Cross - cooperative self - assembly

Abstract

The present disclosure provides, in some embodiments, methods, compositions, and kits for controlling the nucleation and assembly of molecular nanostructures, microstructures, and macrostructures.

Description

[0001] This application is a divisional application, and the application number of its corresponding parent application is 201780060902.6, the filing date is August 2, 2017, and the invention title is "Cross-Cooperative Self-Assemblies". Technical Field

[0002] This application claims the benefit of U.S. Provisional Application No. 62 / 370,098, filed on August 2, 2016, under 35 U.S.C.§119(e), the entire content of which is incorporated herein by reference.

[0003] Federally Sponsored Research

[0004] This invention was made with government support under Grant No. 1435964 awarded by the Naval Research Laboratory. The government has certain rights in this invention. Background Art

[0005] In fact, biomolecules assemble into hierarchical structures through intermolecular interactions. In synthetic biology, it is possible to rationally utilize hierarchical structures to design biosynthetic building blocks, which originate from inherent functionality and control intermolecular interactions at the molecular level. Such biosynthetic self-assembled structures have useful applications, for example, in the field of nanotechnology. Summary of the Invention

[0006] In some embodiments, provided herein are techniques (including, for example, methods, compositions, and kits) for controlling the nucleation and hierarchical assembly (programmable self-assembly) of molecular structures such as nucleic acids (e.g., DNA) and / or protein nanostructures, microstructures, and macrostructures. This technique is referred to herein as "cross-cooperative assembly", which can be used to program and rapidly assemble structures solely from the provided macromolecular "seeds", and thus can be considered a "0-background" assembly method. By designing cooperative binding sites on individual biomolecular subunits (which require simultaneous engagement with a large number of other subunits to achieve stable attachment), the system imposes an inherent high energy barrier to the spontaneous nucleation of structures, even in the presence of high concentrations of each individual component. Nucleation can be triggered only by providing macromolecular "seeds" that resemble pre-existing structural interfaces (presenting multiple weak binding sites for stably capturing the next subunit). Adding seeds that can stably capture individual subunits effectively bypasses the activation energy barrier against spontaneous nucleation, thereby driving the higher-order assembly of microscale structures. Multiple components can be continuously added to the structure, such that their growth in one, two, or three dimensions can potentially be as large as that for other polymerization or crystallization processes.

[0007] As provided herein, cross-cocatalytic assembly uses molecular (e.g., nucleic acid or protein) building blocks ( Figure 1A ), which are programmed to self-assemble into cross-layers ( Figure 1B ). In some embodiments, the building blocks can be rod-like structures assembled from programmable nucleic acid hybridization interactions. As shown above, this cross-cocatalytic assembly technique uses a "seed" structure, and programmable nucleic acid self-assembly starts from the "seed" structure. This seed structure is formed by an irreversible interaction between a nucleation structure ( Figure 1A ; "queen bee") and a subset of the building blocks ( Figure 1A ; "drone bees"), and the subset of the building blocks are arranged in rows to form an initial seed layer along the nucleation structure. In the presence of the seed structure, another set of building blocks ( Figure 1B ) is added to the existing seed layer ( Figure 1A ; 'worker bees'). The binding between a sufficient number of building blocks (drone bees) and the nucleation structure (queen bee) to form a seed can trigger the addition of many additional layers of building blocks (worker bees), and each layer is rotated by a certain degree (e.g., 90°) relative to the adjacent (above and / or below) layer.

[0008] The nucleation structure and the building blocks are configured to interact (e.g., bind) with each other based on a set of kinetic / nucleation energy parameters as follows. The initial subset of the building blocks (drone bees) should bind strongly (irreversibly / stably) and form an oriented layer along the nucleation structure (queen bee). The initial subset of the building blocks (drone bees) should not interact (bind) with each other. Similarly, the subsequent subsets of the building blocks (worker bees) should not interact (bind) with each other. In addition, in the absence of the nucleation structure (queen bee), any building block (drone bee) from the initial subset should have only a weak (reversible) interaction with a building block (worker bee) from another subset. In the presence of the nucleation structure (queen bee), a single building block (drone bee) from the initial subset can interact with more than one building block (worker bee) from the subsequent subset, and a single building block (worker bee) from the subsequent subset can interact with more than one building block (drone bee) from the initial subset or more than one building block (worker bees of another subset) from another subset. For example, referring to Figure 1B , a single building block (e.g., a DNA nanorod) can bind to 8 other building blocks (e.g., DNA nanorods), although the single building block binds to each of the 8 building blocks only once to form two layers with a "cross" pattern.

[0009] The single interaction between the building blocks (drones) from the initial subgroup and the building blocks (worker bees) from subsequent subgroups should be weak enough such that in the absence of a seed structure (where a large number of individual worker bees would have to come together simultaneously), there is an arbitrarily large entropy penalty for nucleation. Using these parameters, zero background and minimal defects can be achieved, even at high concentrations of interacting building blocks, enabling rapid nucleation and assembly of nucleic acid nanostructures.

[0010] Accordingly, the present disclosure provides compositions comprising: (a) a nucleated nucleic acid nanostructure; (b) a first layer of parallel elongated nucleic acid nanostructures that stably bind to the nucleated nanostructure of (a); and (c) a second layer of parallel elongated nucleic acid nanostructures that stably bind to the elongated nanostructures of (b) and are rotationally angled relative to the parallel elongated nanostructures of (b), wherein individual elongated nanostructures of (b) bind to multiple elongated nanostructures of (c) each via a single cooperative binding site. In some embodiments, individual elongated nanostructures of (c) bind to multiple elongated nanostructures of (b) each via a single cooperative binding site.

[0011] The present disclosure also provides in some aspects compositions comprising: (a) a nucleated nanostructure; (b) a first subgroup of elongated nanostructures, wherein less than 10% of the nanostructures of (b) bind to each other, and wherein the nanostructures of (b) reversibly bind to the nucleated nanostructure of (a); and (c) a second subgroup of elongated nanostructures, wherein less than 10% of the nanostructures of (c) bind to each other, wherein in the absence of the nucleated nanostructure, the nanostructures of (b) can reversibly bind to the nanostructure of (a) only at a single location on the nanostructure of (a), and wherein, in the absence of the nucleated nanostructure, the nanostructure of (a) can reversibly bind to the nanostructures of (b) only at a single location on the nanostructures of (b). See, e.g., Figure 1A - 1B .

[0012] In some embodiments, the present disclosure also provides cross nucleic acid nanostructures, which include: a first nanorod including a first plug strand and a second plug strand; a second nanorod including a third plug strand and a fourth plug strand, wherein the second nanorod is parallel to the first nanorod; a third nanorod including a fifth plug strand complementary to and binding to the first plug strand and a sixth plug strand complementary to and binding to the second plug strand; a fourth nanorod including a seventh plug strand complementary to and binding to the third plug strand and an eighth plug strand complementary to and binding to the fourth plug strand, wherein the third nanorod is parallel to the fourth nanorod. See, for example, Figure 18 The cross nanostructure is not limited to 4 nanorods, and in many embodiments, includes at least 4 (e.g., at least 5, 10, 15, 20, 25, 50, 100 or more) nanorods configured in a cross pattern as described herein.

[0013] Thus, in some embodiments, the cross nucleic acid nanostructure includes a first plurality of nanorods parallel to each other and a second plurality of nanorods parallel to each other, wherein the first plurality of nanorods bind to and are perpendicular (or non-parallel) to the second plurality of nanorods. See, for example, Figure 18 .

[0014] In some embodiments, each nanorod is composed of DNA. For example, the nanorod can be composed of a 6-helix DNA bundle (see, for example, Douglas SM1, Chou JJ, Shih WM. DNA-nanotube-induced alignment of membrane proteins for NMR structure determination (DNA- nanotube induced alignment of membrane proteins for NMR structure determination). Proc Natl Acad Sci U S A. 104, 6644–6648, 2007, incorporated herein by reference).

[0015] In some aspects, the present disclosure also provides cross nucleic acid slats, which include: a first plurality of at least four nucleic acid strands parallel to each other, each strand of the first plurality having a length of 20-100 nucleotides (e.g., 20-30, 20-40 or 20-50 nucleotides); and a second plurality of at least four nucleic acid strands parallel to each other, each strand of the second plurality having a length of 20-100 nucleotides (e.g., 20-30, 20-40 or 20-50 nucleotides), wherein the at least four nucleic acid strands of the first plurality bind to and are perpendicular to the at least four nucleic acid strands of the second plurality. See, for example, Figure 21A - 21B .

[0016] In some aspects, the present disclosure also provides cross nucleic acid lattices, which include: a first plurality of at least four nucleic acid strands parallel to each other, each strand of the first plurality having a length of at least 21 nucleotides; and a second plurality of at least four nucleic acid strands parallel to each other, each strand of the second plurality having a length of at least 21 nucleotides, wherein the at least four nucleic acid strands of the first plurality bind to and are perpendicular to the at least four nucleic acid strands of the second plurality. See, for example, Figure 21A - 21B .

[0017] In some aspects, the present disclosure further provides nucleic acid nanostructures, which include nucleic acid scaffold strands (e.g., M13 or M13-derived) folded into a repetitive circular shape (e.g., 5-15 rings, or 5, 6, 7, 8, 9, or 10 rings) fixed by shorter nucleic acid staple strands, wherein the repetitive loop structure binds to at least one (e.g., at least 2, 3, 4, 5, 10, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more) cross nucleic acid lattices. See, for example, Figure 22 , 24A, 25, and 27B.

[0018] In some aspects, the present disclosure further provides nucleic acid nanostructures, which include nucleic acid scaffold strands folded into a repetitive circular shape fixed by at least two cross nucleic acid lattices. See, for example, Figure 27B and 28B .

[0019] The present disclosure also provides, in some aspects, a method for preparing cross nucleic acid nanostructures, which includes: mixing in a reaction mixture (a) a first nanorod, which includes a first plug strand and a second plug strand, (b) a second nanorod, which includes a third plug strand and a fourth plug strand, wherein the second nanorod is parallel to the first nanorod; (c) a third nanorod, which includes a fifth plug strand complementary to and binding to the first plug strand and a sixth plug strand complementary to and binding to the second plug strand; and (d) a fourth nanorod, which includes a seventh plug strand complementary to and binding to the third plug strand and an eighth plug strand complementary to and binding to the fourth plug strand, wherein the third nanorod is parallel to the fourth nanorod; and incubating the reaction mixture under conditions (e.g., nucleic acid hybridization conditions) that produce an assembly of cross nucleic acid nanostructures. See, for example, Figure 22 .

[0020] In some aspects, the present disclosure also provides methods for detecting biomolecules (analytes). In some embodiments, a method includes (a) mixing in a reaction mixture: (i) a sample comprising a biomolecule; (ii) nucleic acid strands capable of self-assembling into nanostructures comprising vertically stacked parallel strands; (iii) a plurality of oligonucleotides shorter than the nucleic acid strands of (ii), wherein the oligonucleotides of (iii) bind to the strands of (ii) to assemble the vertically stacked parallel strands; (iv) two cross-linked nucleic acid slats, wherein the two slats bind to the strands of (ii), and wherein each slat is linked to a biomolecule binding partner that specifically binds the biomolecule in the sample; (b) incubating the reaction mixture under conditions that permit binding of the biomolecule binding partner to the biomolecule and assembly of the nanostructures into vertically stacked parallel strands; (c) removing the plurality of oligonucleotides of (iii) from the reaction mixture of (b); (d) incubating the reaction mixture of (c) in the presence of a plurality of the cross-linked nucleic acid slats, wherein the cross-linked nucleic acid slats bind to the vertically stacked parallel strands to form a three-dimensional cylindrical structure. In some embodiments, the method further includes imaging the three-dimensional cylindrical structure. See, for example, Figure 28A - 28B 。

[0021] In some embodiments, the method may include mixing in a reaction mixture (e.g., using a hybridization buffer): (a) a sample comprising a biomolecule and (b) a nucleic acid nanostructure comprising: (i) a nucleic acid scaffold strand capable of folding into a repetitive looped shape (e.g., 2-15 vertically stacked loops) and (ii) two cross-linked nucleic acid slats, wherein a biomolecule binding partner (e.g., an antibody) that specifically binds the biomolecule is linked to each of the cross-linked nucleic acid slats such that in the presence of the relevant biomolecule, the biomolecule binding partner binds to the biomolecule and the nucleic acid nanostructure folds into a repetitive looped shape. See, for example, Figure 28A - 28B 。

[0022] In some embodiments, the method further includes mixing the reaction mixture with a plurality (e.g., 2-50 or 2-100) of cross-linked nucleic acid slats to form a three-dimensional cylindrical-like structure. See, for example, Figure 24B 。

[0023] It should be understood that the nucleic acid nanostructures (e.g., nanorods, slats, cylinders, etc.) and variants thereof as described herein, as provided herein, can be designed, for example, using the following publicly available tools, as described by Douglas SM, Marblestone AH, Teerapittayanon S, Vazquez A, Church GM, Shih WM. Rapid prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, 5001–5006, 2009 (incorporated herein by reference). See also, Douglas et al., Nature, 459(7245):414-418, 2009, which is incorporated herein by reference. For example, and as described elsewhere herein, it is known in the art that hundreds of oligonucleotide "staple" strands can be assembled into a cross-linked helical planar antiparallel array using a long "scaffold" strand as a template to generate custom-shaped (e.g., megadalton-scale) DNA nanostructures. This "scaffold DNA origami" method has also been adapted to generate 3D shapes formed as folded layers of double helices constrained into a honeycomb lattice. caDNAno, an open-source software package with a graphical user interface, can be used to assist in designing DNA sequences for folding 3D DNA (or other nucleic acid) nanostructures. caDNAno software and video tutorial materials demonstrating its construction are available from cadnano.org. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1A - 1B An abstract form showing an example of a cross-coassembly system is shown. Figure 1A A system showing no nucleation site and no self-assembly is shown. Figure 1B A system and triggered spontaneous self-assembly after addition of a nucleation site are shown. The growth direction is indicated by the gray arrow, and one-dimensional (1D) growth is shown in this example. The individual components are referred to as "queen", "drone", and "worker".

[0025] Figure 2 A diagram showing the principle by which the nucleation site (queen) structure initiates a higher-order structure with drones and workers by lowering the activation energy of the assembly is shown.

[0026] Figure 3A - 3C An example of a DNA-origami cross-assembly is shown. Figure 3AShows the queen bee (Q) and drone / worker bee (D / W) architecture, which is shown in cross-section (caDNAno software downloaded from cadnano.org) and in a 3D graphical representation. Each single cylinder represents a double-stranded DNA helix. Figure 3B Is a graphical representation of the 1D and 2D growth of DNA-origami co-assemblies. 3D growth can be achieved by establishing designs that combine 1D and 2D growth. Figure 3C Shows different paths for 2D growth.

[0027] Figure 4 Shows an example of a single-stranded DNA crossover co-assembly. The oligonucleotides of the worker bees and drones that include the system (shown as cylinders) are nucleated by adding a cubic DNA-origami queen bee structure with a nucleation site. The step-by-step assembly is shown in the magnified portion of the illustration.

[0028] Figure 5 Shows an example of a catenane crossover co-assembly queen bee (catenane queen bee) that can be used for ultrasensitive detection. The oligonucleotides of the worker bees and drones that include the system (shown as cylinders) are nucleated by adding a single-stranded catenane queen bee structure with a nucleation site. The binding sites on the structure shown on the left side of the magnified portion of the illustration indicate the nucleation of the worker bees / drones. Each main loop has multiple binding sites that act together as cooperative binding sites.

[0029] Figure 6 Shows the catenane queen bee from Figure 5 that has been modified to act as a biosensor. The large DNA loop has been separated to incorporate biomolecule capture sites to bind biomolecules (e.g., macromolecules) in a biological sample. In some embodiments, the presence of a biomolecule can be detected in a mixture as follows: (1) The biological sample is mixed with a high concentration of catenane queen bees, and the biomolecule of interest binds to the biomolecule capture site. (2) A chemical reaction is used to reversibly cleave the biomolecule capture site. (3) The catenane queen bees that do not bind to the target biomolecule decompose faster than those catenane queen bees that are clustered together by the target biomolecule. (4) The remaining catenane queen bees in the test mixture reconnect together at the biomolecule capture site. (5) Worker bees and drones are added to the test mixture to amplify the remaining queen bees using a micron-scale DNA structure that can be easily observed. This system is modular because the biomolecule capture site can be customized to bind disease markers, including protein or nucleic acid sequences.

[0030] Figure 7 Shows a CAD schematic of an example of the base-pairing connection between a 6-helix bundle worker bee and a 6-helix drone and the queen bee. A plug-and-socket connection design can also be used, as Figure 18 - 20As shown. The following CAD tools were used to design the structure: Douglas SM, Marblestone AH, Teerapittayanon S, Vazquez A, Church GM, Shih WM. Rapid prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, 5001–5006, 2009.

[0031] Figure 8A - 8D is a schematic diagram depicting different exemplary "seed" designs (6-helix bundle nanorods combined with nucleating nanostructures), and these "seed" designs have different cooperative binding site configurations. Additional exemplary "seed" designs are shown in Figure 16A - 16C as follows.

[0032] Figure 9A - 9B Shows the results obtained from a seesaw experiment using examples of nucleating nanostructures (queen bee) folded at different temperatures (A: 65 - 60 °C; B: 60 - 55 °C; C: 65 - 55 °C; D: 60 - 50 °C) at a MgCl2 concentration of 6 mM.

[0033] Figure 10A - 10B Results obtained from a seesaw experiment using examples of nanostructures (drone bee) folded at different temperatures (A: 70 - 60 °C; B: 65 - 55 °C; C: 65 - 60 °C; D: 60 - 55 °C) at a MgCl2 concentration of 6 mM.

[0034] Figure 11 Shows a schematic diagram depicting an assembly of an exemplary seed structure (queen bee + drone bee). An image of this structure is also shown. The nanostructure assembly can also be carried out as Figure 19A - 19D shown below.

[0035] Figure 12A - 12G Shows a seed structure formed by an assembly of single-stranded DNA and another nanostructure (drone bee).

[0036] Figure 13A - 13B Shows the results obtained from a seesaw experiment using a single-stranded nucleating nanostructure (queen bee) at different temperatures and gradients.

[0037] Figure 14A - 14C Shows the results demonstrating the assembly of nanostructures (worker bee) in the presence of a nucleating nanostructure (queen bee) rather than in the absence of a nucleating nanostructure.

[0038] Figure 15A - 15B Results are shown for nanostructure examples that do not assemble in the absence of a nucleating nanostructure (queen bee).

[0039] Figure 16A A two-dimensional view of a lattice queen bee is shown that can simultaneously bind 16 drones across a horizontal plane of the queen bee (at coordinates χ in Figure 16B ). The staples required to fold the scaffold into the queen bee are shown, and single-stranded sequences that protrude can be added to the 3’ ends of the staples to bind drones. A three-dimensional view ( Figure 16B ) shows the queen bee with binding sites in each drone-docking lattice. A transmission electron microscopy (TEM) image of the queen bee is shown in Figure 16C . The lateral dimensions of the structure are approximately 72 nm x 240 nm.

[0040] Figure 17A - 17B Drones and worker bee subassemblies are depicted. Figure 17A Drones and worker bee subassemblies are shown that are constructed from 6-helix bundle scaffold DNA origami to form rods of customizable length. The 3’ ends of the staples contain protruding single-stranded DNA sequences that act as plug-binding handles to interact with other components. Similarly, the bottom helix contains socket sequences (i.e., single-stranded DNA scaffolds not complementary to the folded staples) that accept plug sequences from other components. The plugs and sockets are each periodic and can be positioned, for example, every 42 bp (~14 nm) along the length of the component. Figure 17B TEM images of test drones folded from two different scaffold sequences are shown. The drone in the upper image is ~250 nm in length, while the drone in the lower image is ~440 nm in length by comparison.

[0041] Figure 18 A detailed view of the plug-socket binding system is shown. The example shown in the upper panel shows a full set of 5 single-stranded plug sequences extending from a queen bee (small arrow) with matching plug sites in a 6-helix bundle drone. In the lower panel, the binding sequences are drawn as a series of “X”s to indicate that both the length and sequence of the plugs and sockets can vary. The scaffold sequences are drawn in black. Note that this design (shown for drone-queen bee assembly) can also be used to bind drones to worker bees. The lattice queen bee sequences correspond to SEQ ID NO:685 and SEQ ID NO:686 from top to bottom. The 6-helix bundle (hb) drone sequences correspond to SEQ ID NO:687 and SEQ ID NO:688 from left to right.

[0042] Figure 19A - 19D Shows how the plug-socket binding system can be used to program drones to bind to desired sites on a queen bee.Figure 19A Shows two 440nm drones placed in the two middle queen cells, Figure 19B Shows one 250nm drone placed in the middle queen cell, Figure 19C Shows 250nm drones in each cell of the queen. The required design is shown on the left, and the TEM image of the assembled structure is shown on the right. Figure 19D Shows the total analysis using agarose gel electrophoresis of the designs from Figure 19A One design uses 7bp plug - socket, and the other has 10bp plug - socket.

[0043] Figure 20 Shows the change over time of the remaining degree of free queen when the queen binds to a single 440nm drone.

[0044] Figure 21A - 21B Shows an example of an architecture based on cross - DNA slats. Figure 21A Is the abstract form of the cross - DNA slat motif (right). The light and dark strands are intertwined and complementary to each other at each junction. The length of each binding site is shown on the right. Each row and column totals 21 base pairs (bp). The matrix shows the number of base pairs (bp) of each binding site at each position in the abstract form and 3D rendering. Figure 21B Is the 3D rendering of the DNA slat. On the left, the top - down view shows the intertwining of each strand. The cross - section (A - A) is shown on the right.

[0045] Figure 22 Shows the steps of DNA slat assembly. Step 1 shows the DNA - origami folding of an arbitrary DNA - origami queen (showing a cylindrical queen as an example). Step 2 is the mixing of the crude DNA - origami queen reactant (from Step 1) with the DNA slats at various salt concentrations, temperatures, and DNA slat concentrations.

[0046] Figure 23A Shows a flat DNA - origami queen without adding any DNA slats. Figure 23B Shows a flat DNA - origami queen with added DNA slats and the correct formation of the lamella by covering the ssDNA scaffold of the queen with DNA slats. The DNA slat coverage area is indicated in light gray. The scale bar on the image is 600nm, and on the enlarged view is 100nm.

[0047] Figure 24A Shows a cylindrical DNA - origami queen without adding any DNA slats. The scale bar on the image is 400nm, and on the enlarged view is 100nm. Figure 24BShows the ssDNA scaffold of the queen bee covered with DNA slats, the cylindrical DNA-origami queen bee with added DNA slats, and the correct formation of the cylinder. The scale bar is 50 nm. The DNA slat-covered area is indicated in light gray.

[0048] Figure 25 Depicts the growth mechanism of DNA slats inoculated on the queen bee structure. The DNA-origami queen bee is mixed with DNA slats to cover the ssDNA scaffold of the queen bee, and then the latter extends and polymerizes only through the growth of the micron-scale structure of the DNA slats (in the same plane, the DNA slats can be end-to-end connected by nucleobase pairing of adjacent slats). The design above shows a flat DNA-origami queen bee where three linear lamellae grow in the horizontal direction. The design below shows a cylindrical DNA-origami queen bee where tubular growth occurs in the vertical direction.

[0049] Figure 26A - 26E Shows three extensions of the first-generation DNA slats combined with the flat DNA-origami queen bee. Figure 26A Shows the first-generation extensions covered with short second-generation DNA slats, producing three dentate extensions on the queen bee. Figure 26B Shows the first-generation extensions covered with long second-generation DNA slats, with their tails covered with short third-generation DNA slats. Figure 26C - 26E Shows the first-generation, second-generation, and third-generation DNA slats, which are complementary to each other, producing extensions of the linear lamellar structure. Figure 26C Contains one extended first generation, Figure 26D Contains two extended first generations, Figure 26E Contains three extended first generations. Figure 26A - 26C The scale bar of Figure 26D - 26E is 100 nm,

[0050] Figure 27A - 27E Shows the formation of a multi-component catenane system using DNA slats in a one-pot reaction. ( Figure 27A ) Formation of 8 rings, where the M13 scaffold passes through the staple strands. The staple ("brown") strands fold the stable DNA-origami bases and the DNA slats connect the 8 rings. ( Figure 27B ) 3D view of the cylindrical queen bee, which additionally acts as a multi-component catenane system that typically has a high yield for DNA-origami. ( Figure 27C ) Abstract form and 3D view of the DNA slats, which interweave through the ssDNA M13 scaffold rings on the cylindrical queen bee. By connecting on one side, a single DNA slat connects all 8 rings. ( Figure 27D)3D rendering of a DNA slat, where the DNA slats are intertwined and connect eight individual ssDNA rings. An angled top view is shown at the top, and a side view is at the bottom.( Figure 27E )Prior art for achieving up to a 4-component catenane system in low yields.

[0051] Figure 28A - 28B A cylinder honeybee for ultrasensitive detection is shown. Figure 28A Biomolecules present are shown attached to DNA slats (black) that bring eight rings together. In the absence of biomolecules, the honeybees are separated and growth cannot occur, even in the presence of DNA slats in solution. Figure 28B Biomolecules present in the reactants bring DNA slats (black) together and provide a scaffold of ssDNA for the tubular structure to be in close proximity, thus nucleating and growing.

[0052] Figure 29 A schematic diagram of a honeybee (upper drawing) where each slat has six binding sites and a transmission electron microscopy (TEM) image of the honeybee (lower drawing) are shown.

[0053] Figure 30A - 30B A flat DNA-origami honeybee that nucleates misaligned DNA slats is shown. Figure 30A Depicts a flat DNA-origami honeybee without Figure 23A the sheet layer shown at the bottom right in Figure 30B is a schematic diagram explaining how DNA slats (moving in a diagonal direction) assemble on the ssDNA scaffold of a flat honeybee.

[0054] Figure 31 Examples of biomolecule sensing and verification mechanisms on DNA-origami cylinder honeybees are shown. Top: Biomolecules present. (1) Biomolecules bind to the antibody bridge bond. (2) The medium gray strand is displaced via toehold-mediated strand displacement. (3) The light gray strand binds to the dark gray strand (sealing the bridge bond). Bottom: Biomolecules absent. (1) No biomolecules bind to the antibody bridge bond. (2) The medium gray strand is displaced via toehold-mediated strand displacement, resulting in none of the bridge bonds being intact, and subsequently the cylinder honeybees separate (shown in Figure 28A ) Detailed Description

[0055] Nature achieves rapid, nucleation-limited growth of cytoskeletal filaments such as actin and microtubules. This is accomplished by fixing each additional subunit to the 2-3 already attached subunits at the growing end of the filament through weak interactions. This means that if any two monomers bind to each other in solution, they will rapidly (e.g., within milliseconds) dissociate from each other because the single interaction is weak. This only forms a stable nucleus after 4 subunits come together simultaneously (which is a rare event). Thus, untriggered spontaneous nucleation is rare. Instead, nucleation can be triggered by providing a macromolecular "seed" that mimics the end of a fully formed filament.

[0056] For programmable self-assemblies, rapid, nucleation-limited growth is a very useful feature. However, the technological modification of natural filaments such as actin or microtubules now has many drawbacks: (1) limited understanding of how to tune the interaction strength between subunits; (2) the level of cooperativity is rather low (the weak interactions upon binding only extend for 2-3 subunits), so the inhibition of spontaneous nucleation is not as strong as it could be; and (3) growth is limited to one dimension (filament formation).

[0057] The rapid, reversible, zero-background, triggered nucleation and growth provided herein can have useful applications in nanotechnology and biotechnology such as ultrasensitive detection and templates for miniaturized materials.

[0058] Cross-cooperative assembly

[0059] The cross-cooperative assembly technique provided herein is based on the concept that can be applied to many self-assembling molecules, including nucleic acids and proteins. However, for simplicity and ease of understanding, when mentioned herein it mainly refers to cross-cooperative assembly in the case of nucleic acids such as deoxyribonucleic acid (DNA). The cross-cooperative assembly system uses three basic components: a nucleating nanostructure, a nanostructure programmed to bind to an initial (first) subset of the nucleating nanostructure, and another (second) subset of nanostructures programmed to bind to the initial nanostructure. In Figure 1A - 1BExamples of cross - cooperative assembly are provided, where the nucleating structure is called the "queen bee", the nanostructures of the first subgroup are called the "drone bees", and the nanostructures of the second (and any subsequent) subgroup are called the "worker bees". In this example, the final structure comprises multiple layers of aligned molecular rods, where each layer is rotated by a certain degree (e.g., 90 degrees) relative to the layers below and above it. For example, one layer can be perpendicular to an adjacent (immediately above or below) layer. In some embodiments, one layer is rotated 20, 30, 40, 50, 60, 70, 80, or 90 degrees relative to an adjacent layer (e.g., measured along the length of the drone and / or worker bee nanorods). Each intersection between the rods on adjacent layers adds a small amount of binding energy; any given rod intersects a large number of rods below and above it, and the net binding energy can be adjusted (e.g., by adjusting the design of the binding interface, e.g., the number of base pairs, or by modulating subunit concentration, temperature, or salt concentration) to be large enough to achieve stable (irreversible) or slightly favorable (reversible) attachment as needed. Before assembly initiation, any spontaneous crossing between two rods in solution is transient because the net energy is very low due to only one interaction. Thus, rods can be stably (or alternatively slightly favorably (reversibly)) added to an existing crossed structure (where many attachment points can be immediately achieved), but the structure will not assemble spontaneously in the absence of an existing crossed structure. There should be no growth unless a structural mimic (seed) of the existing crossed structure is added to the solution.

[0060] An exemplary experimental protocol for the cross - cooperative assembly system is as follows: (1) Design the constitutive building blocks (queen bee, drone bees, and worker bees) using DNA CAD tools. See, for example, Douglas SM, Marblestone AH, Teerapittayanon S, Vazquez A, Church GM, Shih WM. Rapid prototyping of 3D DNA - origami shapes with caDNAno. Nucleic Acids Res. 37, 5001–5006, 2009, the entire content of which is incorporated herein by reference.

[0061] The sequence and number of cooperative binding sites on the queen bee are customized to adjust the activation energy of nucleation as needed. (2) Construct and purify the constitutive building blocks using techniques in DNA synthesis and DNA origami and (3) Mix the drone bees and worker bees in solution and add the queen bee to initiate the growth of the higher - order DNA structure.

[0062] Nanostructures bind to each other through cooperative binding sites. A "cooperative binding site" is a location where two nanostructures interact (hybridize / bind). For example, nucleating nanostructures can be programmed with multiple nucleotide base sequences, each of which is complementary to the nucleotide base sequence of one of the nanostructures in an initial subset of nanostructures. Cooperative binding sites can include plug and socket sites, which include a plug strand and a socket strand. A plug strand is a nucleic acid strand (single-stranded nucleic acid) attached to a nucleic acid nanostructure such as a nanorod. The plug strand contains a nucleotide sequence that is complementary (and binds) to the nucleotide sequence within the associated socket strand. Thus, a pair of a plug strand and a socket strand includes nucleotide sequences that are complementary to each other such that the plug strand and the socket strand bind to each other (hybridize) to anchor, for example, drones to queens or worker bees to drones (see, for example, Figure 17B ). In some embodiments, a queen includes multiple plug strands that direct and anchor drones that include multiple complementary (associated) socket strands. Similarly, a drone can include multiple plug strands that direct and anchor worker bees that include multiple complementary socket strands.

[0063] Cooperative binding sites, such as, for example, plug strands and socket strands, can also be used in a similar manner to assemble nucleic acid (e.g., DNA) slats onto another nucleic acid scaffold structure. For example, as Figure 22 shows, DNA slats can be attached to a nucleic acid scaffold (queen) to fix the two-dimensional or three-dimensional shape of the scaffold structure. In the example shown in Figure 22 , DNA slats are used to fix (gather together) the cylindrical shape of a larger scaffold nanostructure. The growth of these slats along the scaffold through cooperative binding sites produces a cylindrical-like shape that can be visualized, for example, by microscopy.

[0064] Cooperative binding sites (e.g., plug and socket sequences) are arranged on nucleating nanostructures in a spatial configuration that facilitates the binding and alignment of the initial (e.g., scaffold) nanostructures. The length of the cooperative binding site can vary, in part, according to the desired strength (strong or weak) of the expected interaction between two molecules having complementary sites. In some embodiments, the cooperative binding site has a length of 5 - 50 nucleotides. For example, the cooperative binding site can have a length of 5 - 40, 5 - 30, 5 - 20, 5 - 10, 5 - 15, 10 - 50, 10 - 40, 10 - 30, 10 - 20, 30 - 50, 30 - 40, or 40 - 50 nucleotides. In some embodiments, the cooperative binding site has a length of 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides. A single plug strand and / or socket strand can have a length of, for example, 5 - 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) nucleotides.

[0065] The number of cooperative binding sites on the nanostructure can also vary. In some embodiments, the number of cooperative binding sites on the nanostructure is from 3 to 1000. For example, the number of cooperative binding sites on the nanostructure can be 3 - 900, 3 - 800, 3 - 700, 3 - 600, 3 - 500, 3 - 400, 3 - 300, 3 - 200, or 3 - 100. In some embodiments, the number of cooperative binding sites on the nanostructure is 3 - 10, 3 - 15, 3 - 20, 3 - 25, 3 - 30, 3 - 35, 3 - 40, 3 - 45, or 3 - 50. In some embodiments, the number of cooperative binding sites on the nanostructure is 3 - 15, 3 - 20, 3 - 25, 3 - 30, 3 - 35, 3 - 40, 3 - 45, or 3 - 50. In some embodiments, the number of cooperative binding sites on the nanostructure is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100.

[0066] The distance between the cooperative binding sites can also vary. In some embodiments, the distance between two cooperative binding sites on the same nanostructure is from 20 to 1000 angstroms. For example, the distance between two cooperative binding sites on the nanostructure can be 20 - 900, 20 - 800, 20 - 700, 20 - 600, 20 - 500, 20 - 400, 20 - 300, 20 - 200, 20 - 100, 50 - 1000, 50 - 900, 50 - 800, 50 - 700, 50 - 600, 50 - 500, 50 - 400, 50 - 300, 50 - 200, or 50 - 100 angstroms. In some embodiments, the distance between two cooperative binding sites on the nanostructure is 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, or 500 angstroms.

[0067] In some embodiments, the distance between cooperative binding sites, e.g., the distance between the plug strands (and / or the socket strands), can be 5 - 100 nucleotides (or nucleotide base pairs (bp)). In some embodiments, the distance between the plug strands (and / or the socket strands) is 5 - 20, 5 - 25, 5 - 50, or 5 - 100 nucleotides. In some embodiments, the distance between the plug strands (and / or the socket strands) is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. In some embodiments, the distance between the plug strands (and / or the socket strands) is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides. In some embodiments, the distance between the plug strands (and / or the socket strands) is 42 + / - 21 nucleotides. For example, the distance between the plug strands (and / or the socket strands) can be 21, 42, or 63 nucleotides. In some embodiments, the distance between the plug strands (and / or the socket strands) is 42 nucleotides.

[0068] The size of one nucleotide unit is 0.33 nm. Thus, in some embodiments, the distance between cooperative binding sites, e.g., the distance between the plug strands (and / or the socket strands), can be 5 - 35 nanometers (nm). In some embodiments, the distance between the plug strands (and / or the socket strands) is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nm. In some embodiments, the distance between the plug strands (and / or the socket strands) is 14 + / - 7 nm. For example, the distance between the plug strands (and / or the socket strands) can be 7, 14, or 21 nm. In some embodiments, the distance between the plug strands (and / or the socket strands) is 14 nucleotides.

[0069] In some embodiments, the distance between two cooperative binding sites on the nanostructure is equally spaced, while in other embodiments, the distance can vary. For example, the distance between the first cooperative binding site and the second cooperative binding site can be 30 angstroms, while the distance between the second cooperative binding site and the third cooperative binding site can be 30 angstroms, 40 angstroms, or 50 angstroms.

[0070] If two or more nanostructures are positioned relative to each other in the same direction, they are considered "aligned". For example, the 5' end (or 3' end) of the nanostructures can face the same direction along their y-axis. Figure 3BThe top layer of the structure shown in [Figure 0] shows aligned nanorods combined with nucleating nanostructures. In this example, the nanorods are perpendicular to the nucleating nanostructures.

[0071] Nucleating nanostructures are required to initiate the assembly of the first (initial) and second (and, thus, subsequent, e.g., third, fourth, fifth, etc.) subgroups of nanostructures, and the combination of nanostructures in the first subgroup with the nucleating structure is required to initiate the assembly of the nanostructures in the second subgroup. A "nucleating nanostructure" is any nanostructure programmed with binding sites that strongly (irreversibly) interact with the binding sites on each member of the initial subgroup of drone nanostructures and align them for recruiting worker nanostructures of subsequent subgroups. That is, the binding sites between the nucleating nanostructure and the nanostructures of the initial subgroup should be strong enough such that the initial nanostructures bind to the nucleating nanostructure and align along the nucleating nanostructure and do not dissociate from the nucleating nanostructure under the reaction conditions (e.g., isothermal, physiological conditions). For example, the nucleating nanostructure can have a two-dimensional or three-dimensional shape.

[0072] Nanostructures of other subgroups can be added to the cross-cocatalytic assembly system, thereby spreading the growth of the final structure (e.g., nanostructure, microstructure, or macrostructure). For example, nanostructures of the third, fourth, and fifth subgroups can be added. The combination of the second subgroup with the nanostructures of the first subgroup is required to initiate the assembly of the nanostructures in the third subgroup; the combination of the third subgroup and the nanostructures of the second subgroup is required to initiate the assembly of the nanostructures in the fourth subgroup; and so on. The final structure determined by the user can be assembled in a one-dimensional, two-dimensional (see, e.g., Figure 3B ) or three-dimensional manner.

[0073] The nanostructures (e.g., nanorods) of each subgroup should follow a specific set of binding energy parameters. More specifically, the nanostructures (e.g., nanorods) of an initial subgroup should bind strongly (irreversibly) and form an aligned layer along the nucleating nanostructures (where each nanostructure is oriented in the same direction relative to each other). The nanostructures (e.g., nanorods) of the initial subgroup should not interact (bind) with each other. Similarly, the nanostructures (e.g., nanorods) of subsequent subgroups should not interact (bind) with each other. Additionally, in the absence of a nucleating structure, any nanostructure (e.g., nanorod) from the initial subgroup should have only one weak (reversible) interaction with any other nanostructure (e.g., nanorod) from a subsequent subgroup. In the presence of a nucleating structure, a single nanostructure (e.g., nanorod) from the initial subgroup can interact with more than one nanostructure (e.g., nanorod) from a subsequent subgroup, and a single nanostructure (e.g., nanorod) from a subsequent subgroup can interact with more than one nanostructure (e.g., nanorod) from the initial subgroup. For example, referring to Figure 1B , a single nanostructure (e.g., nanorod) can bind to 8 other nanostructures (e.g., nanorods), although the single nanostructure (e.g., nanorod) binds to each of the 8 nanostructures (e.g., nanorods) only once to form two layers with a "crossed" pattern.

[0074] "Strong interaction" refers to a binding that occupies more than 50% (e.g., more than 60%, 70%, 80%, or 90%) of the time that the nanostructures bound in the reaction are together (dissociation constant is much less than the concentration of the species / nanostructures).

[0075] "Weak interaction" refers to a binding that occupies less than 1% of the time that the nanostructures bound in the reaction are together (dissociation constant is at least 100 times greater than the concentration of the species / nanostructures).

[0076] The nucleated nanostructures can bind two or more other nanostructures. In some embodiments, the nucleated nanostructures bind 5 - 1000 nanostructures (e.g., DNA nanorods). For example, the nucleated nanostructures can bind 3 - 900, 3 - 800, 3 - 700, 3 - 600, 3 - 500, 3 - 400, 3 - 300, 3 - 200, or 3 - 100 nanostructures. In some embodiments, the nucleated nanostructures bind 3 - 10, 3 - 15, 3 - 20, 3 - 25, 3 - 30, 3 - 35, 3 - 40, 3 - 45, or 3 - 50 nanostructures. In some embodiments, the nucleated nanostructures bind 10 - 15, 10 - 20, 10 - 25, 10 - 30, 10 - 35, 10 - 40, 10 - 45, or 10 - 50 nanostructures. In some embodiments, the nucleated nanostructures bind 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nanostructures (e.g., DNA nanorods).

[0077] Accordingly, a single subgroup of nanostructures (nanostructures programmed to interact with a single nucleated nanostructure) can include 3 - 900, 3 - 800, 3 - 700, 3 - 600, 3 - 500, 3 - 400, 3 - 300, 3 - 200, or 3 - 100 nanostructures. In some embodiments, a single subgroup of nanostructures includes 3 - 10, 3 - 15, 3 - 20, 3 - 25, 3 - 30, 3 - 35, 3 - 40, 3 - 45, or 3 - 50 nanostructures. In some embodiments, a single subgroup of nanostructures includes 10 - 15, 10 - 20, 10 - 25, 10 - 30, 10 - 35, 10 - 40, 10 - 45, or 10 - 50 nanostructures. In some embodiments, a single subgroup of nanostructures includes 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nanostructures (e.g., DNA nanorods).

[0078] "Subgroup of nanostructures" refers to a specific group of nanostructures that are similar in size (having similar dimensions) and structure / shape and are programmed to bind to a nucleated nanostructure (initial subgroup) or an existing layer formed by the alignment and binding of other nanostructures that have been aligned and bound to the nucleated structure or the nanostructures of another existing layer.

[0079] The nanostructures within a given subgroup are programmed not to bind to each other. Thus, in some embodiments, fewer than 10% of the nanostructures within a subgroup bind to another nanostructure of the same subgroup. In some embodiments, fewer than 9%, fewer than 8%, fewer than 7%, fewer than 6%, fewer than 5%, fewer than 4%, fewer than 3%, fewer than 2%, fewer than 1%, fewer than 0.5%, fewer than 0.2%, or fewer than 0.1% of the nanostructures within a subgroup bind to another nanostructure of the same subgroup. In some embodiments, none of the nanostructures within a subgroup bind to another nanostructure of the same subgroup.

[0080] Using cross-cocondensation, the nanostructures are aligned to form multiple layers, with each layer rotated a certain degree relative to the adjacent layers (above and below). Examples of two layers rotated relative to each other are shown in Figure 1B The top layer of aligned nanorods is rotated 90 degrees relative to the bottom layer of aligned nanorods. The degree of rotation between two adjacent layers can vary. In some embodiments, one layer is rotated 10 - 90 degrees, 20 - 90 degrees, 30 - 90 degrees, 40 - 90 degrees, 50 - 90 degrees, 60 - 90 degrees, 70 - 90 degrees, or 80 - 90 degrees relative to an adjacent layer. In some embodiments, one layer is rotated 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 degrees relative to an adjacent layer.

[0081] Nucleic acid nanostructures

[0082] “Nucleic acid nanostructures”, including “DNA nanostructures”, refer to nanostructures (e.g., structures of 0.1 nm - 1 μm (e.g., 0.1 nm - 100 nm) in each spatial dimension (e.g., 1D, 2D, or 3D)) that are rationally designed to self-assemble (be programmed) into a predetermined defined shape and that do not assemble in nature. Using nucleic acids to construct nanostructures can be achieved through strict nucleobase pairing rules (e.g., A binds to T, G binds to C, A does not bind to G or C, T does not bind to G or C), such that multiple strand portions with complementary base sequences bind together to form strong, robust structures. This allows rational design of the nucleobase sequences that will selectively assemble (self-assemble) to form nanostructures.

[0083] Examples of nucleic acid (e.g., DNA) nanostructures include, but are not limited to, DNA origami structures, in which long scaffold strands (e.g., at least 500 nucleotides in length) are folded into complex shapes by hundreds (e.g., 100, 200, 300, 400, 500 or more) of short (e.g., less than 200, less than 100 nucleotides in length) staple strands (Rothemund, P.W.K. Nature 440, 297–302 (2006); Douglas, S.M. et al., Nature 459, 414–418 (2009); Andersen, E.S. et al., Nature 459, 73–76 (2009); Dietz, H. et al., Science 325, 725–730 (2009); Han, D. et al., Science 332, 342–346 (2011); Liu, W et al., Angew. Chem. Int. Ed. 50, 264–267 (2011); Zhao, Z. et al., Nano Lett. 11, 2997–3002 (2011); Woo, S. & Rothemund, P. Nat. Chem. 3, 620–627 (2011); T. et al., Chem. Soc. Rev. 40, 5636–5646 (2011)). Other, more modular strategies have also been used to assemble DNA tiles (Fu, T. J. & Seeman, N. C. Biochemistry 32, 3211–3220 (1993); Winfree, E. et al., Nature 394, 539–544 (1998); Yan, H. et al., Science 301, 1882–1884 (2003); Rothemund, P. W. K. et al., PLoS Biol. 2, e424 (2004); Park, S. H. et al., Angew. Chem. Int. Ed. 45, 735–739 (2006); Schulman, R. & Winfree, E. Proc. Natl Acad. Sci. USA 104, 15236–15241 (2007); He, Y. et al., Nature 452, 198–201 (2008); Yin, P. et al., Science 321, 824–826 (2008); Sharma, J. et al., Science 323, 112–116 (2009); Zheng, J. P. et al., Nature 461, 74–77 (2009); Lin, C. et al., ChemPhysChem 7, 1641–1647 (2006)) or RNA tiles (Chworos, A. et al., Science 306, 2068–2072 (2004); Delebecque, C. J. et al., Science 333, 470–474 (2011)) into periodic (Winfree, E. et al., Nature 394, 539–544 (1998); Yan, H. et al., Science 301, 1882–1884 (2003); Chworos, A. et al., Science 306, 2068–2072 (2004); Delebecque, C. J. et al., Science 333, 470–474 (2011)) and algorithmic (Rothemund, P. W. K. et al., PLoS Biol. 2, e424 (2004)) two-dimensional lattices (Seeman, N. C. J. Theor. Biol. 99, 237–247 (1982); Park, S. H. et al., Angew. Chem. Int. Ed. 45, 735–739 (2006)), extended strips (Schulman, R. & Winfree, E. Proc. Natl Acad. Sci.USA 104,15236–15241(2007); Yin, P. et al., Science 321, 824–826(2008)) and tubes (Yan, H. et al., Science 301, 1882–1884(2003); Yin, P. et al., Science 321, 824–826(2008); Sharma, J. et al., Science 323, 112–116(2009)), three-dimensional crystals (Zheng, J.P. et al., Nature 461, 74–77(2009)), polyhedra (He, Y. et al., Nature 452, 198–201(2008)) and simple finite two-dimensional shapes (Chworos, A. et al., Science 306, 2068–2072(2004); Park, S.H. et al., Angew. Chem. Int. Ed. 45, 735–739(2006)).

[0084] Thus, the cross-cocooned building blocks (e.g., nucleated nanostructures and multiple sub-groups of nanostructures) can be one of a variety of nucleic acid nanostructure shapes, including, but not limited to, rods / tubes, sheets, strips, lattices, cubes, spheres, polyhedra, or another two- or three-dimensional shape. In some embodiments, the nanostructure has (a) junction(s), (a) branch(es), cross, and / or double-cross formed by nucleobase pairing of two or more nucleic acid strands (see, e.g., Mao, C. PLoS Biology, 2(12), 2036-2038, 2004).

[0085] In some embodiments, the nucleic acid nanostructure has a handle and a cylindrical shape, similar to Figure 22 that depicted in

[0086] The versatile and stable nature of DNA origami enables the construction of a variety of unique architectures that can be designed in a specific way to facilitate the co-assembly of larger structures. In one example, each component is an independently folded DNA-origami structure. Figure 3A Examples of DNA-origami drones, queens, and worker bees are shown, where the drones and worker bees have the same architecture (6-helix bundle DNA nanotubes). The queens, drones, and worker bees can then be assembled in a cooperative manner to form higher-order 1D, 2D, and 3D structures( Figure 3B ). By combining 1D and 2D design principles to consider 3D structures. For example, Figure 22 depicts the use of 2D drone / worker bee slats assembly to form a 3D queen bee nanostructure in a cylindrical shape.

[0087] A nucleic acid (e.g., DNA) strip is a nanostructure formed as a strip and composed of DNA. The strip can be an antiparallel-crossing single-stranded strip (AXSSS), which includes multiple single strands that cross paired single strands only once. Also provided herein are parallel-crossing strips, which include a pair of strands that cross another pair of strands.

[0088] Similar to large-scale DNA-origami crossover co-assembly, single-stranded DNA can be used to achieve co-assembly of more advanced structures. To achieve this, drones and worker bees are replaced with oligonucleotides of various lengths (depending on the recommended architecture), which can be assembled onto the DNA-origami queen nucleation sites ( Figure 4 shown in) or assembled onto the Figure 5 , Figure 22 and Figure 24A - 24B shown single-stranded DNA catenane structures. Figure 5 The loop structures depicted in are composed of single-stranded DNA with exposed binding sites for drone and worker bee oligonucleotides. In another example, the assembly is folded into a DNA-origami cylinder queen ( Figure 24A - 24B ). The scaffold can be covered with extended DNA strips (multiple strips) capable of seeding more DNA strips, causing growth of the structure. Generally, DNA strips work in two steps: first, folding the origami queen sites (e.g., mixing M13 scaffolds and staple strands), and second, mixing the crude DNA-origami queen reactants with the DNA strips, causing growth of the structure. For example, changing the salt concentration, temperature, and DNA strip concentration can change the binding energy of various sub-assemblies, causing reversible or irreversible binding.

[0089] Typically, nucleic acid nanostructures do not contain coding sequences (sequences encoding full-length mRNA or proteins), and thus, nucleic acid nanostructures do not contain promoters or other genetic elements that control gene / protein expression. Individual single-stranded nucleic acids (e.g., DNA or RNA strands without secondary structure), or individual double-stranded nucleic acids (e.g., without secondary structure), such as the double helix existing in nature or the double helix produced synthetically or recombinantly (e.g., such as plasmids or other expression vectors), are specifically excluded from the definition of nucleic acid nanostructures.

[0090] In some embodiments, the nanostructure has a void volume, which is the combined volume of the spaces between the nucleic acids forming the nanostructure. It should be understood that "space" includes spaces filled with fluid. Thus, a nanostructure in solution having a void volume of 25% can comprise 75% nucleic acid and 25% reaction buffer (filling 25% of the void volume of the nanostructure). In some embodiments, in solution, e.g., a nanostructure in a reaction buffer can have a void volume of at least 10% (e.g., 10 - 90%, 10 - 80%, 10 - 70%, 10 - 60%, 10 - 50%, 10 - 40%, or 10 - 30%), at least 20% (e.g., 20 - 90%, 20 - 80%, 20 - 70%, 20 - 60%, 20 - 50%, 20 - 40%, or 20 - 30%), at least 30% (e.g., 30 - 90%, 30 - 80%, 30 - 70%, 30 - 60%, 30 - 50%, or 30 - 40%), at least 40% (e.g., 40 - 90%, 40 - 80%, 40 - 70%, 40 - 60%, or 40 - 50%), at least 50% (e.g., 50 - 90%, 50 - 80%, 50 - 70%, or 50 - 60%), at least 60% (e.g., 60 - 90%, 60 - 80%, or 60 - 70%), at least 70% (e.g., 70 - 90% or 70 - 80%), or at least 80% (e.g., 80 - 90%). In some embodiments, the nanostructure has a void volume of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%.

[0091] A "nucleic acid nanorod", including a "DNA nanorod", is a rod-shaped nucleic acid (e.g., DNA) nanostructure. A nanorod is a three-dimensional cylindrical shape with a length greater than its diameter. Examples of nanorods are depicted in Figure 1A - 1B and Figure 3A - 3B . In some embodiments, the nucleic acid nanorod comprises a six-helix bundle. For example, six DNA double helices can be joined to each other at two crossover sites. When the crossover points are separated by 7 or 14 nucleotide pairs, DNA double helices with 10.5 nucleotide pairs per turn contribute to the programming of DNA double crossover molecules to form a hexagonal symmetric arrangement (see, e.g., Mathieu F. et al., Nano Lett. 5(4), 661 - 664 (2005)). Other methods for assembling nucleic acid nanorods (also referred to as nanotubes) can be used (see, e.g., Feldkamp, U. et al., Angew. Chem. Int. Ed. 45(12), 1856–1876 (2006); Hariri A. et al., Nature Chemistry, 7, 295 - 300 (2015)).

[0092] The length and diameter of the nanorods (or other nanostructures) can vary. In some embodiments, the length of the nanorods (or other nanostructures) is 10 - 100 nm or 10 - 500 nm. For example, the nanorods can have a length of 10 - 500 nm, 10 - 400 nm, 10 - 300 nm, 10 - 200 nm, 10 - 100 nm, 10 - 90 nm, 10 - 80 nm, 10 - 70 nm, 10 - 60 nm, 10 - 50 nm, 10 - 30 nm, or 10 - 20 nm. In some embodiments, the nanorods have a length of 100 - 500 nm, 200 - 500 nm, or 300 - 500 nm. In some embodiments, the nanorods have a length of 100 nm, 150 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, or 500 nm. In some embodiments, the nanorods have a length of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nm. In some embodiments, the length of the nanorods (or other nanostructures) is greater than 100 nm (e.g., 100 - 1000 nm), or less than 10 nm (e.g., 1 - 10 nm). In some embodiments, the diameter of the nanorods (or other nanostructures) is 5 - 90 nm. For example, the nanorods can have a diameter of 5 - 80 nm, 5 - 70 nm, 5 - 60 nm, 5 - 50 nm, 5 - 30 nm, 5 - 20, or 5 - 10 nm. In some embodiments, the nanorods have a diameter of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 nm. In some embodiments, the diameter of the nanorods is greater than 9 nm, or less than 5 nm. Thus, in some embodiments, the nanorods (or other nanostructures) have a perimeter of 15 - 300 nm (C≈3.14 x d).

[0093] If the length of the nanostructure is greater than the width / diameter (e.g., by at least 10%, 20%, 25%, 50%, 100%, or 200% or more), the nucleic acid nanostructures, such as nanorods, are considered to be "elongated".

[0094] Nucleic acid nanostructures are typically nanostructures on the nanoscale (e.g., having a length of 1 - 1000 nanometers). However, in some embodiments, the term "nanostructure" herein can include microscale structures (e.g., structures assembled from more than one nanoscale or microscale structure). In some embodiments, the size (e.g., length or width / diameter) of the nanostructure is greater than 500 nm or greater than 1000 nm. In some embodiments, the size of the nanostructure is 1 micron to 2 microns. In some embodiments, the size of the nanostructure is 10 - 500 nm, 10 - 450 nm, 10 - 400 nm, 10 - 350 nm, 10 - 300 nm, 10 - 250 nm, 10 - 200 nm, 10 - 150 nm, 10 - 100 nm, 10 - 50 nm, or 10 - 25 nm. In some embodiments, the size of the nanostructure is 500 - 450 nm, 500 - 400 nm, 500 - 350 nm, 500 - 300 nm, 500 - 250 nm, 500 - 200 nm, 500 - 150 nm, 500 - 100 nm, 500 - 50 nm or 500 - 25 nm. In some embodiments, the size of the nanostructure is 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450 or 500 nm.

[0095] Nucleic acid nanostructures are considered to be "self - assembling". From a bottom - up perspective, self - assembly refers to the process by which molecules assume a defined arrangement without the need for guidance or management from an external source. Nevertheless, it should be understood that with synthetic nucleic acid self - assemblies as provided herein, the nucleotide base sequences that direct the assembly of the nucleic acids are artificially designed, and the corresponding nucleic acids are accordingly synthesized by an external source (such as a person skilled in the art (using, for example, standard nucleic acid synthesis techniques)). That is, a person of ordinary skill in the art can, based on the strict nucleotide base - pairing rules (e.g., A binds to T, G binds to C, A does not bind to G or C, T does not bind to G or C) set, "program" the nucleotide base sequences within a single nucleic acid strand or between two different nucleic acid strands to selectively cause them to bind to each other in solution. Self - assembly can be intramolecular (folding) or intermolecular.

[0096] The nanostructures, and thus the nanostructures, microstructures, and macrostructures assembled from smaller nanostructures, are "rationally designed". As discussed above, the nanostructures do not assemble in nature. The nucleic acid strands used in the cross-cocoaassembly are "programmed" such that within a specific population of strands, complementary nucleobase sequences within the same strand or between two different strands selectively bind to each other to form complex, user-specified structures, such as rods / tubes, strips, lattices, sheets, polyhedra, cubes, spheres, or other two- or three-dimensional shapes. The nanostructures can have regular shapes (all the same sides and all equal interior angles) or irregular shapes (sides and angles of any length and degree).

[0097] Method of cross-cocoaassembly

[0098] In some embodiments, the nucleation of nanostructures and the self-assembly of multiple subgroups of nanostructures occur in a "one-pot" reaction, where all the nucleic acid nanostructures of the cross-cocoaassembly system are mixed in a reaction buffer and then incubated under conditions that result in the self-assembly of all the nucleic acid nanostructures.

[0099] The conditions for the self-assembly of the nucleic acid nanostructures that result in the cross-cocoaassembly reaction can vary depending on the size, shape, composition, and number of the nucleic acid nanostructures in a particular reaction. Such conditions can be determined by one of ordinary skill in the art, e.g., one who rationally designs / programs the nanostructures to self-assemble.

[0100] The cross-cocoaassembly method can be carried out at a variety of temperatures. In some embodiments, the cross-cocoaassembly method is carried out at room temperature (∼25 °C) or 37 °C. The cross-cocoaassembly method can be carried out at temperatures below 25 °C or above 37 °C.

[0101] The salt concentration of the reaction buffer in which the cross-cocoaassembly reaction is carried out can also vary. In some embodiments, the reaction buffer contains MgCl2 salt at a concentration of 1 mM - 10 mM (e.g., 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, or 10 mM). In some embodiments, the reaction buffer contains NaCl at a concentration of 100 mM - 500 mM (e.g., 100 mM, 200 mM, 300 mM, 400 mM, or 500 mM). In some embodiments, the cross-cocoaassembly method is carried out under high-salt conditions. Thus, in some embodiments, the reaction buffer contains MgCl2 salt at a concentration of at least 20 mM (e.g., 20 - 500 mM or 20 - 200 mM). In some embodiments, the reaction buffer contains NaCl at a concentration of at least 1 M (e.g., 1 - 2 M, 1 - 3 M, 1 - 4 M, or 1 - 5 M).

[0102] In any given reaction, the number of initial nanostructures (drones) exceeds the number of nucleated nanostructures (queens). Thus, in some embodiments, the ratio of nucleated nanostructures to non-nucleated nanostructures (e.g., drones from an initial subgroup or worker bees from a subsequent subgroup) is 1:10–1:10 12 (trillion). For example, the ratio of nucleated nanostructures to non-nucleated nanostructures can be 1:10–1:1000, 1:10–1:500, 1:10–1:100, 1:10–1:75, 1:10–1:50, or 1:10–1:25. In some embodiments, the ratio of nucleated nanostructures to non-nucleated nanostructures is 1:1000, 1:500, 1:100, 1:90, 1:80, 1:70, 1:60, 1:50, 1:40, 1:30, 1:20, or 1:10.

[0103] In some embodiments, the cross-cocoa assembly reactant incubation lasts 2-96 hours. For example, the cross-cocoa assembly reactant can be incubated for 2-24 hours, 2-30 hours, 2-36 hours, 2-42 hours, 2-48 hours, 2-54 hours, 2-60 hours, 2-66 hours, 2-72 hours, 2-78 hours, 2-84 hours, 2-90 hours, or 2-96 hours. In some embodiments, the cross-cocoa assembly reactant incubation lasts 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, or 72 hours. In some embodiments, the cross-cocoa assembly reactant incubation lasts 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, or 72 hours.

[0104] Biosensor

[0105] In some embodiments, the cross-assembly product can be used as a biosensor that is capable of detecting a selected biomolecule (analyte) using a variety of different mechanisms and the systems described herein. For example, in such a system, the presence of a biomolecule can be used to trigger cross-assembly, which can then be detected (manifested), thereby indicating the presence of the biomolecule.

[0106] Biomolecules can be detected using a ring system. As Figure 6As depicted, a large DNA loop (“main loop”), i.e., a single-stranded DNA, can be separated to incorporate a biomolecule capture site (analyte test site) for binding a macromolecule in a biological sample. The DNA loop is looped and encompasses multiple separate and independent “guest” loops, which are single-stranded DNAs and act as catenane queens, such that the guest loops are connected to the main loop, similar to individual beads on a bracelet. In some embodiments, the guest loops are individually formed from separate single-stranded nucleic acids (see, e.g., Figure 5 and 6 ), while in other embodiments, the guest loops are formed from a long single nucleic acid strand assembled into multiple (e.g., vertically stacked) loops (see, e.g., Figure 27A and 27B ). The number of guest loops can be 2, 3, 4, or 5 or more. In an embodiment, each guest loop (catenane queen) includes binding sites for drone and worker oligonucleotides and is thus capable of cross-assembly. In an embodiment, the multiple connected guest loops form a catenane queen including binding sites (e.g., plug strands) for drone and worker nucleic acids and / or structures when in close proximity and are thus capable of cross-assembly. The number of binding sites per guest loop can vary and can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100. A biomolecule test site can also be formed near the biomolecule capture site.

[0107] In some embodiments, the presence of a biomolecule can be detected in a mixture, such as a biological sample, as follows. First, the biological sample is mixed with a high concentration of catenane queens, allowing macromolecules of interest to bind to the biomolecule capture site. Then, a chemical reaction is used to reversibly cleave the biomolecule capture site. Catenane queens that do not bind the target biomolecule will separate more rapidly than those aggregated with the target biomolecule. The remaining catenane queens in the test mixture are reconnected at the biomolecule test site. Subsequently, drones and workers are added to the test mixture to amplify the remaining intact queens using easily observable micron-scale DNA structures. This system is modular, and the biomolecule capture site can be customized to bind disease markers, including protein or nucleic acid sequences.

[0108] A highly specific biosensor can also be established by adding a biomolecule detection system to a multiple guest loop (e.g., guest ring) catenane system having DNA slats (as depicted in FIGS. 27 - 28). In this example, a cylinder queen bee is used; however, other three - dimensional shapes are possible (e.g., sheets, blocks, and dendrimers). Examples of preparing the cylinder queen bee (wound sheet) were described above.

[0109] Examples of DNA slats are depicted in Figure 21A and 21B .

[0110] Using a scaffold for DNA origami (e.g., M13 scaffold) and staple strands, multiple guest loop catenane systems can be formed. For example, in FIG. 27, an 8 - ring system is formed in a one - pot reaction. The number of rings (loops) can vary depending on the design of the system and can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 rings. Additional rings can be used. Unlike the systems described above, the handle (elongated structure) and the rings (loops) are part of the same single - stranded DNA (e.g., M13 DNA); the handle structure is programmed to be joined together by specific staple strands (slats). The system is designed to surround a specific staple strand / slat; in the presence of a biomolecule, they bring the structures together, and when drone and worker bees are added, growth can occur from the parallel rings ( Figure 28B ). In the absence of a biomolecule, the staple strand / slat releases the structures, and growth cannot occur even in the presence of drones and worker bees when the queen bee is separated and the proximity of the binding sites is not sufficient for nucleation and growth ( Figure 28A ). The presence of the structures can be detected using any of the methods described above or any method known in the art.

[0111] The DNA slats or other nucleic acids of the biosensor can be modified using one or more switchable bridging bonds. A "switchable bridging bond" is a connection between functional groups that forms or breaks in the presence of a specific reagent (e.g., a reaction reagent or a dissociating agent). Examples of switchable bridging bonds include bonds formed via "click chemistry" reactions (e.g., between azides and alkynes), protein - protein binding (e.g., one or more antibodies binding to a target protein / antigen), and disulfide bonds (between two thiol groups).

[0112] Accordingly, some aspects of the present disclosure provide a biosensor comprising: (i) a first DNA strip comprising a first functional group (e.g., azide or alkyne), a first binding partner (e.g., an antibody, aptamer or nanobody), and a second functional group (e.g., thiol or nucleic acid), and (ii) a second DNA strip comprising a third functional group (e.g., thiol or nucleic acid), a second binding partner (e.g., an antibody, aptamer or nanobody), and a fourth functional group (e.g., azide or alkyne), wherein the first and fourth functional groups react in the presence of a reaction reagent to form a linkage (e.g., a covalent bond), wherein the first and fourth binding partners specifically bind to a biomolecule of interest to form a linkage (e.g., a non-covalent bond), and wherein the second and third functional groups form a linkage (e.g., a covalent bond) that breaks in the presence of a dissociation reagent.

[0113] In some embodiments, the biosensor comprises a first DNA strip and a second DNA strip, the first DNA strip comprising an azide, an antibody, and a thiol, and the second DNA strip comprising an alkyne, an antibody, and a thiol, wherein the antibody of (i) and the antibody of (ii) specifically bind to a biomolecule of interest.

[0114] The "first biomolecule binding partner" and the "second biomolecule binding partner" are any molecules that bind to the same target biomolecule to form a switchable bridging bond that links the DNA strips to each other (by non-covalent bonds). In some embodiments, the first and second biomolecule binding partners are proteins or peptides. For example, the first and second biomolecule binding partners can be antibodies that bind to different epitopes of the same antigen. Thus, in some embodiments, the first and second biomolecule binding partners are antibodies (e.g., monoclonal, polyclonal, human, humanized or chimeric). In some embodiments, the first and second biomolecule binding partners are antibody fragments (e.g., Fab, F(ab')2, Fc, scFv or vhh), and the biomolecule binding partner can also be a nanobody or an aptamer. Other protein-protein binding partners can be used.

[0115] "The "first functional group" and the "fourth functional group" are functional groups that react with each other to form a linkage (bond, such as a covalent or non-covalent bond), and the linkage forms a switchable bridge bond that connects DNA slats to each other. In some embodiments, the bridge bond is formed by a click chemistry (azide-alkyne cycloaddition) reaction (e.g., V.V. Rostovtsev, et al., Angew. Chem. Int. Ed., 2002, 41, 2596-2599; and F. Himo, et al., J. Am. Chem. Soc., 2005, 127, 210-216, each incorporated herein by reference). Thus, in some embodiments, one of the first or fourth functional groups is an azide, and the other of the first or fourth functional groups is an alkyne. For example, the first functional group can be an azide, and the fourth functional group can be trans-cyclooctene (TCO). Other click chemistry functional groups can be used."

[0116] "The "second functional group" and the "third functional group" are functional groups that react with each other to form a linkage (bond, such as a covalent or non-covalent bond), and the linkage also forms another switchable bridge bond that connects DNA slats to each other. The bridge bond breaks (dissociates) in the presence of a dissociating reagent. A "dissociating reagent" is a reagent (e.g., a chemical substance) that breaks the bond (e.g., a covalent bond) between the second and third functional groups. In some embodiments, the second and third functional groups are thiols that react with each other to form a disulfide bond. Thus, in some embodiments, the dissociating reagent is dithiothreitol (DTT). In some embodiments, the concentration of DTT is 50 mM - 200 mM. For example, the concentration of DTT can be 100 mM. Other functional groups can be used."

[0117] Additional embodiments

[0118] 1. A composition comprising:

[0119] (a) nucleated nanostructures;

[0120] (b) a first subgroup of elongated nanostructures, wherein fewer than 10% of the nanostructures of (b) are bound to each other, and wherein the nanostructures of (b) are irreversibly bound to the nucleated nanostructures of (a); and

[0121] (c) a second subgroup of elongated nanostructures, wherein fewer than 10% of the nanostructures of (c) are bound to each other,

[0122] wherein, in the absence of nucleated nanostructures, the nanostructures of (b) can reversibly bind to the nanostructures of (a) at only a single location on the nanostructures of (a), and

[0123] Among them, in the absence of nucleating nanostructures, the nanostructures of (a) can reversibly bind to the nanostructures of (b) at only a single position on the nanostructures of (b).

[0124] 3. The composition according to embodiment 1, further comprising (d) a third subgroup of elongated nanostructures, wherein less than 10% of the nanostructures of (d) are bound to each other.

[0125] 4. The composition according to embodiment 1 or 2, wherein the nanostructures of (b) are aligned in one direction and irreversibly bound to the nucleating nanostructures of (a) to form a first layer.

[0126] 5. The composition according to embodiment 3, wherein the nanostructures of (c) are aligned in one direction and bound to the nanostructures of the first layer to form a second layer, wherein the first layer is rotated 10 degrees - 170 degrees relative to the second layer.

[0127] 6. The composition according to embodiment 4, wherein the first layer is rotated 90 degrees relative to the second layer.

[0128] 7. The composition according to embodiment 4 or 5, wherein the nanostructures of (d) are aligned in one direction and bound to the nanostructures of the second layer to form a third layer, wherein the second layer is rotated 10 degrees - 170 degrees relative to the third layer.

[0129] 8. The composition according to any one of embodiments 1 - 7, wherein the nucleating nanostructures of (a), the nanostructures of (b), the nanostructures of (c), and / or the nanostructures of (d) are nucleic acid nanostructures.

[0130] 9. The composition according to embodiment 8, wherein the nucleating nanostructures of (a), the nanostructures of (b), the nanostructures of (c), and / or the nanostructures of (d) are DNA nanostructures.

[0131] 10. The composition according to embodiment 8 or 9, wherein the nucleating nanostructures of (a), the nanostructures of (b), the nanostructures of (c), and / or the nanostructures of (d) comprise long nucleic acid chains, and the long nucleic acid chains are bound to multiple nucleic acid chains shorter than the long nucleic acid chains.

[0132] 11. The composition according to embodiment 8 or 9, wherein the nucleating nanostructures of (a), the nanostructures of (b), the nanostructures of (c), and / or the nanostructures of (d) comprise multiple nucleic acid chains, and the length of each chain is less than 200 nm.

[0133]

[0134] ​12. The composition according to any one of embodiments 1-6, wherein the nucleated nanostructure of (a), the nanostructure of (b), the nanostructure of (c), and / or the nanostructure of (d) is a protein nanostructure.

[0135] 13. The composition according to any one of embodiments 1-12, wherein the nucleated nanostructure of (a), the nanostructure of (b), the nanostructure of (c), and / or the nanostructure of (d) is rod-shaped.

[0136] 14. A method, comprising:

[0137] Mixing in a reaction buffer

[0138] (a) Nucleated nanostructures;

[0139] (b) A first subgroup of elongated nanostructures, wherein less than 10% of the nanostructures of (b) are bound to each other, and wherein the nanostructures of (b) irreversibly bind to the nucleated nanostructures of (a); and

[0140] (c) A second subgroup of elongated nanostructures, wherein less than 10% of the nanostructures of (c) are bound to each other,

[0141] wherein, in the absence of nucleated nanostructures, the nanostructures of (b) can reversibly bind to the nanostructures of (a) only at a single location on the nanostructures of (a), and

[0142] wherein, in the absence of nucleated nanostructures, the nanostructures of (a) can reversibly bind to the nanostructures of (b) only at a single location on the nanostructures of (b); and

[0143] Incubating the reaction buffer comprising (a), (b), and (c) under conditions that result in the binding of the nanostructures of (b) to the nucleated nanostructures of (a) and the binding of the nanostructures of (c) to the nanostructures of (b) to form a hierarchical structure.

[0144] 15. The method according to embodiment 14, wherein the reaction buffer further comprises (d) a third subgroup of elongated nanostructures, wherein less than 10% of the nanostructures of (d) are bound to each other.

[0145] 16. The method according to embodiment 14 or 15, wherein the nucleated nanostructure of (a), the nanostructure of (b), the nanostructure of (c), and / or the nanostructure of (d) is a nucleic acid nanostructure.

[0146] 17. The method according to embodiment 16, wherein the nucleated nanostructure of (a), the nanostructure of (b), the nanostructure of (c), and / or the nanostructure of (d) is a DNA nanostructure.

[0147] 18. The method according to embodiment 16 or 17, wherein the nucleated nanostructures of (a), the nanostructures of (b), the nanostructures of (c) and / or the nanostructures of (d) comprise long nucleic acid chains, and the long nucleic acid chains are bound to multiple nucleic acid chains shorter than the long nucleic acid chains.

[0148] 19. The method according to embodiment 16 or 17, wherein the nucleated nanostructures of (a), the nanostructures of (b), the nanostructures of (c) and / or the nanostructures of (d) comprise multiple nucleic acid chains, and the length of each chain is less than 200 nm.

[0149] 20. The method according to any one of embodiments 14-16, wherein the nucleated nanostructures of (a), the nanostructures of (b), the nanostructures of (c) and / or the nanostructures of (d) are protein nanostructures.

[0150] 21. The method according to any one of embodiments 14-20, wherein the nucleated nanostructures of (a), the nanostructures of (b), the nanostructures of (c) and / or the nanostructures of (d) are rod-shaped.

[0151] 22. A composition comprising:

[0152] (a) Nucleated DNA nanostructures;

[0153] (b) A first subgroup of elongated DNA nanorods, wherein less than 10% of the nanostructures of (b) are bound to each other, and wherein the DNA nanorods of (b) are irreversibly bound to the nucleated DNA nanostructures of (a); and

[0154] (c) A second subgroup of elongated DNA nanorods, wherein less than 10% of the DNA nanorods of (c) are bound to each other,

[0155] wherein, in the absence of nucleated DNA nanostructures, the DNA nanorods of (b) can reversibly bind to the DNA nanorods of (a) only at a single position on the DNA nanorods of (a), and

[0156] wherein, in the absence of nucleated DNA nanostructures, the DNA nanorods of (a) can reversibly bind to the DNA nanorods of (b) only at a single position on the DNA nanorods of (b).

[0157] Examples

[0158] Example 1

[0159] These examples demonstrate the assembly of nucleated nanostructures (queen bees). The most prominent band from a screening assay of a nucleic acid self-assembly reaction was selected and denatured by incubation at 90 °C for 2 minutes, followed by an 18-hour ramp. The gel ( Figure 9A ) was 2% agarose (10 μL ethidium bromide, c = 10 mg / mL) and run at 60 V for 240 minutes in 0.5x TBE and 11 mM MgCl2. A seesaw experiment was performed where the temperature was varied between 65 - 60 °C (A), 60 - 55 °C (B), 65 - 55 °C (C), and 60 - 50 °C (D). The bands of the gel were excised, followed by FreezeNSqueeze at 16k x g for 15 minutes, and then stained with 2% UF after washing with 2 minutes of ddH2O to purify the structures. The queen bees folded well and no significant differences were observed between conditions A to D on the seesaw experiment ( Figure 9B ).

[0160] The experiment was repeated using different nanostructures acting as "drones". The most prominent band from a large-scale screening was selected and denatured by incubation at 90 °C for 2 minutes, followed by an 18-hour ramp. The gel ( Figure 10A ) was 2% agarose (10 μL ethidium bromide, c = 10 mg / mL) and run at 60 V for 240 minutes in 0.5x TBE and 11 mM MgCl2. In this experiment, the temperature was varied between 70 - 60 °C (A), 65 - 55 °C (B), 65 - 60 °C (C), and 60 - 55 °C (D). The bands of the gel were excised, followed by FreezeNSqueeze at 16k x g for 15 minutes, and then stained with 1% UF to purify the structures. The drones folded well and no significant differences were observed between conditions A to D on the seesaw experiment ( Figure 10B ).

[0161] Next, the assembly of queen bees with drones was verified ( Figure 11 ). The following conditions were tested (at a 1:1:1 ratio): queen bee - all sites closed and two drones; queen bee - site 0 exposed and two drones; queen bee - site 1 exposed and two drones; queen bee - sites 0 / 1 exposed and two drones; and queen bee - all sites exposed and two drones. Assembly was achieved by incubation at 25 °C for a period of 72 hours, and the structures were purified by excising the bands of the gel, followed by FreezeNSqueeze at 16k x g for 15 minutes, and then stained with 2% UF. The samples were run on a 2% agarose gel (10 μL ethidium bromide, c = 10 mg / mL) and run at 60 V for 240 minutes in 0.5x TBE and 11 mM MgCl2. Approximately 10 - 15 ng of each structure was observed.

[0162] Example 2

[0163] A similar system was constructed using single-stranded DNA instead of the 6-helix bundle. A schematic diagram of the nucleating nanostructure architecture is shown in Figure 12A . Each single strand contains a binding region and a linker region, including a 5bp binding region and linker (polyT) regions of 3 and 5 nucleotides. Exemplary 5bp, 2-nucleotide linkers are shown below:

[0164] TGCAA TTT AATTC TTT TAGCA TTT CAATA TTT GTAGA TTT GAGAA TTT CGTTTT TTT ATTCA–62mer (SEQ ID NO:683).

[0165] Worker bees are stacked on top of drone bees in layers ( Figure 12B - 12G ). The queen bee is shown to fold in two gradients of 5C or 10C ( Figure 12A ). Folding occurs during a 2-minute denaturation period at 90°C and after an 18-hour gradient. Samples are run on a 2% agarose gel (10 μL ethidium bromide, c = 10 mg / mL) and run at 60 V for 240 minutes in 0.5x TBE and 11 mM MgCl2. The queen bee is incubated with 6 mM MgCl2 under a thermal gradient of 50 - 40°C. The resulting structures are shown in Figure 13B .

[0166] Example 3

[0167] The assembly of worker bees only (both short and long linkers) without a queen bee was examined. In this example, worker bees do not assemble under conditions of high salt concentration (1 M NaCl, up to 15 mM MgCl2), low temperature (4°C), and high concentration of worker bees (3.125 μM). Other conditions were also tested, including 10 - 20 mM PEG and high salt and high concentration of oligonucleotides. No assembly occurred. Figure 14A - 14B The successful assembly of drone / worker bees at different concentrations with the queen bee is shown. The structures were purified by cutting the bands, FreezeNSqueeze at 16k xg for 15 minutes, and 2% UF staining. In the absence of the queen bee, there was no sign of assembly ( Figure 14C ).

[0168] Then, the duplex length was increased to 8 bp, and 2nt (v0.1) and 3nt (v0.2) linker regions were tested. Intertwining was introduced into the structure, and staple strands were added to constrain the ends of the scaffold loops ( Figure 15A ). As Figure 16BAs can be seen, in any group and under any salt concentration condition, no assembly exists in the absence of the queen bee.

[0169] Example 4

[0170] This example demonstrates that 6-helix bundle DNA nanorod drones are assembled by the lattice queen bee into a cross structure through nucleation ( Figure 19A - 19D ). The lattice queen bee has 16 cells, and each cell can bind drones using 5 cooperative plug-socket binding sites. Shown here are the site-specific bindings of two 440 nm long drones ( Figure 19A ), one 250 nm long drone ( Figure 19B ), and 16 250 nm long drones ( Figure 19C ). This example shows the binding of drones using 10 bp plug-sockets to the lattice queen bee. When a stoichiometric excess of drones is present, Figure 19D the agarose gel image in Figure 18 shows that the queen bee in the reaction is completely bound by the drones. Additionally, the functionality of the plug-socket binding system ( Figure 18 ) is shown together with the TEM micrographs and kinetic data of these assemblies ( Figure 19A -D and Figure 20 ).

[0171] The lattice queen bee and 6-helix bundle drones were conceptualized and then designed using the caDNAno design tool (for the queen bee, see Figure 16A - 16C (data not shown), for the drones see Figure 17A - 17B(Data not shown). The staple sequences designed in caDNAno were ordered commercially and folded using M13 phage scaffold DNA under the following conditions: drones in 6 mM MgCl2, (90 °C / 2 min, 60 - 50 °C / 18 h); queens in 8 mM MgCl2, ({(94 °C - 86 °C) at a gradient of 4 °C / 5 min}; {(85 °C - 70 °C) at a gradient of 1 °C / 5 min}; {(70 °C - 40 °C) at a gradient of 1 °C / 15 min}; {(40 °C - 25 °C) at a gradient of 1 °C / 10 min}). The scaffold for the lattice queen consists of 8634 bases from the M13 phage genome, and the staple DNA sequences were determined by caDNAno. The binding sequences for the drones were manually attached to the 3’ end of the staple DNA to bind the drones in the desired orientation. 250 nm and 440 nm 6hb drones were also designed in caDNAno. The scaffold DNA consists of 8064 bases from the M13 phage genome (for 440 nm drones), or a custom 3825 base sequence derived from M13 phage (for 250 nm drones). The staple DNA sequences were determined by caDNAno and purchased commercially. The scaffold portions for the socket and plug sequences were customized to determine the orientation and final position of the sub-assemblies in the assembled structure. The 5’ ends of the staple sub-group were truncated to free the scaffold so that it could act as a socket for binding the plug. The 3’ ends of the staples of another sub-group were attached to the plug DNA sequences so that they could interact with other worker sub-assemblies.

[0172] The folded structures were separated from the excess folded staples using agarose gel electrophoresis, and the bands containing the structures of interest were purified from the agarose gel matrix. The purified structures were placed on carbon grids, stained with 2% uranyl formate, and analyzed by TEM to verify the assemblies with the correct structures (for queens see Figure 16C , for drones see Figure 17B ).

[0173] The purified sub-assemblies were assembled into a cross-construct using the following conditions: 0.1 or 0.01 nM queens, 1 nM drones, 30 mM MgCl2, 45 mM Tris-borate, 1 mM EDTA, and 0.01% Tween-20; incubated at 50 °C for 8 - 24 h. The assembled reactants were analyzed using gel electrophoresis and TEM, as shown in Figure 19A - 19D . The kinetics of the binding between drones and queens are shown in Figure 20 .

[0174] Example 5

[0175] A similar system was constructed using single-stranded DNA (ssDNA) instead of the 6-helix bundle, called "cross DNA slats" (abbreviation: "DNA slats"). The schematic diagram of the basic unit is shown in Figure 21A - 21B In. Figure 21A - 21B Each DNA slat shown in is an oligonucleotide 21 nucleotides (nt) long, allowing the formation of a 4×4 DNA slat array to maintain the correct 10.5 bases / turn. The length of the DNA slat can be extended by repeating 21 nt, for example, to obtain a larger structure. Figure 21A An abstract form of the DNA slat architecture and a matrix are shown, with the number of base pairs (bp) at each binding site at each position. The alternation of 6 bp and 5 bp is used to maintain the correct helicity and approximately the same binding energy of each DNA slat. An exemplary DNA slat strand with 16 binding sites (84 nt) is shown below:

[0176] TGGTTCTGGAGTTTTACTCGGGACACTTCAGCGTAATATCGGAAGCAGGCACTTTGAAACCTATAAGTCCTGACTATTAATAAC (SEQ ID NO:684).

[0177] Figure 21B 3D renderings of the front and cross-section from the DNA slat architecture are shown. Multiple strands travel intertwined above and below each other. The DNA slats can reliably cover the ssDNA overhangs (from the M13 scaffold) of different DNA-origami queens. Figure 23A - 24B Examples of the ssDNA scaffolds covered after adding the DNA slats are shown. Figure 23A The flat DNA-origami queen shown in is folded using 6 mM MgCl2 through a 2-minute 90°C denaturation period, followed by an 18-hour gradient from 55°C to 50°C. Figure 24A The cylindrical DNA-origami queen shown in is folded using 8 mM MgCl2 through a 15-minute 80°C denaturation period, followed by an 18-hour gradient from 60°C to 25°C. The assembly process of the DNA slats with the queen is shown in Figure 22 In. Once the queen is folded, the crude queen reactant is mixed with the DNA slats, and the assembly conditions can be adjusted by changing the concentration of the DNA slats (100 nM–1000 nM), the concentration of the salt (5 mM–30 mM MgCl2 and 0–1 M NaCl), and the assembly temperature (4°C–55°C). By changing the assembly conditions such as the MgCl2 and DNA slat concentrations, the kinetics of the assembly process can be affected.

[0178] Example 6

[0179] This example shows how to extend DNA slats to create more binding sites to facilitate polymerization on the queen bee. Figure 25 Both flat and cylindrical queen bees that are first covered are shown (as Figure 23A - 23B and Figure 24A - 24B shown), where the extended DNA slats that seed the next generation of DNA slats bind and ultimately grow into micron-sized structures. The queen bee nucleation sites determine the shape of the structures that grow subsequently. Figure 26A and 26B show flat queen bees assembled with two types of end extensions. Figure 26C - 26E Show flat queen bees with one, two, and three domain extensions. Samples shown in Figure 26A - 26E were prepared by reacting crude flat queen bee reactants (∼1 nM), DNA slats (1000 nM / strand), and 15 mM MgCl2 at 50 °C for 2 hours. Figure 30A - 30B Show the staggered design of DNA slats that bind to flat queen bees and grow into ribbon-like lamellae. The formation of subsequent ribbons is shown in Figure 31 . Control reactions without flat queen bees showed no assembly of DNA slats after reacting for 18 hours. Samples in Figure 31 were prepared by reacting crude flat queen bee reactants (∼9 nM), DNA slats (7500 nM / strand), and 14 mM MgCl2 at 50 °C for ∼66 hours.

[0180] Example 7

[0181] By using cylindrical DNA-origami queen bees, a multi-guest catenane system can be produced in a one-pot reaction. Figure 27A - 27C Show that by folding the cylindrical queen bee, a multi-guest catenane system can be obtained by adding DNA slats. To connect multiple rings, two DNA slats are required. A close-up view of the DNA slats that interweave and connect the ssDNA M13 scaffold rings is shown in Figure 27C . By connecting two DNA slats at one end, a single DNA slat that captures all 8 rings is created. A 3D rendering of the purple DNA slat that captures 8 rings is shown in Figure 27D . Figure 24 shows that by adding 64 slats, only the slats can be reduced, depending on the size and number of guest rings. Using the cylindrical queen bee together with DNA slats achieved a high yield in a one-pot reaction. The cylindrical queen bee can subsequently be converted into a ultrasensitive biosensor by coupling a biomolecule detection system to the DNA slats (see, for example, Figure 31 ). By integrating the verification step, the presence of an analyte can be converted into the open or closed state of the purple DNA slat. Figure 28A - 28BIt is shown that in the absence of biomolecules, the queen separates (open DNA sheets) and no nucleation-mediated growth of the DNA sheets occurs. However, the presence of biomolecules keeps the DNA sheets intact and holds the queen structure together, which can then trigger the growth of micrometer-sized tubes, which can then be detected using low-cost optical instruments, for example.

[0182] Table 1. Exemplary queen bee staple sequences

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198]

[0199]

[0200]

[0201] Table 2. Exemplary 250 nm 6-helix bundle sequences

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

[0208]

[0209]

[0210] Table 3. Exemplary 440 nm 6-Helix Bundle

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221] All references, patents, and patent applications disclosed herein are incorporated by reference in their entirety for the subject matter of each cited reference, in some cases covering the entire content of such documents.

[0222] The indefinite articles "a" and "an", as used herein in the specification and in the claims, shall be understood to mean "at least one" unless clearly indicated to the contrary.

[0223] It should also be understood that, unless clearly indicated to the contrary, in any method claimed herein that includes more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order of the steps or acts recited in the method.

[0224] In the claims and in the specification above, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "owning," "consisting of," and the like are to be understood to be open-ended, i.e., intended to include but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as set forth in Section 2111.03 of the Patent Examination Procedure Manual of the United States Patent and Trademark Office.

[0225] In summary, the present invention provides the following embodiments:

[0226] 1. A composition comprising:

[0227] (a) a nucleated nucleic acid nanostructure;

[0228] (b) a first layer of parallel elongated nucleic acid nanostructures stably bound to the nucleated nanostructure of (a); and

[0229] (c) a second layer of parallel elongated nucleic acid nanostructures stably bound to the elongated nanostructure of (b) and rotationally angled relative to the parallel elongated nanostructures of (b), wherein a single elongated nanostructure of (b) binds to multiple elongated nanostructures of (c) via a single cooperative binding site.

[0230] 2. The composition of embodiment 1, further comprising (d) a third layer of parallel elongated nanostructures stably bound to the elongated nanostructure of (c) and rotationally angled relative to the parallel elongated nanostructures of (c).

[0231] 3. The composition of embodiment 1 or 2, wherein the second layer is rotated 10° - 170° relative to the first layer.

[0232] 4. The composition of embodiment 3, wherein the second layer is rotated 90° relative to the first layer.

[0233] 5. The composition of any one of embodiments 1 - 4, wherein the third layer is rotated 10° - 170° relative to the second layer.

[0234] 6. The composition of embodiment 5, wherein the third layer is rotated 90°.

[0235] 7. The composition of any one of embodiments 1 - 6, wherein the third layer is parallel to the first layer.

[0236] 8. The composition of any one of embodiments 1 - 7, wherein the nucleic acid of (a) is DNA.

[0237] 9. The composition according to any one of embodiments 1-8, wherein the nucleic acid of (b) and / or (c) is DNA.

[0238] 10. The composition according to embodiment 8 or 9, wherein the nanostructure of (a), (b) and / or (c) comprises a nucleic acid scaffold strand, and the nucleic acid scaffold strand binds to a plurality of nucleic acid staple strands shorter than the nucleic acid scaffold strand.

[0239] 11. The composition according to embodiment 10, wherein the length of the nucleic acid scaffold strand is greater than 1000 bases, and the length of each nucleic acid staple strand is less than 200 nucleotides.

[0240] 12. The composition according to any one of embodiments 8-11, wherein the nucleating nanostructure of (b) and / or (c) comprises DNA nanorods.

[0241] 13. The composition according to any one of embodiments 8-12, wherein the nucleating nanostructure of (b) and / or (c) comprises DNA slats.

[0242] 14. A method, comprising:

[0243] Mixing the following in a reaction buffer:

[0244] (a) A nucleating nucleic acid nanostructure;

[0245] (b) A first subgroup of elongated nucleic acid nanostructures that stably bind to the nucleating nanostructure of (a); and

[0246] (c) A second subgroup of elongated nucleic acid nanostructures that stably bind to the elongated nanostructure of (b); and

[0247] Incubating the reaction buffer containing (a), (b) and (c) under conditions that produce the following results: (i) the elongated nanostructures of (b) stably bind to the nucleating nanostructure of (a) to form a first layer of parallel elongated nanostructures, and (ii) the elongated nanostructures of (c) bind to the elongated nanostructures of the first layer to form a second layer of parallel elongated nanostructures, and the second layer of parallel elongated nanostructures is rotationally angled with respect to the first layer, wherein a single elongated nanostructure of (b) binds to a plurality of elongated nanostructures of (c) through a single cooperative binding site.

[0248] 15. The method according to embodiment 14, wherein the second layer is rotated 10°-170° with respect to the first layer.

[0249] 16. The method according to embodiment 15, wherein the second layer is rotated 90° relative to the first layer.

[0250] 17. The method according to any one of embodiments 14 - 16, wherein the nucleic acid of (a) is DNA.

[0251] 18. The method according to any one of embodiments 14 - 17, wherein the nucleic acid of (b) and / or (c) is DNA.

[0252] 19. The method according to embodiment 17 or 18, wherein the nanostructure of (a), (b) and / or (c) comprises a nucleic acid scaffold strand, which binds to a plurality of nucleic acid staple strands shorter than the nucleic acid scaffold strand.

[0253] 20. The method according to embodiment 19, wherein the length of the nucleic acid scaffold strand is greater than 1000 bases, and the length of each nucleic acid staple strand is less than 200 nucleotides.

[0254] 21. The method according to any one of embodiments 17 - 20, wherein the nucleated nanostructure of (b) and / or (c) comprises DNA nanorods.

[0255] 22. The method according to any one of embodiments 17 - 21, wherein the nucleated nanostructure of (b) and / or (c) comprises DNA slats.

[0256] 23. A cross - nucleic acid nanostructure, comprising:

[0257] A first nanorod, which comprises a first plug - in strand and a second plug - in strand;

[0258] A second nanorod, which comprises a third plug - in strand and a fourth plug - in strand, wherein the second nanorod is parallel to the first nanorod;

[0259] A third nanorod, which comprises a fifth plug - in strand complementary to and binding to the first plug - in strand and a sixth plug - in strand complementary to and binding to the second plug - in strand;

[0260] A fourth nanorod, which comprises a seventh plug - in strand complementary to and binding to the third plug - in strand and an eighth plug - in strand complementary to and binding to the fourth plug - in strand, wherein the third nanorod is parallel to the fourth nanorod.

[0261] 24. A cross - nucleic acid nanostructure, comprising:

[0262] (a) A first plurality of nanorods arranged parallel to each other; and

[0263] (b) A second plurality of nanorods arranged parallel to each other, wherein the first plurality of nanorods are bound and perpendicular to the second plurality of nanorods, and each individual nanorod of (b) is bound to each of the plurality of nanorods of (a) through a single cooperative binding site.

[0264] 25. The cross nucleic acid nanostructure according to embodiment 23 or 24, wherein each nanorod comprises DNA.

[0265] 26. The cross nucleic acid nanostructure according to embodiment 25, wherein each nanorod comprises a 6-helix DNA bundle.

[0266] 27. A cross nucleic acid slat, comprising:

[0267] (a) A first plurality of at least four nucleic acid strands arranged parallel to each other, each strand of the first plurality having a length of 15-30 nucleotides; and

[0268] (b) A second plurality of at least four nucleic acid strands arranged parallel to each other, each strand of the second plurality having a length of 15-30 nucleotides, wherein the at least four nucleic acid strands of the first plurality are bound and perpendicular to the at least four nucleic acid strands of the second plurality, a single nucleic acid strand of (b) is bound to each of the plurality of nucleic acid strands of (a) through a single cooperative binding site, and a single nucleic acid strand of (a) is bound to each of the plurality of nucleic acid strands of (b) through a single cooperative binding site.

[0269] 28. A nucleic acid nanostructure, comprising a nucleic acid scaffold strand folded into a plurality of stacked parallel loops, the plurality of stacked parallel loops being bound to at least one cross nucleic acid slat according to embodiment 27.

[0270] 29. A nucleic acid nanostructure, comprising a stack of parallel nucleic acid loops bound to a plurality of nucleic acid slats according to embodiment 27.

[0271] 30. A method for preparing a cross nucleic acid nanostructure, comprising:

[0272] Mixing the following in a reaction mixture:

[0273] (a) A first nanorod, the first nanorod comprising a first plug strand and a second plug strand,

[0274] (b) A second nanorod, the second nanorod comprising a third plug strand and a fourth plug strand, wherein the second nanorod is parallel to the first nanorod;

[0275] (c) A third nanorod, the third nanorod comprising a fifth plug strand complementary to and bound to the first plug strand and a sixth plug strand complementary to and bound to the second plug strand; and

[0276] (d) A fourth nanorod, the fourth nanorod comprising a seventh plug chain complementary to and bound to the third plug chain and an eighth plug chain complementary to and bound to the fourth plug chain, wherein the third nanorod is parallel to the fourth nanorod; and

[0277] Incubate the reaction mixture under conditions that produce an assembly of cross-linked nucleic acid nanostructures.

[0278] 31. A method for detecting a biomolecule, comprising:

[0279] (a) Mixing the following in a reaction mixture:

[0280] (i) A sample containing a biomolecule;

[0281] (ii) Nucleic acid strands capable of self-assembling into nanostructures comprising stacked parallel strands;

[0282] (iii) At least two of the cross-linked nucleic acid slats of embodiment 27, wherein two slats are bound to the stacked parallel strands of (ii), and wherein at least two of the slats are linked to a biomolecule binding partner that specifically binds the biomolecule in the sample;

[0283] (b) Incubating the reaction mixture under conditions that allow the biomolecule binding partner to bind to the biomolecule and the nanostructures to assemble into stacked parallel strands; and

[0284] (c) Incubating the reaction mixture of (b) in the presence of a plurality of the cross-linked nucleic acid slats of embodiment 27, wherein the cross-linked nucleic acid slats bind to the stacked parallel strands to form a stable three-dimensional nanostructure.

[0285] 32. The method of embodiment 31, further comprising imaging the three-dimensional nanostructure.

[0286] 33. A method for detecting a biomolecule, comprising:

[0287] Mixing the following in a reaction mixture:

[0288] (a) A sample containing a biomolecule, and

[0289] (b) A nucleic acid nanostructure, the nucleic acid nanostructure comprising: (i) a nucleic acid scaffold strand and nucleic acid staple strands capable of assembling into a plurality of stacked parallel loops and (ii) two of the cross-linked nucleic acid slats of embodiment 27 programmed to bind to the loops of (i),

[0290] A biomolecular binding partner that specifically binds to the biomolecule is linked to each of the cross nucleic acid strips such that, in the presence of the biomolecule, the biomolecular binding partner binds to the biomolecule and the nucleic acid nanostructure folds into a plurality of stacked parallel loops; and

[0291] Incubate the reaction mixture to assemble a plurality of stacked parallel loops.

[0292] 34. The method of embodiment 33, further comprising mixing the reaction mixture with a plurality of cross nucleic acid strips of embodiment 27 to form a three-dimensional nanostructure.

Claims

1. A method for preparing a cross nucleic acid nanostructure, comprising: Mixing the following in a reaction mixture: (a) A first nanorod, the first nanorod comprising a first plug chain and a second plug chain, (b) A second nanorod, the second nanorod comprising a third plug chain and a fourth plug chain, wherein the second nanorod is parallel to the first nanorod; (c) A third nanorod, the third nanorod comprising a fifth plug chain complementary to and binding to the first plug chain and a sixth plug chain complementary to and binding to the second plug chain; and (d) A fourth nanorod, the fourth nanorod comprising a seventh plug chain complementary to and binding to the third plug chain and an eighth plug chain complementary to and binding to the fourth plug chain, wherein the third nanorod is parallel to the fourth nanorod; and Incubating the reaction mixture under conditions to produce an assembly of the cross nucleic acid nanostructure.

2. A cross nucleic acid slat, comprising: (a) A first plurality of at least four nucleic acid chains parallel to each other, each chain of the first plurality having a length of at least 21 nucleotides; and (b) A second plurality of at least four nucleic acid chains parallel to each other, each chain of the second plurality having a length of at least 21 nucleotides, wherein the at least four nucleic acid chains of the first plurality bind to and are perpendicular to the at least four nucleic acid chains of the second plurality, a single nucleic acid chain of (b) binds to each of the multiple nucleic acid chains of (a) through a single cooperative binding site, and a single nucleic acid chain of (a) binds to each of the multiple nucleic acid chains of (b) through a single cooperative binding site.

3. A nanostructure, comprising the cross nucleic acid slat of claim 2.

4. The nanostructure according to claim 3, wherein the nanostructure is two-dimensional.

5. The nanostructure according to claim 4, wherein the nanostructure is three-dimensional.

6. A microstructure, comprising the cross nucleic acid slat of claim 2.

7. The microstructure according to claim 6, wherein the microstructure is two-dimensional.

8. The microstructure according to claim 7, wherein the microstructure is three-dimensional.

Images