transfection, remove the transfection solution and replace with fresh culture medium (without Zeocin TM );

[0088] ⑤ Split the cells 1:5 and allow the cells to attach for 15 min, then use an appropriate concentration of Zeocin TM Medium replacement: cells were cultured at 27°C and the selective medium was replaced every 3-4 days for 60 days;

[0089] ⑥Isolate stable expressing clonal cell lines and measure the expression of luciferase.

[0090] 4. pIZ / V5-spz transfected two BmN cell lines respectively

[0091] 2 μg of recombinant plasmid pIZ / V5-spz was used to transfect two BmN clone cell lines respectively, and 2 μg of pIZ / V5 empty vector was used as control. After 72 hours, the transfected cells and cell culture medium were collected to measure the luciferase activity.

[0092] The transfection procedure is as follows:

[0093] ① Plant the cells in a 24-well plate one day in advance, so that the cell density is about 60% during transfection;

[0094] ② Dilute 2 μg of pIZ / V5-spz with 25 μL of serum-free medium and mix thoroughly to prepare DNA dilution solution;

[0095] ③ Add 2 μL of Entranster TM -H4000 was diluted with 25 μL serum-free diluent and mixed thoroughly to make Entranster TM -H4000 dilution and let stand at room temperature for 5 min.

[0096] ④Entranster TM -H4000 dilution was added to the pIZ / V5-spz dilution, mixed thoroughly (pumped 20 times with the pipette), and allowed to stand at room temperature for 15 minutes. The transfection complex was prepared.

[0097] ⑤ Add 50 μL of transfection complex to the culture container containing cells and complete culture medium and mix gently.

[0098] ⑥After 4 hours of culture, the culture medium was replaced and cultured routinely for 72 hours, and the relative activity of luciferase was determined.

[0099] 5. Effects of pIZ / V5-spz transfection on the expression and secretion rate of exogenous proteins in BmN cells

[0100] The collected cells and culture medium samples were assayed for luciferase activity according to the following method:

[0101] (1) Dilute 5× cell lysis buffer with PBS to 1× cell lysis buffer;

[0102] (2) Pipette the culture medium in the 24-well plate of the above experiment into a new EP tube with the corresponding number;

[0103] (3) Add 120 μL of 1× cell lysis buffer to each well of the 24-well plate and incubate in an incubator with shaking for 15 min;

[0104] (4) Use a pipette to transfer the cell lysate in the well into another new EP tube with the corresponding number;

[0105] (5) Centrifuge all sample EP tubes containing culture medium and cell lysate at 12,000 × g for 2 min. Take 4 μL from each EP tube and put it into a new corresponding EP tube and continue centrifugation at 12,000 for 2 min.

[0106] (6) The instrument detects and records the data, counts the total expression amount of luciferase, the amount secreted into the culture medium, and calculates the secretion rate.

[0107] The statistical analysis results are:

[0108] The statistical results of total expression, secretion into the culture medium and secretion rate are shown below. Figure 1-3 ;

[0109] Stable cell lines stably expressing SP-Luc and Luc were screened, and then 2 μg of recombinant plasmid pIZ / V5-spz was transferred into BmN cells, and pIZ / V5 empty load was used as control. After 72 hours, cells and supernatants were collected, luciferase activity was measured, and secretion rate was calculated. The results showed that in BmN expressing secretory protein (SP-Luc), after transfection with pIZ / V5-spz and culture for 72 hours, the secretion of SP-Luc supernatant increased significantly compared with the pIZ / V5 empty load control group ( Figure 2 ). The experimental results showed that the secretion rate increased by 12.7% ( Figure 3 ).

[0110] Finally, it should be said that the amount, method of use and treatment time of spz described in the above examples and implementation methods are for illustrative purposes only and are not limiting. However, a person skilled in the art should understand that slight differences in cell status or physical and chemical properties of cell culture medium, such as pH, temperature, etc., can lead to various changes in form and details, or in a similar manner, such as constructing a stable cell line overexpressing the spz gene, or using vectors such as baculovirus to carry the spz gene, the effects described in the patent can also be achieved without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. SEQ ID NO.1 license plate Application of the gene in improving the secretion rate of foreign proteins expressed in silkworm BmN cells with the participation of the signal peptide of Bombyx mori nuclear polyhedrosis virus GP64.

2. Stable expression of SEQ ID NO.1 license plate Application of baculovirus vector carrying a gene in improving the secretion rate of foreign protein expressed with the participation of the signal peptide of Bombyx mori nuclear polyhedrosis virus GP64 in Bombyx mori BmN cells.

Images