Primer set and method for detecting blood tumor fusion gene

Abstract

The present invention discloses a primer set and method for detecting blood tumor fusion genes. In the present invention, for 62 pairs of blood tumor fusion genes, a specific primer set for target gene amplification is designed and screened, and by optimizing the concentration of primers in the multiplex PCR amplification system and the conditions for library construction, sequencing is performed based on the IonGeneStudioS5Plus high-throughput sequencing platform, and a method for detecting blood tumor fusion genes is established. The detection coverage is wide, and multiple gene fusions can be detected at the same time, and the detected fusion types can distinguish subtypes, thereby improving the accuracy of diagnosis and treatment.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and more specifically, to a primer set, a kit and a method for detecting blood tumor fusion genes. Background Art

[0002] Since the first fusion gene BCR-ABL1 was discovered in chronic myeloid leukemia (CML) in 1960, the types of fusion genes have continued to increase, especially with the widespread application of second-generation sequencing in the past decade, new fusion genes have been discovered. It is currently known that more than 95% of CML patients have BCR-ABL1 fusion genes, more than 90% of APL patients have other RARA fusion genes such as PML-RARA and ZBTB16-RARA, more than 35% of AML patients have RUNX1-RUNXT1, CBFB-MYH11 and other fusion genes, more than 50% of ALL patients have ETV6-RUNX1, BCR-ABL1 and other fusion genes, more than 80% of follicular lymphoma patients have BCL2-IGH fusion genes, etc. Many fusion genes have been found in various types of blood tumors. Fusion genes play an important role in the diagnosis, prognosis, stratification and treatment of blood tumors.

[0003] Hematological malignancies are a class of diseases with high heterogeneity, and their diagnosis and treatment require a comprehensive analysis combining morphology, immunology, genetics, and molecular biology. Currently, the gold standard for detecting fusion genes in hematological malignancies is cytogenetic karyotype analysis and FISH testing. However, the limitations of cytogenetic testing include the inability to distinguish fusion subtypes, low throughput, and the inability to identify gene microdeletions or gene fusions involving smaller fragments. There are still cases where patients are not accurately stratified and suffer from overtreatment or undertreatment. Therefore, molecular-level diagnosis is the key to further improving the clinical cure rate for patients with hematological malignancies, as it can improve the accuracy of diagnosis and treatment through genotyping testing, and then achieve accurate prognostic stratification.

[0004] In addition, the fluorescence in situ hybridization (FISH) technology can only detect single genes or single pairs of genes when detecting fusion genes, and the detection efficiency is low. Moreover, the importance of fusion typing for clinical treatment selection and prognosis judgment is becoming increasingly prominent. Karyotype analysis and FISH testing, the "gold standard" for fusion gene detection, cannot distinguish fusion subtypes, and RT-PCR can detect common fusion types but can only distinguish major subtypes. Karyotype analysis and FISH testing have high technical requirements and rely on manual interpretation of results.

[0005] Therefore, it is very necessary to provide a method that can efficiently and accurately classify the fusion subtypes of blood tumor fusion genes. Summary of the invention

[0006] Based on this, the object of the present invention is to provide a primer set, a kit and a method for detecting blood tumor fusion genes.

[0007] The technical solutions for achieving the above-mentioned invention objectives include the following.

[0008] The first aspect of the present invention provides a primer set for detecting a blood tumor fusion gene, comprising:

[0009] The forward primer for detecting the B1J19 subtype of the fusion gene BCR-JAK2 is shown in SEQ ID NO.1 and the reverse primer is shown in SEQ ID NO.2;

[0010] The forward primer whose sequence is shown in SEQ ID NO.3 and the reverse primer whose sequence is shown in SEQ ID NO.4 for detecting the E5J12 subtype of the fusion gene ETV6-JAK2;

[0011] The forward primer whose sequence is shown in SEQ ID NO.3 and the reverse primer whose sequence is shown in SEQ ID NO.2 for detecting the E5J19 subtype of the fusion gene ETV6-JAK2;

[0012] The forward primer for detecting the E4J17 subtype of the fusion gene ETV6-JAK2 is shown in SEQ ID NO.5 and the reverse primer is shown in SEQ ID NO.6;

[0013] The forward primer whose sequence is shown in SEQ ID NO.7 and the reverse primer whose sequence is shown in SEQ ID NO.8 for detecting the F6E11 subtype and F7E11 subtype of the fusion gene FUS-ERG;

[0014] The forward primer whose sequence is shown as SEQ ID NO.9 and the reverse primer whose sequence is shown as SEQ ID NO.10 for detecting the F8E9 subtype of the fusion gene FUS-ERG;

[0015] The forward primer for detecting the P5J19 subtype of the fusion gene PAX5-JAK2 is shown in SEQ ID NO.11 and the reverse primer is shown in SEQ ID NO.2;

[0016] The forward primer for detecting the S4J11 subtype of the fusion gene SSBP2-JAK2 is shown in SEQ ID NO.12 and the reverse primer is shown in SEQ ID NO.13;

[0017] The forward primer for detecting the S5J11 subtype of the fusion gene SSBP2-JAK2 is shown in SEQ ID NO.14 and the reverse primer is shown in SEQ ID NO.13;

[0018] The forward primer for detecting the T16P3 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.15 and the reverse primer is shown in SEQ ID NO.16;

[0019] The forward primer whose sequence is shown in SEQ ID NO.17 and the reverse primer whose sequence is shown in SEQ ID NO.6 for detecting the B1J17 subtype of the fusion gene BCR-JAK2;

[0020] The forward primer for detecting the B13J11 subtype of the fusion gene BCR-JAK2 is shown in SEQ ID NO.18 and the reverse primer is shown in SEQ ID NO.13;

[0021] The forward primer for detecting the E4J16 subtype of the fusion gene ETV6-JAK2 is shown in SEQ ID NO.5 and the reverse primer is shown in SEQ ID NO.19;

[0022] The forward primer whose sequence is shown in SEQ ID NO.20 and the reverse primer whose sequence is shown in SEQ ID NO.21 for detecting the F5E8 subtype of the fusion gene FUS-ERG;

[0023] The forward primer whose sequence is shown in SEQ ID NO.7 and the reverse primer whose sequence is shown in SEQ ID NO.8 for detecting the F6E11 subtype of the fusion gene FUS-ERG;

[0024] The forward primer whose sequence is shown as SEQ ID NO.7 and the reverse primer whose sequence is shown as SEQ ID NO.10 for detecting the F7E10 subtype of the fusion gene FUS-ERG;

[0025] The forward primer whose sequence is shown as SEQ ID NO.7 and the reverse primer whose sequence is shown as SEQ ID NO.21 for detecting the F7E8 subtype of the fusion gene FUS-ERG;

[0026] The forward primer for detecting the S3J11 subtype of the fusion gene SSBP2-JAK2 is shown in SEQ ID NO.22 and the reverse primer is shown in SEQ ID NO.13;

[0027] The forward primer whose sequence is shown in SEQ ID NO.18 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B13A3 subtype of the fusion gene BCR-ABL1;

[0028] A forward primer having a sequence as shown in SEQ ID NO.24 and a reverse primer having a sequence as shown in SEQ ID NO.23 for detecting the B14A3 subtype of the fusion gene BCR-ABL1;

[0029] The forward primer whose sequence is shown in SEQ ID NO.25 and the reverse primer whose sequence is shown in SEQ ID NO.26 for detecting the B18A2 subtype of the fusion gene BCR-ABL1;

[0030] The forward primer whose sequence is shown in SEQ ID NO.25 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B18A3 subtype of the fusion gene BCR-ABL1;

[0031] The forward primer for detecting the B19A2 subtype of the fusion gene BCR-ABL1 is shown in SEQ ID NO.27 and the reverse primer is shown in SEQ ID NO.26;

[0032] The forward primer whose sequence is shown in SEQ ID NO.27 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B19A3 subtype of the fusion gene BCR-ABL1;

[0033] The forward primer whose sequence is shown in SEQ ID NO.17 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B1A3 subtype of the fusion gene BCR-ABL1;

[0034] The forward primer for detecting the B6A2 subtype of the fusion gene BCR-ABL1 is shown in SEQ ID NO.28 and the reverse primer is shown in SEQ ID NO.26;

[0035] The forward primer whose sequence is shown in SEQ ID NO.28 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B6A3 subtype of the fusion gene BCR-ABL1;

[0036] The forward primer for detecting the B8A2 subtype of the fusion gene BCR-ABL1 is shown in SEQ ID NO.29 and the reverse primer is shown in SEQ ID NO.26;

[0037] The forward primer whose sequence is shown in SEQ ID NO.29 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B8A3 subtype of the fusion gene BCR-ABL1;

[0038] The forward primer for detecting the B13J11 subtype of the fusion gene BCR-JAK2 is shown in SEQ ID NO.18 and the reverse primer is shown in SEQ ID NO.13;

[0039] The forward primer for detecting the B13J19 subtype of the fusion gene BCR-JAK2 is shown in SEQ ID NO.18 and the reverse primer is shown in SEQ ID NO.2;

[0040] The forward primer whose sequence is shown in SEQ ID NO.17 and the reverse primer whose sequence is shown in SEQ ID NO.13 for detecting the B1J11 subtype of the fusion gene BCR-JAK2;

[0041] The forward primer for detecting the B12P12 subtype of the fusion gene BCR-PDGFRA is shown in SEQ ID NO.30 and the reverse primer is shown in SEQ ID NO.31;

[0042] The forward primer for detecting the B7P12 subtype of the fusion gene BCR-PDGFRA is shown in SEQ ID NO.28 and the reverse primer is shown in SEQ ID NO.31;

[0043] The forward primer for detecting the C4M28 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.32 and the reverse primer is shown in SEQ ID NO.33;

[0044] The forward primer for detecting the C13P12 subtype of the fusion gene CDK5RAP2-PDGFRA has a sequence as shown in SEQ ID NO.34 and a reverse primer as shown in SEQ ID NO.31;

[0045] The forward primer for detecting the E4A2 subtype of the fusion gene ETV6-ABL1 is shown in SEQ ID NO.5 and the reverse primer is shown in SEQ ID NO.26;

[0046] The forward primer whose sequence is shown as SEQ ID NO.3 and the reverse primer whose sequence is shown as SEQ ID NO.26 for detecting the E5A2 subtype of the fusion gene ETV6-ABL1;

[0047] The forward primer whose sequence is shown in SEQ ID NO.5 and the reverse primer whose sequence is shown in SEQ ID NO.4 for detecting the E4J12 subtype of the fusion gene ETV6-JAK2;

[0048] The forward primer for detecting the E4J19 subtype of the fusion gene ETV6-JAK2 has a sequence as shown in SEQ ID NO.5 and a reverse primer with a sequence as shown in SEQ ID NO.2;

[0049] The forward primer whose sequence is shown in SEQ ID NO.3 and the reverse primer whose sequence is shown in SEQ ID NO.6 for detecting the E5J17 subtype of the fusion gene ETV6-JAK2;

[0050] The forward primer for detecting the E6P12 subtype of the fusion gene ETV6-PDGFRA is shown in SEQ ID NO.35 and the reverse primer is shown in SEQ ID NO.31;

[0051] The forward primer for detecting the E4P10 subtype of the fusion gene ETV6-PDGFRA has a sequence as shown in SEQ ID NO.5 and a reverse primer has a sequence as shown in SEQ ID NO.36;

[0052] The forward primer for detecting the E4P11 subtype of the fusion gene ETV6-PDGFRA has a sequence as shown in SEQ ID NO.5 and a reverse primer has a sequence as shown in SEQ ID NO.37;

[0053] The forward primer for detecting the E7P10 subtype of the fusion gene ETV6-PDGFRA has a sequence as shown in SEQ ID NO.38 and a reverse primer has a sequence as shown in SEQ ID NO.36;

[0054] The forward primer for detecting the E7P11 subtype of the fusion gene ETV6-PDGFRA has a sequence as shown in SEQ ID NO.38 and a reverse primer has a sequence as shown in SEQ ID NO.37;

[0055] The forward primer for detecting the F12P13 subtype of the fusion gene FIP1L1-PDGFRA has a sequence as shown in SEQ ID NO.39 and a reverse primer has a sequence as shown in SEQ ID NO.40;

[0056] The forward primer for detecting the F15R3 subtype of the fusion gene FIP1L1-RARA is shown in SEQ ID NO.41 and the reverse primer is shown in SEQ ID NO.42;

[0057] The forward primer whose sequence is shown in SEQ ID NO.9 and the reverse primer whose sequence is shown in SEQ ID NO.8 for detecting the F8E11 subtype of the fusion gene FUS-ERG;

[0058] The forward primer for detecting the K23P12 subtype of the fusion gene KIF5B-PDGFRA has a sequence as shown in SEQ ID NO.43 and a reverse primer has a sequence as shown in SEQ ID NO.31;

[0059] The forward primer for detecting the M8A4 subtype of the fusion gene MLL-AFF1 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.45;

[0060] The forward primer for detecting the M8A5 subtype of the fusion gene MLL-AFF4 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.46;

[0061] The forward primer for detecting the M8A6 subtype of the fusion gene MLL-AFF4 has a sequence as shown in SEQ ID NO.44 and a reverse primer as shown in SEQ ID NO.47;

[0062] The forward primer for detecting the M9A5 subtype of the fusion gene MLL-AFF4 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.46;

[0063] The forward primer for detecting the M9A6 subtype of the fusion gene MLL-AFF4 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.47;

[0064] The forward primer for detecting the M7E2 subtype of the fusion gene MLL-ELL is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.50;

[0065] The forward primer for detecting the M10E12 subtype of the fusion gene MLL-EPS15 is shown in SEQ ID NO.51 and the reverse primer is shown in SEQ ID NO.52;

[0066] The forward primer for detecting the M8M2 subtype of the fusion gene MLL-MLLT1 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.53;

[0067] The forward primer whose sequence is shown in SEQ ID NO.44 and the reverse primer whose sequence is shown in SEQ ID NO.54 for detecting the M8M4 subtype of the fusion gene MLL-MLLT1;

[0068] The forward primer for detecting the M8M6 subtype of the fusion gene MLL-MLLT1 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.55;

[0069] The forward primer for detecting the M8M7 subtype of the fusion gene MLL-MLLT1 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.56;

[0070] The forward primer for detecting the M8M9 subtype of the fusion gene MLL-MLLT10 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.57;

[0071] The forward primer for detecting the M8M2 subtype of the fusion gene MLL-MLLT11 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.58;

[0072] The forward primer for detecting the M9M2 subtype of the fusion gene MLL-MLLT11 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.58;

[0073] The forward primer whose sequence is shown in SEQ ID NO.49 and the reverse primer whose sequence is shown in SEQ ID NO.59 for detecting the M7M6 subtype of the fusion gene MLL-MLLT3;

[0074] The forward primer for detecting the M8M6 subtype of the fusion gene MLL-MLLT3 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.59;

[0075] The forward primer for detecting the M8M7 subtype of the fusion gene MLL-MLLT3 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.60;

[0076] The forward primer for detecting the M9M6 subtype of the fusion gene MLL-MLLT3 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.59;

[0077] The forward primer for detecting the M9M7 subtype of the fusion gene MLL-MLLT3 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.60;

[0078] The forward primer for detecting the M7M2 subtype of the fusion gene MLL-MLLT4 is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.61;

[0079] The forward primer for detecting the M8M2 subtype of the fusion gene MLL-MLLT4 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.61;

[0080] The forward primer for detecting the M9M2 subtype of the fusion gene MLL-MLLT4 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.61;

[0081] The forward primer for detecting the M7M11 subtype of the fusion gene MLL-MLLT6 is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.62;

[0082] The forward primer for detecting the M9M11 subtype of the fusion gene MLL-MLLT6 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.62;

[0083] The forward primer for detecting the M7S2 subtype of the fusion gene MLL-SEPT6 is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.63;

[0084] The forward primer whose sequence is shown in SEQ ID NO.64 and the reverse primer whose sequence is shown in SEQ ID NO.65 for detecting the N6M2 subtype of the fusion gene NPM1-MLF1;

[0085] The forward primer for detecting the N3R3 subtype of the fusion gene NPM1-RARA is shown in SEQ ID NO.66 and the reverse primer is shown in SEQ ID NO.42;

[0086] The forward primer for detecting the N22R3 subtype of the fusion gene NUMA-RARA is shown in SEQ ID NO.67 and the reverse primer is shown in SEQ ID NO.42;

[0087] The forward primer for detecting the N23A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.68 and the reverse primer is shown in SEQ ID NO.26;

[0088] The forward primer for detecting the N29A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.69 and the reverse primer is shown in SEQ ID NO.26;

[0089] The forward primer for detecting the N31A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.70 and the reverse primer is shown in SEQ ID NO.26;

[0090] The forward primer for detecting the N32A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.71 and the reverse primer is shown in SEQ ID NO.26;

[0091] The forward primer for detecting the N34A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.72 and the reverse primer is shown in SEQ ID NO.26;

[0092] The forward primer for detecting the N12H2 subtype of the fusion gene NUP98-HOXA11 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.74;

[0093] The forward primer for detecting the N11H2 subtype of the fusion gene NUP98-HOXA13 has a sequence as shown in SEQ ID NO.75 and a reverse primer has a sequence as shown in SEQ ID NO.76;

[0094] The forward primer for detecting the N12H2 subtype of the fusion gene NUP98-HOXA13 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.76;

[0095] The forward primer for detecting the N11H2 subtype of the fusion gene NUP98-HOXA9 has a sequence as shown in SEQ ID NO.75 and a reverse primer has a sequence as shown in SEQ ID NO.77;

[0096] The forward primer for detecting the N12H2 subtype of the fusion gene NUP98-HOXC11 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.78;

[0097] The forward primer for detecting the N12H2 subtype of the fusion gene NUP98-HOXD13 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.79;

[0098] The forward primer for detecting the N11M15 subtype of the fusion gene NUP98-MLLT10 has a sequence as shown in SEQ ID NO.75 and a reverse primer as shown in SEQ ID NO.80;

[0099] The forward primer for detecting the N12P2 subtype of the fusion gene NUP98-PRRX1 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.81;

[0100] The forward primer whose sequence is shown in SEQ ID NO.82 and the reverse primer whose sequence is shown in SEQ ID NO.83 for detecting the P17M10 subtype of the fusion gene PICALM-MLLT10;

[0101] The forward primer whose sequence is shown in SEQ ID NO.82 and the reverse primer whose sequence is shown in SEQ ID NO.84 for detecting the P17M4 subtype of the fusion gene PICALM-MLLT10;

[0102] The forward primer for detecting the P17M9 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.82 and the reverse primer is shown in SEQ ID NO.57;

[0103] The forward primer for detecting the P18M10 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.85 and the reverse primer is shown in SEQ ID NO.83;

[0104] The forward primer whose sequence is shown in SEQ ID NO.85 and the reverse primer whose sequence is shown in SEQ ID NO.84 for detecting the P18M4 subtype of the fusion gene PICALM-MLLT10;

[0105] The forward primer for detecting the P18M9 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.85 and the reverse primer is shown in SEQ ID NO.57;

[0106] The forward primer for detecting the P19M10 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.86 and the reverse primer is shown in SEQ ID NO.83;

[0107] The forward primer for detecting the P19M4 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.86 and the reverse primer is shown in SEQ ID NO.84;

[0108] The forward primer for detecting the P19M9 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.86 and the reverse primer is shown in SEQ ID NO.57;

[0109] The forward primer for detecting the P5R3 subtype of the fusion gene PML-RARA is shown in SEQ ID NO.87 and the reverse primer is shown in SEQ ID NO.42;

[0110] The forward primer for detecting the P2R3 subtype of the fusion gene PRKAR1A-RARA is shown in SEQ ID NO.88 and the reverse primer is shown in SEQ ID NO.42;

[0111] The forward primer whose sequence is shown in SEQ ID NO.89 and the reverse primer whose sequence is shown in SEQ ID NO.90 for detecting the R2A4 subtype of the fusion gene RCSD1-ABL1;

[0112] The forward primer whose sequence is shown in SEQ ID NO.91 and the reverse primer whose sequence is shown in SEQ ID NO.90 for detecting the R3A4 subtype of the fusion gene RCSD1-ABL1;

[0113] The forward primer for detecting the R3C2 subtype of the fusion gene RUNX1-CBFA2T3 is shown in SEQ ID NO.92 and the reverse primer is shown in SEQ ID NO.93;

[0114] The forward primer whose sequence is shown in SEQ ID NO.92 and the reverse primer whose sequence is shown in SEQ ID NO.94 for detecting the R3C4 subtype of the fusion gene RUNX1-CBFA2T3;

[0115] The forward primer for detecting the R3M2 subtype of the fusion gene RUNX1-MECOM is shown in SEQ ID NO.92 and the reverse primer is shown in SEQ ID NO.95;

[0116] The forward primer for detecting the R3R2 subtype of the fusion gene RUNX1-RPL22 is shown in SEQ ID NO.92 and the reverse primer is shown in SEQ ID NO.96;

[0117] The forward primer for detecting the R3R3 subtype of the fusion gene RUNX1-RUNX1T1 is shown in SEQ ID NO.92 and the reverse primer is shown in SEQ ID NO.97;

[0118] The forward primer for detecting the S7N18 subtype of the fusion gene SET-NUP214 is shown in SEQ ID NO.98 and the reverse primer is shown in SEQ ID NO.99;

[0119] The forward primer for detecting the S3A4 subtype of the fusion gene SNX2-ABL1 is shown in SEQ ID NO.100 and the reverse primer is shown in SEQ ID NO.90;

[0120] The forward primer for detecting the S15R3 subtype of the fusion gene STAT5B-RARA is shown in SEQ ID NO.101 and the reverse primer is shown in SEQ ID NO.42;

[0121] The forward primer whose sequence is shown in SEQ ID NO.102 and the reverse primer whose sequence is shown in SEQ ID NO.103 for detecting the S1T2 subtype of the fusion gene STIL-TAL1;

[0122] The forward primer for detecting the S6P12 subtype of the fusion gene STRN-PDGFRA is shown in SEQ ID NO.104 and the reverse primer is shown in SEQ ID NO.31;

[0123] The forward primer whose sequence is shown in SEQ ID NO.105 and the reverse primer whose sequence is shown in SEQ ID NO.106 for detecting the T15H4 subtype of the fusion gene TCF3-HLF;

[0124] The forward primer whose sequence is shown in SEQ ID NO.15 and the reverse primer whose sequence is shown in SEQ ID NO.106 for detecting the T16H4 subtype of the fusion gene TCF3-HLF;

[0125] The forward primer for detecting the T16P5 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.15 and the reverse primer is shown in SEQ ID NO.107;

[0126] The forward primer for detecting the T17P3 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.108 and the reverse primer is shown in SEQ ID NO.16;

[0127] The forward primer for detecting the T17P5 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.108 and the reverse primer is shown in SEQ ID NO.107;

[0128] The forward primer for detecting the Z3R3 subtype of the fusion gene ZBTB16-RARA is shown in SEQ ID NO.109 and the reverse primer is shown in SEQ ID NO.42;

[0129] The forward primer for detecting the Z4R3 subtype of the fusion gene ZBTB16-RARA is shown in SEQ ID NO.110 and the reverse primer is shown in SEQ ID NO.42;

[0130] The forward primer for detecting the Z18A2 subtype of the fusion gene ZMIZ1-ABL1 is shown in SEQ ID NO.111 and the reverse primer is shown in SEQ ID NO.26;

[0131] The forward primer whose sequence is shown in SEQ ID NO.18 and the reverse primer whose sequence is shown in SEQ ID NO.26 for detecting the B13A2 subtype of the fusion gene BCR-ABL1;

[0132] The forward primer whose sequence is shown in SEQ ID NO.24 and the reverse primer whose sequence is shown in SEQ ID NO.26 for detecting the B14A2 subtype of the fusion gene BCR-ABL1;

[0133] The forward primer for detecting the B1A2 subtype of the fusion gene BCR-ABL1 is shown in SEQ ID NO.17 and the reverse primer is shown in SEQ ID NO.26;

[0134] The forward primer for detecting the C5M28 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.33;

[0135] The forward primer for detecting the C5M29 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.113;

[0136] The forward primer for detecting the C5M33 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.114;

[0137] The forward primer for detecting the D9C18 subtype of the fusion gene DEK-CAN_NUP214 is shown in SEQ ID NO.115 and the reverse primer is shown in SEQ ID NO.99;

[0138] The forward primer whose sequence is shown as SEQ ID NO.116 and the reverse primer whose sequence is shown as SEQ ID NO.42 for detecting the P3R3 subtype of the fusion gene PML-RARA;

[0139] The forward primer whose sequence is shown in SEQ ID NO.117 and the reverse primer whose sequence is shown in SEQ ID NO.42 for detecting the P6R3 subtype and P6R3.1 subtype of the fusion gene PML-RARA;

[0140] The forward primer for detecting the C5M12 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.118;

[0141] The forward primer for detecting the C5M8 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.119;

[0142] The forward primer for detecting the E5R2 subtype of the fusion gene ETV6-RUNX1 is shown in SEQ ID NO.3 and the reverse primer is shown in SEQ ID NO.120;

[0143] The forward primer whose sequence is shown in SEQ ID NO.51 and the reverse primer whose sequence is shown in SEQ ID NO.45 for detecting the M10A4 subtype of the fusion gene MLL-AFF1;

[0144] The forward primer for detecting the M9A5 subtype of the fusion gene MLL-AFF1 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.121;

[0145] The forward primer whose sequence is shown in SEQ ID NO.122 and the reverse primer whose sequence is shown in SEQ ID NO.42 for detecting the P6R3 subtype of the fusion gene PML-RARA;

[0146] The forward primer for detecting the T13P2 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.123 and the reverse primer is shown in SEQ ID NO.124;

[0147] The forward primer for detecting the E4N15 subtype of the fusion gene ETV6-NTRK3 is shown in SEQ ID NO.5 and the reverse primer is shown in SEQ ID NO.125;

[0148] The forward primer for detecting the E5N15 subtype of the fusion gene ETV6-NTRK3 is shown in SEQ ID NO.3 and the reverse primer is shown in SEQ ID NO.125;

[0149] The forward primer whose sequence is shown as SEQ ID NO.30 and the reverse primer whose sequence is shown as SEQ ID NO.26 for detecting the B12A2 subtype of the fusion gene BCR-ABL1;

[0150] The forward primer whose sequence is shown as SEQ ID NO.30 and the reverse primer whose sequence is shown as SEQ ID NO.23 for detecting the B12A3 subtype of the fusion gene BCR-ABL1;

[0151] A forward primer having a sequence as shown in SEQ ID NO.126 and a reverse primer having a sequence as shown in SEQ ID NO.26 for detecting the B20A2 subtype of the fusion gene BCR-ABL1;

[0152] The forward primer whose sequence is shown as SEQ ID NO.126 and the reverse primer whose sequence is shown as SEQ ID NO.23 for detecting the B20A3 subtype of the fusion gene BCR-ABL1;

[0153] The forward primer for detecting the C4M29 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.32 and the reverse primer is shown in SEQ ID NO.113;

[0154] The forward primer for detecting the C4M30 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.32 and the reverse primer is shown in SEQ ID NO.127;

[0155] The forward primer for detecting the C4M31 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.32 and the reverse primer is shown in SEQ ID NO.128;

[0156] The forward primer for detecting the C5M30 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.127;

[0157] The forward primer for detecting the C5M31 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.128;

[0158] The forward primer for detecting the D9N19 subtype of the fusion gene DEK-NUP214 is shown in SEQ ID NO.115 and the reverse primer is shown in SEQ ID NO.129;

[0159] The forward primer for detecting the E5R3 subtype of the fusion gene ETV6-RUNX1_AML1 is shown in SEQ ID NO.3 and the reverse primer is shown in SEQ ID NO.130;

[0160] The forward primer for detecting the M7F2 subtype of the fusion gene MLL_KMT2A-FOXO4 is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.131;

[0161] The forward primer for detecting the N4M4 subtype of the fusion gene NPM1-MLF1 is shown in SEQ ID NO.132 and the reverse primer is shown in SEQ ID NO.133;

[0162] The forward primer for detecting the N4R5 subtype of the fusion gene NPM1-RARA is shown in SEQ ID NO.132 and the reverse primer is shown in SEQ ID NO.134;

[0163] The forward primer for detecting the S1T1 subtype of the fusion gene STIL-TAL1 is shown in SEQ ID NO.102 and the reverse primer is shown in SEQ ID NO.135;

[0164] The forward primer for detecting the T14H4 subtype of the fusion gene TCF3-HLF is shown in SEQ ID NO.136 and the reverse primer is shown in SEQ ID NO.106;

[0165] The forward primer for detecting the Z4R5 subtype of the fusion gene ZBTB16-RARA is shown in SEQ ID NO.110 and the reverse primer is shown in SEQ ID NO.134;

[0166] The forward primer whose sequence is shown as SEQ ID NO.7 and the reverse primer whose sequence is shown as SEQ ID NO.10 for detecting the F6E9 subtype of the fusion gene FUS-ERG;

[0167] A forward primer having a sequence as shown in SEQ ID NO.137 and a reverse primer having a sequence as shown in SEQ ID NO.138 for detecting the M1E2 subtype of the fusion gene MNX1-ETV6; and,

[0168] The sequence of the forward primer for detecting the M1E3 subtype of the fusion gene MNX1-ETV6 is shown as SEQ ID NO.137 and the sequence of the reverse primer is shown as SEQ ID NO.139.

[0169] The second aspect of the present invention provides a kit for detecting blood tumor fusion genes, wherein the kit comprises the above-mentioned primer set for detecting blood tumor fusion genes.

[0170] The third aspect of the present invention provides a method for detecting blood tumor fusion genes, comprising the following steps: using the cDNA of the sample to be tested as a template, using the above-mentioned kit to perform PCR amplification of the blood tumor fusion gene, performing end repair on the amplified product, connecting a specific linker, and then performing library amplification, and sequencing the library on a machine.

[0171] In the present invention, specific primer sets for target gene amplification are designed and screened for 62 pairs of blood tumor fusion genes, and by optimizing the primer concentration in the multiplex PCR amplification system (so that the amplification uniformity of each pair of primers in the specific primer set reaches an ideal effect) and the library construction (based on the amplicon library construction method, one-step amplification of the targeted gene) conditions, sequencing is performed based on the Ion GeneStudioS5Plus high-throughput sequencing platform, and a method for detecting blood tumor fusion genes is established. The detection coverage is wide, and multiple gene fusions can be detected at the same time. The detected fusion types can distinguish subtypes, thereby improving the accuracy of diagnosis and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0172] Figure 1 The amplification results of different primer pairs in Experimental Example 1 of the present invention are shown.

[0173] Figure 2 This is the sequencing result using primer pair B in Experimental Example 1 of the present invention.

[0174] Figure 3 It is the library length of the test sample in Experimental Example 2 of the present invention.

[0175] Figure 4 These are the sequencing results of different primer concentrations in Experimental Example 2 of the present invention.

[0176] Figure 5 This is the overall sequencing quality report of the test samples in Experimental Example 3 of the present invention.

[0177] Figure 6 This is a sequencing quality report for each test sample in Experimental Example 3 of the present invention. DETAILED DESCRIPTION

[0178] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0179] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0180] The experimental methods in the following examples where specific conditions are not specified are generally carried out under conventional conditions, such as those described in Green and Sambrook et al., Molecular Cloning: A Laboratory Manual (2013), or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0181] In some embodiments of the present invention, a primer set for detecting blood tumor fusion gene is disclosed, and its specific sequence is shown in Table 2.

[0182] In other embodiments of the present invention, a kit for detecting blood tumor fusion genes is also disclosed, and the kit includes the above-mentioned primer set for detecting blood tumor fusion genes.

[0183] In some of the embodiments, the working concentration of the primer set is 0.08 μM to 0.12 μM.

[0184] In other embodiments of the present invention, a method for detecting blood tumor fusion genes is also disclosed, comprising the following steps: using the cDNA of the sample to be tested as a template, using the above-mentioned kit to perform PCR amplification of the blood tumor fusion gene, performing end repair on the amplified product, connecting to a specific linker, then performing library amplification, and sequencing the library on a machine.

[0185] The key to the detection method of the present invention is to design the primer sequence of the target amplification region, optimize the concentration of primers in the multiplex PCR amplification system through the design and screening of a series of target gene fragment regions, and explore the conditions of the experimental process of the entire method, so that the amplification uniformity of each pair of primers can achieve an ideal effect, ensure the effectiveness and feasibility of the experimental process, and finally form a set of methods suitable for the detection of blood tumor fusion genes, which can be used to assist in the diagnosis of blood tumors and improve the accuracy of diagnosis and treatment through genetic typing detection.

[0186] In some embodiments, the PCR amplification reaction system includes: ddH2O 5.4±0.1μL, 10×Buffer 2±0.1μL, MgCl2 1.2±0.1μL, dNTP Mix 0.4±0.1μL, primer mixture 0.8±0.1μL, DNA Polymerase 0.2±0.05μL, and cDNA 10±0.2μL.

[0187] In some embodiments, the reaction procedure of the PCR amplification includes: 95°C for 5 min; 95°C for 45 s, 60°C for 45 s, 72°C for 60 s, 35 cycles; 75°C for 10 min; 4°C∞.

[0188] In some embodiments, the reaction system for library amplification includes: PCR SuperMix HighFidelity 50±2 μL, Library Amplification Primer Mix 2.5±0.5 μL, Unamplified library 12.5±0.5 μL.

[0189] In some embodiments, the reaction procedure for library amplification includes: 95°C for 5 min; 95°C for 15 s, 58°C for 15 s, 70°C for 60 s, 7 cycles; 4°C∞.

[0190] In some of the examples, the IonGene Studio S5 Plus platform was used for on-machine sequencing. The sequencing length was 400 bp, and the sequencing time was only 4.5 hours. Ionchef was used for automated template preparation of library templates, which reduced manual operations, greatly reduced the errors generated during the experiment, and further ensured the reliability of the test results.

[0191] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0192] Example 1 Primer set for detecting blood tumor fusion gene

[0193] This embodiment provides a primer set for detecting blood tumor fusion genes, wherein the blood tumor fusion genes to be detected are shown in Table 1.

[0194] Table 1

[0195]

[0196]

[0197] According to the locations of 62 pairs of fusion genes related to blood tumors in Table 1, primer sequences of the target regions were designed. The specific primer sets are shown in Table 2.

[0198] Table 2

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207] Example 2 Method for detecting blood tumor fusion genes

[0208] The following steps are involved:

[0209] 1. Sample RNA extraction

[0210] The QIAamp RNA Blood Mini kit was used in combination with the fully automatic nucleic acid extraction and purification instrument QIAsymphony SP for nucleic acid extraction and purification. Sample types included whole blood, bone marrow puncture, etc.

[0211] 2. Reverse transcription

[0212] Take a 0.2mL PCR tube, add 100ng RNA to the tube, add water to the total volume of 10μL, and perform pre-denaturation, program: [65℃, 5min]; [4℃, ∞]; after the reaction is completed, immediately take out the sample and put it on an ice plate, let it stand for 2 minutes, microcentrifuge, prepare the reagents according to the reaction system in Table 3, and perform reverse transcription according to the reaction program in Table 4.

[0213] Table 3

[0214] Reagents Volume (μL) 10×RT Mix 2 HiScriptⅢEnzyme Mix 2 Random hexamers 1 <![CDATA[ddH2O]]> 5 RNA 10 Total 20

[0215] Table 4

[0216] temperature time 25℃ 5min 37℃ 45min 85℃ 5s 4℃ ∞

[0217] 3. Amplification of target gene fragment

[0218] Thaw the amplification enzyme solution and the hematological tumor-related fusion gene amplification primer set (Table 2) on ice, mix well and then centrifuge microcentrifuge, prepare the PCR reaction system according to Table 5, pipette up and down 5 times, centrifuge microcentrifuge, and perform PCR amplification according to the reaction program in Table 6.

[0219] Table 5

[0220]

[0221] Table 6

[0222]

[0223] 4. Purification after amplification

[0224] (1) Take out the Agencourt AMPure XP beads, equilibrate to room temperature, and shake thoroughly before use;

[0225] (2) Add 36 μL Agencourt AMPure XP beads (1.8*sample volume) to each sample after amplification, mix well by pipetting, and let stand at room temperature for 5 min;

[0226] (3) Place on a magnetic stand for 2 minutes. After the solution becomes clear, discard the supernatant.

[0227] (4) Add 200 μL of freshly prepared 80% ethanol and let stand for 30 seconds. After the solution is clear, remove the supernatant. Repeat once. Leave at room temperature for 5 to 10 minutes to evaporate the alcohol and allow the magnetic beads to dry.

[0228] (5) Add 10 μL ddH2O to resuspend the magnetic beads, pipette and mix, let stand at room temperature for 5 min, and then place on a magnetic rack. After the solution is clear, carefully transfer 6 μL of the supernatant to a new PCR tube or 96-well plate.

[0229] 5. End repair

[0230] The Ion Plus Fragment Library Kit was used for end repair. The reaction system was prepared according to Table 7 and then shaken to mix; end repair was performed at [20 min, room temperature].

[0231] Table 7

[0232]

[0233]

[0234] 6. Connector and purification

[0235] (1) Connecting joints

[0236] Fully dissolve the connection buffer (Ion Plus Fragment Library Kit, Thermofisher) and the specific adapter (used to identify the sample in the subsequent analysis process, Ion Plus Fragment Library Kit, Thermofishe), prepare the connection adapter (4 μL adapter, H2O: P1: Index = 2: 1: 1, wherein P1 and Index are components of the specific adapter) reaction system as shown in Table 8, pipette up and down 5 times, microcentrifuge, put on the PCR instrument, and perform adapter connection according to the reaction program in Table 9.

[0237] Table 8

[0238] Components Volume (μL) DNA 12.5 10X Ligase Buffer 5 dNTP Mix 1 Nuclease-free Water 22.5 DNA Ligase 1 Nick Repair Polymerase 4 Connection joints 4 Total 50

[0239] Table 9

[0240] temperature time 25℃ 15min 72℃ 5min 4℃ ∞

[0241] (2) Purification of ligation product

[0242] (a) Take out Agencourt AMPure XP beads, equilibrate to room temperature, and shake thoroughly before use;

[0243] (b) After ligation, add 70 μL Agencourt AMPure XP beads (1.4*sample volume) to each sample, mix by pipetting, and let stand at room temperature for 5 min.

[0244] (c) Place on a magnetic stand for 2 min. After the solution is clarified, discard the supernatant.

[0245] (d) Add 200 μL of freshly prepared 80% ethanol and let stand for 30 seconds. After the solution is clear, remove the supernatant. Repeat once. Leave at room temperature for 5 to 10 minutes to evaporate the alcohol and allow the magnetic beads to dry.

[0246] (e) Add 10 μL ddH2O to resuspend the magnetic beads, pipette and mix, let stand at room temperature for 5 min, and then place on a magnetic rack. After the solution is clear, carefully transfer 12.5 μL of the supernatant to a new PCR tube or 96-well plate.

[0247] 7. Library amplification and purification

[0248] (1) Amplification of the library

[0249] Prepare the reaction system for amplifying the library as shown in Table 10, pipette up and down 5 times, centrifuge microcentrifuge, put it on the PCR instrument, and set it as shown in Table 11.

[0250] The reaction program was used for library amplification.

[0251] Table 10

[0252] Components Volume (μL) Unamplified library 12.5 <![CDATA[Platinum TM PCR SuperMix High Fidelity]]> 50.0 Library Amplification Primer Mix 2.5 Total 65.0

[0253] Table 11

[0254]

[0255] (2) Library purification

[0256] (a) Take out Agencourt AMPure XP beads, equilibrate to room temperature, and shake thoroughly before use;

[0257] (b) After ligation, add 97.5 μL Agencourt AMPure XP beads (1.5*sample volume) to each sample, mix by pipetting, and let stand at room temperature for 5 min.

[0258] (c) Place on a magnetic stand for 2 min. After the solution is clarified, discard the supernatant.

[0259] (d) Add 200 μL of freshly prepared 80% ethanol and let stand for 30 seconds. After the solution is clarified, remove the supernatant. Repeat once. Let stand at room temperature for 5 to 10 minutes to evaporate the alcohol.

[0260] (e) Add 10 μL ddH2O to resuspend the magnetic beads, pipette and mix, let stand at room temperature for 5 min, and then place on a magnetic rack. After the solution is clear, carefully transfer 11 μL of the supernatant to a new PCR tube or 96-well plate.

[0261] (3) Use dsDNA HS Assay Kit and The concentration of the library was measured by 3.0Fluorometer; the length of the library was measured by fragment analyzer (Bioanalyzer2100).

[0262] (4) After determining the concentration, perform library pooling according to equal ng.

[0263] 8. Library template preparation

[0264] The library was diluted to 50 pM and automated template preparation was performed using Ion Chef, including oil-in-water PCR, effective microbead enrichment, and chip loading, which took about 13 hours, and the manual operation time for the entire process was less than 15 minutes.

[0265] 9. Sequencing

[0266] The Ion GeneStudio S5 Plus of the Ion Torrent platform was used for sequencing, with a sequencing read length of 400bp and a sequencing time of approximately 4.5 hours.

[0267] 10. Data Processing

[0268] The generated BCL file is transferred to the Torrent Server, a computer server dedicated to the Ion Torrent platform, for preliminary data processing and analysis. After analysis and processing, a preliminary sequencing quality report is issued, including Totalbases, Totalreads, Usable sequence, Readlength, etc. The corresponding OutputFiles will issue a sequencing quality report for each sample, including Bases, Reads, Length, etc.

[0269] Experimental Example 1 Screening of specific primers

[0270] Taking the PML-RARA.P3R3 fusion gene subtype (formed by the fusion of PML exon 3 and RARA exon 3) as an example, according to the NCBI reference PML gene (NM_033240) and RARA gene (NM_000964), according to the upstream and downstream of the fusion gene breakpoint, appropriate primers were obtained by Blast, and primers with appropriate parameters such as TM, GC and length were selected for primer synthesis. A total of 2 pairs of primers (primer pair A and primer pair B) were designed.

[0271] The sequence of primer pair A is as follows:

[0272] Upstream primer: TGCAGAGGATGAAGTGCTACG (SEQ ID NO.140)

[0273] Downstream primer: TTGTAGATGCGGGGTAGAGGG (SEQ ID NO.141)

[0274] The upstream primer of primer pair B is SEQ ID NO.116, and the downstream primer is SEQ ID NO.42.

[0275] Primer pairs A and B were used respectively to amplify the blood tumor fusion-positive sample (confirmed to be a PML-RARA.P3R3 fusion gene subtype-positive sample) according to the method of Example 2. The amplification results are as follows: Figure 1 As shown. Figure 1 It can be seen that the target product cannot be amplified using primer pair A, but the target product can be amplified using primer pair B. The product amplified using primer pair B was sequenced and the results are as follows: Figure 2 As shown, from Figure 2 It can be seen that the PML-RARA.P3R3 fusion gene can be detected, indicating that primer pair B can achieve effective amplification.

[0276] Experimental Example 2 Optimization of primer concentration

[0277] The present invention uses 7 blood tumor fusion-positive samples (fluorescence quantitative PCR verification, using the leukemia-related gene detection kit of Shanghai Yuanqi Biotechnology Co., Ltd., among which sample No. 3 is PML-RARA.P6R3 fusion gene positive) to optimize the primer concentration.

[0278] After the primer pairs shown in Table 2 were mixed, the test was performed at concentrations of 0.1 μM and 0.2 μM, and the library was constructed after multiple PCR amplification. After multiple PCR amplification, the concentration of the amplicon of the sample was shown in Table 12.

[0279] Table 12

[0280]

[0281]

[0282] As can be seen from Table 12, the fusion primer pairs of the present invention were used to perform multiplex PCR amplification on the test samples, and the amplicon concentration of the test samples was normal, indicating that the primers of the present invention are specific, the amplification system and conditions are reasonable, the amplification effect is good, and the target amplification product can be obtained.

[0283] The library was constructed by linker connection, and the concentration and length were measured after the library was released, as shown in Table 13 and Figure 3 shown.

[0284] Table 13

[0285]

[0286] For sample No. 3 (primer concentration 0.1uM), qubit was first used to quantitatively analyze the library, and the results showed that the library concentration was normal. Then, the Agilent bioanalyzer was used for qualitative analysis, and the results showed that the main peak of the library was at 200bp, there was no adapter dimer, and the fragment size was in line with expectations ( Figure 3 ), indicating that the library construction process of the present invention and the corresponding kit system can meet the library construction requirements.

[0287] The sequencing results of sample 3 are as follows Figure 4 As shown. Both 0.1μM and 0.2μM can be amplified successfully and the target fragment (129bp) can be detected. However, from the number of sequencing reads, 0.2μM only sequenced 181 reads, and the number of target product reads of 0.1μM was 1799. It is speculated that because the primer concentration is too high, there is non-specific amplification, so 0.1μM is selected as the final primer concentration. Experimental Example 3 Methodological verification of the detection method of the present invention

[0288] The method of Example 2 was adopted to verify the methodology of the detection method of the present invention by testing 69 blood tumor fusion-positive samples (verified by fluorescent quantitative PCR), 2 blood tumor fusion-negative samples (peripheral blood samples), and 3 nuclease-free water (NTC quality control).

[0289] The overall sequencing quality report of the test sample is as follows Figure 5 The sequencing quality report shows that the median ReadLength of the library is 119bp, the ISPLoading rate is 87%, the TotalReads obtained by sequencing are close to 6M, the UsableReads ratio is 55%, and the data volume is 808M. This shows that the length of the library fragment is in line with expectations, and the library construction and machine loading process can meet the experimental requirements.

[0290] The sequencing quality report of Test49 samples is as follows Figure 6 As shown, we can see that the average read length is 134bp, the number of sequenced reads is about 230k, the data volume is about 30M, and the library fragment length is in line with expectations.

[0291] The above sequencing results were obtained, and the accuracy results of fusion gene detection were obtained through bioinformatics analysis and comparison, as shown in Table 14.

[0292] Table 14

[0293]

[0294]

[0295]

[0296] The statistical data of fusion gene detection are shown in Table 15.

[0297] Table 15

[0298]

[0299] Among the 71 validation samples, there were 69 fusion gene positive samples, 69 of which were detected; there were 2 fusion gene negative samples, 2 of which were detected, and the positive and negative coincidence rates were both 100%, indicating that the detection method of the present invention has good specificity.

[0300] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0301] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A primer set for detecting blood tumor fusion gene, characterized in that: The primer set includes all of the following primers: The forward primer for detecting the B1J19 subtype of the fusion gene BCR-JAK2 is shown in SEQ ID NO.1 and the reverse primer is shown in SEQ ID NO.2; The forward primer whose sequence is shown in SEQ ID NO.3 and the reverse primer whose sequence is shown in SEQ ID NO.4 for detecting the E5J12 subtype of the fusion gene ETV6-JAK2; The forward primer whose sequence is shown in SEQ ID NO.3 and the reverse primer whose sequence is shown in SEQ ID NO.2 for detecting the E5J19 subtype of the fusion gene ETV6-JAK2; The forward primer for detecting the E4J17 subtype of the fusion gene ETV6-JAK2 is shown in SEQ ID NO.5 and the reverse primer is shown in SEQ ID NO.6; The forward primer whose sequence is shown in SEQ ID NO.7 and the reverse primer whose sequence is shown in SEQ ID NO.8 for detecting the F6E11 subtype and F7E11 subtype of the fusion gene FUS-ERG; The forward primer whose sequence is shown as SEQ ID NO.9 and the reverse primer whose sequence is shown as SEQ ID NO.10 for detecting the F8E9 subtype of the fusion gene FUS-ERG; The forward primer for detecting the P5J19 subtype of the fusion gene PAX5-JAK2 is shown in SEQ ID NO.11 and the reverse primer is shown in SEQ ID NO.2; The forward primer for detecting the S4J11 subtype of the fusion gene SSBP2-JAK2 is shown in SEQ ID NO.12 and the reverse primer is shown in SEQ ID NO.13; The forward primer for detecting the S5J11 subtype of the fusion gene SSBP2-JAK2 is shown in SEQ ID NO.14 and the reverse primer is shown in SEQ ID NO.13; The forward primer for detecting the T16P3 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.15 and the reverse primer is shown in SEQ ID NO.16; The forward primer whose sequence is shown in SEQ ID NO.17 and the reverse primer whose sequence is shown in SEQ ID NO.6 for detecting the B1J17 subtype of the fusion gene BCR-JAK2; The forward primer for detecting the B13J11 subtype of the fusion gene BCR-JAK2 is shown in SEQ ID NO.18 and the reverse primer is shown in SEQ ID NO.13; The forward primer for detecting the E4J16 subtype of the fusion gene ETV6-JAK2 is shown in SEQ ID NO.5 and the reverse primer is shown in SEQ ID NO.19; The forward primer whose sequence is shown in SEQ ID NO.20 and the reverse primer whose sequence is shown in SEQ ID NO.21 for detecting the F5E8 subtype of the fusion gene FUS-ERG; The forward primer whose sequence is shown in SEQ ID NO.7 and the reverse primer whose sequence is shown in SEQ ID NO.8 for detecting the F6E11 subtype of the fusion gene FUS-ERG; The forward primer whose sequence is shown as SEQ ID NO.7 and the reverse primer whose sequence is shown as SEQ ID NO.10 for detecting the F7E10 subtype of the fusion gene FUS-ERG; The forward primer whose sequence is shown as SEQ ID NO.7 and the reverse primer whose sequence is shown as SEQ ID NO.21 for detecting the F7E8 subtype of the fusion gene FUS-ERG; The forward primer for detecting the S3J11 subtype of the fusion gene SSBP2-JAK2 is shown in SEQ ID NO.22 and the reverse primer is shown in SEQ ID NO.13; The forward primer whose sequence is shown in SEQ ID NO.18 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B13A3 subtype of the fusion gene BCR-ABL1; A forward primer having a sequence as shown in SEQ ID NO.24 and a reverse primer having a sequence as shown in SEQ ID NO.23 for detecting the B14A3 subtype of the fusion gene BCR-ABL1; The forward primer whose sequence is shown in SEQ ID NO.25 and the reverse primer whose sequence is shown in SEQ ID NO.26 for detecting the B18A2 subtype of the fusion gene BCR-ABL1; The forward primer whose sequence is shown in SEQ ID NO.25 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B18A3 subtype of the fusion gene BCR-ABL1; The forward primer for detecting the B19A2 subtype of the fusion gene BCR-ABL1 is shown in SEQ ID NO.27 and the reverse primer is shown in SEQ ID NO.26; The forward primer whose sequence is shown in SEQ ID NO.27 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B19A3 subtype of the fusion gene BCR-ABL1; The forward primer whose sequence is shown in SEQ ID NO.17 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B1A3 subtype of the fusion gene BCR-ABL1; The forward primer for detecting the B6A2 subtype of the fusion gene BCR-ABL1 is shown in SEQ ID NO.28 and the reverse primer is shown in SEQ ID NO.26; The forward primer whose sequence is shown in SEQ ID NO.28 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B6A3 subtype of the fusion gene BCR-ABL1; The forward primer for detecting the B8A2 subtype of the fusion gene BCR-ABL1 is shown in SEQ ID NO.29 and the reverse primer is shown in SEQ ID NO.26; The forward primer whose sequence is shown in SEQ ID NO.29 and the reverse primer whose sequence is shown in SEQ ID NO.23 for detecting the B8A3 subtype of the fusion gene BCR-ABL1; The forward primer for detecting the B13J11 subtype of the fusion gene BCR-JAK2 is shown in SEQ ID NO.18 and the reverse primer is shown in SEQ ID NO.13; The forward primer for detecting the B13J19 subtype of the fusion gene BCR-JAK2 is shown in SEQ ID NO.18 and the reverse primer is shown in SEQ ID NO.2; The forward primer whose sequence is shown in SEQ ID NO.17 and the reverse primer whose sequence is shown in SEQ ID NO.13 for detecting the B1J11 subtype of the fusion gene BCR-JAK2; The forward primer for detecting the B12P12 subtype of the fusion gene BCR-PDGFRA is shown in SEQ ID NO.30 and the reverse primer is shown in SEQ ID NO.31; The forward primer for detecting the B7P12 subtype of the fusion gene BCR-PDGFRA is shown in SEQ ID NO.28 and the reverse primer is shown in SEQ ID NO.31; The forward primer for detecting the C4M28 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.32 and the reverse primer is shown in SEQ ID NO.33; The forward primer for detecting the C13P12 subtype of the fusion gene CDK5RAP2-PDGFRA has a sequence as shown in SEQ ID NO.34 and a reverse primer as shown in SEQ ID NO.31; The forward primer for detecting the E4A2 subtype of the fusion gene ETV6-ABL1 is shown in SEQ ID NO.5 and the reverse primer is shown in SEQ ID NO.26; The forward primer whose sequence is shown as SEQ ID NO.3 and the reverse primer whose sequence is shown as SEQ ID NO.26 for detecting the E5A2 subtype of the fusion gene ETV6-ABL1; The forward primer whose sequence is shown in SEQ ID NO.5 and the reverse primer whose sequence is shown in SEQ ID NO.4 for detecting the E4J12 subtype of the fusion gene ETV6-JAK2; The forward primer for detecting the E4J19 subtype of the fusion gene ETV6-JAK2 has a sequence as shown in SEQ ID NO.5 and a reverse primer with a sequence as shown in SEQ ID NO.2; The forward primer whose sequence is shown in SEQ ID NO.3 and the reverse primer whose sequence is shown in SEQ ID NO.6 for detecting the E5J17 subtype of the fusion gene ETV6-JAK2; The forward primer for detecting the E6P12 subtype of the fusion gene ETV6-PDGFRA is shown in SEQ ID NO.35 and the reverse primer is shown in SEQ ID NO.31; The forward primer for detecting the E4P10 subtype of the fusion gene ETV6-PDGFRA has a sequence as shown in SEQ ID NO.5 and a reverse primer has a sequence as shown in SEQ ID NO.36; The forward primer for detecting the E4P11 subtype of the fusion gene ETV6-PDGFRA has a sequence as shown in SEQ ID NO.5 and a reverse primer has a sequence as shown in SEQ ID NO.37; The forward primer for detecting the E7P10 subtype of the fusion gene ETV6-PDGFRA has a sequence as shown in SEQ ID NO.38 and a reverse primer has a sequence as shown in SEQ ID NO.36; The forward primer for detecting the E7P11 subtype of the fusion gene ETV6-PDGFRA has a sequence as shown in SEQ ID NO.38 and a reverse primer has a sequence as shown in SEQ ID NO.37; The forward primer for detecting the F12P13 subtype of the fusion gene FIP1L1-PDGFRA has a sequence as shown in SEQ ID NO.39 and a reverse primer has a sequence as shown in SEQ ID NO.40; The forward primer for detecting the F15R3 subtype of the fusion gene FIP1L1-RARA is shown in SEQ ID NO.41 and the reverse primer is shown in SEQ ID NO.42; The forward primer whose sequence is shown in SEQ ID NO.9 and the reverse primer whose sequence is shown in SEQ ID NO.8 for detecting the F8E11 subtype of the fusion gene FUS-ERG; The forward primer for detecting the K23P12 subtype of the fusion gene KIF5B-PDGFRA has a sequence as shown in SEQ ID NO.43 and a reverse primer has a sequence as shown in SEQ ID NO.31; The forward primer for detecting the M8A4 subtype of the fusion gene MLL-AFF1 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.45; The forward primer for detecting the M8A5 subtype of the fusion gene MLL-AFF4 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.46; The forward primer for detecting the M8A6 subtype of the fusion gene MLL-AFF4 has a sequence as shown in SEQ ID NO.44 and a reverse primer as shown in SEQ ID NO.47; The forward primer for detecting the M9A5 subtype of the fusion gene MLL-AFF4 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.46; The forward primer for detecting the M9A6 subtype of the fusion gene MLL-AFF4 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.47; The forward primer for detecting the M7E2 subtype of the fusion gene MLL-ELL is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.50; The forward primer for detecting the M10E12 subtype of the fusion gene MLL-EPS15 is shown in SEQ ID NO.51 and the reverse primer is shown in SEQ ID NO.52; The forward primer for detecting the M8M2 subtype of the fusion gene MLL-MLLT1 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.53; The forward primer whose sequence is shown in SEQ ID NO.44 and the reverse primer whose sequence is shown in SEQ ID NO.54 for detecting the M8M4 subtype of the fusion gene MLL-MLLT1; The forward primer for detecting the M8M6 subtype of the fusion gene MLL-MLLT1 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.55; The forward primer for detecting the M8M7 subtype of the fusion gene MLL-MLLT1 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.56; The forward primer for detecting the M8M9 subtype of the fusion gene MLL-MLLT10 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.57; The forward primer for detecting the M8M2 subtype of the fusion gene MLL-MLLT11 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.58; The forward primer for detecting the M9M2 subtype of the fusion gene MLL-MLLT11 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.58; The forward primer whose sequence is shown in SEQ ID NO.49 and the reverse primer whose sequence is shown in SEQ ID NO.59 for detecting the M7M6 subtype of the fusion gene MLL-MLLT3; The forward primer for detecting the M8M6 subtype of the fusion gene MLL-MLLT3 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.59; The forward primer for detecting the M8M7 subtype of the fusion gene MLL-MLLT3 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.60; The forward primer for detecting the M9M6 subtype of the fusion gene MLL-MLLT3 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.59; The forward primer for detecting the M9M7 subtype of the fusion gene MLL-MLLT3 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.60; The forward primer for detecting the M7M2 subtype of the fusion gene MLL-MLLT4 is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.61; The forward primer for detecting the M8M2 subtype of the fusion gene MLL-MLLT4 is shown in SEQ ID NO.44 and the reverse primer is shown in SEQ ID NO.61; The forward primer for detecting the M9M2 subtype of the fusion gene MLL-MLLT4 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.61; The forward primer for detecting the M7M11 subtype of the fusion gene MLL-MLLT6 is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.62; The forward primer for detecting the M9M11 subtype of the fusion gene MLL-MLLT6 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.62; The forward primer for detecting the M7S2 subtype of the fusion gene MLL-SEPT6 is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.63; The forward primer whose sequence is shown in SEQ ID NO.64 and the reverse primer whose sequence is shown in SEQ ID NO.65 for detecting the N6M2 subtype of the fusion gene NPM1-MLF1; The forward primer for detecting the N3R3 subtype of the fusion gene NPM1-RARA is shown in SEQ ID NO.66 and the reverse primer is shown in SEQ ID NO.42; The forward primer for detecting the N22R3 subtype of the fusion gene NUMA-RARA is shown in SEQ ID NO.67 and the reverse primer is shown in SEQ ID NO.42; The forward primer for detecting the N23A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.68 and the reverse primer is shown in SEQ ID NO.26; The forward primer for detecting the N29A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.69 and the reverse primer is shown in SEQ ID NO.26; The forward primer for detecting the N31A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.70 and the reverse primer is shown in SEQ ID NO.26; The forward primer for detecting the N32A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.71 and the reverse primer is shown in SEQ ID NO.26; The forward primer for detecting the N34A2 subtype of the fusion gene NUP214-ABL1 is shown in SEQ ID NO.72 and the reverse primer is shown in SEQ ID NO.26; The forward primer for detecting the N12H2 subtype of the fusion gene NUP98-HOXA11 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.74; The forward primer for detecting the N11H2 subtype of the fusion gene NUP98-HOXA13 has a sequence as shown in SEQ ID NO.75 and a reverse primer has a sequence as shown in SEQ ID NO.76; The forward primer for detecting the N12H2 subtype of the fusion gene NUP98-HOXA13 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.76; The forward primer for detecting the N11H2 subtype of the fusion gene NUP98-HOXA9 has a sequence as shown in SEQ ID NO.75 and a reverse primer has a sequence as shown in SEQ ID NO.77; The forward primer for detecting the N12H2 subtype of the fusion gene NUP98-HOXC11 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.78; The forward primer for detecting the N12H2 subtype of the fusion gene NUP98-HOXD13 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.79; The forward primer for detecting the N11M15 subtype of the fusion gene NUP98-MLLT10 has a sequence as shown in SEQ ID NO.75 and a reverse primer as shown in SEQ ID NO.80; The forward primer for detecting the N12P2 subtype of the fusion gene NUP98-PRRX1 is shown in SEQ ID NO.73 and the reverse primer is shown in SEQ ID NO.81; The forward primer whose sequence is shown in SEQ ID NO.82 and the reverse primer whose sequence is shown in SEQ ID NO.83 for detecting the P17M10 subtype of the fusion gene PICALM-MLLT10; The forward primer whose sequence is shown in SEQ ID NO.82 and the reverse primer whose sequence is shown in SEQ ID NO.84 for detecting the P17M4 subtype of the fusion gene PICALM-MLLT10; The forward primer for detecting the P17M9 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.82 and the reverse primer is shown in SEQ ID NO.57; The forward primer for detecting the P18M10 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.85 and the reverse primer is shown in SEQ ID NO.83; The forward primer whose sequence is shown in SEQ ID NO.85 and the reverse primer whose sequence is shown in SEQ ID NO.84 for detecting the P18M4 subtype of the fusion gene PICALM-MLLT10; The forward primer for detecting the P18M9 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.85 and the reverse primer is shown in SEQ ID NO.57; The forward primer for detecting the P19M10 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.86 and the reverse primer is shown in SEQ ID NO.83; The forward primer for detecting the P19M4 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.86 and the reverse primer is shown in SEQ ID NO.84; The forward primer for detecting the P19M9 subtype of the fusion gene PICALM-MLLT10 is shown in SEQ ID NO.86 and the reverse primer is shown in SEQ ID NO.57; The forward primer for detecting the P5R3 subtype of the fusion gene PML-RARA is shown in SEQ ID NO.87 and the reverse primer is shown in SEQ ID NO.42; The forward primer for detecting the P2R3 subtype of the fusion gene PRKAR1A-RARA is shown in SEQ ID NO.88 and the reverse primer is shown in SEQ ID NO.42; The forward primer whose sequence is shown in SEQ ID NO.89 and the reverse primer whose sequence is shown in SEQ ID NO.90 for detecting the R2A4 subtype of the fusion gene RCSD1-ABL1; The forward primer whose sequence is shown in SEQ ID NO.91 and the reverse primer whose sequence is shown in SEQ ID NO.90 for detecting the R3A4 subtype of the fusion gene RCSD1-ABL1; The forward primer for detecting the R3C2 subtype of the fusion gene RUNX1-CBFA2T3 is shown in SEQ ID NO.92 and the reverse primer is shown in SEQ ID NO.93; The forward primer whose sequence is shown in SEQ ID NO.92 and the reverse primer whose sequence is shown in SEQ ID NO.94 for detecting the R3C4 subtype of the fusion gene RUNX1-CBFA2T3; The forward primer for detecting the R3M2 subtype of the fusion gene RUNX1-MECOM is shown in SEQ ID NO.92 and the reverse primer is shown in SEQ ID NO.95; The forward primer for detecting the R3R2 subtype of the fusion gene RUNX1-RPL22 is shown in SEQ ID NO.92 and the reverse primer is shown in SEQ ID NO.96; The forward primer for detecting the R3R3 subtype of the fusion gene RUNX1-RUNX1T1 is shown in SEQ ID NO.92 and the reverse primer is shown in SEQ ID NO.97; The forward primer for detecting the S7N18 subtype of the fusion gene SET-NUP214 is shown in SEQ ID NO.98 and the reverse primer is shown in SEQ ID NO.99; The forward primer for detecting the S3A4 subtype of the fusion gene SNX2-ABL1 is shown in SEQ ID NO.100 and the reverse primer is shown in SEQ ID NO.90; The forward primer for detecting the S15R3 subtype of the fusion gene STAT5B-RARA is shown in SEQ ID NO.101 and the reverse primer is shown in SEQ ID NO.42; The forward primer whose sequence is shown in SEQ ID NO.102 and the reverse primer whose sequence is shown in SEQ ID NO.103 for detecting the S1T2 subtype of the fusion gene STIL-TAL1; The forward primer for detecting the S6P12 subtype of the fusion gene STRN-PDGFRA is shown in SEQ ID NO.104 and the reverse primer is shown in SEQ ID NO.31; The forward primer whose sequence is shown in SEQ ID NO.105 and the reverse primer whose sequence is shown in SEQ ID NO.106 for detecting the T15H4 subtype of the fusion gene TCF3-HLF; The forward primer whose sequence is shown in SEQ ID NO.15 and the reverse primer whose sequence is shown in SEQ ID NO.106 for detecting the T16H4 subtype of the fusion gene TCF3-HLF; The forward primer for detecting the T16P5 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.15 and the reverse primer is shown in SEQ ID NO.107; The forward primer for detecting the T17P3 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.108 and the reverse primer is shown in SEQ ID NO.16; The forward primer for detecting the T17P5 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.108 and the reverse primer is shown in SEQ ID NO.107; The forward primer for detecting the Z3R3 subtype of the fusion gene ZBTB16-RARA is shown in SEQ ID NO.109 and the reverse primer is shown in SEQ ID NO.42; The forward primer for detecting the Z4R3 subtype of the fusion gene ZBTB16-RARA is shown in SEQ ID NO.110 and the reverse primer is shown in SEQ ID NO.42; The forward primer for detecting the Z18A2 subtype of the fusion gene ZMIZ1-ABL1 is shown in SEQ ID NO.111 and the reverse primer is shown in SEQ ID NO.26; The forward primer whose sequence is shown in SEQ ID NO.18 and the reverse primer whose sequence is shown in SEQ ID NO.26 for detecting the B13A2 subtype of the fusion gene BCR-ABL1; The forward primer whose sequence is shown in SEQ ID NO.24 and the reverse primer whose sequence is shown in SEQ ID NO.26 for detecting the B14A2 subtype of the fusion gene BCR-ABL1; The forward primer for detecting the B1A2 subtype of the fusion gene BCR-ABL1 is shown in SEQ ID NO.17 and the reverse primer is shown in SEQ ID NO.26; The forward primer for detecting the C5M28 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.33; The forward primer for detecting the C5M29 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.113; The forward primer for detecting the C5M33 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.114; The forward primer for detecting the D9C18 subtype of the fusion gene DEK-CAN_NUP214 is shown in SEQ ID NO.115 and the reverse primer is shown in SEQ ID NO.99; The forward primer whose sequence is shown as SEQ ID NO.116 and the reverse primer whose sequence is shown as SEQ ID NO.42 for detecting the P3R3 subtype of the fusion gene PML-RARA; The forward primer whose sequence is shown in SEQ ID NO.117 and the reverse primer whose sequence is shown in SEQ ID NO.42 for detecting the P6R3 subtype and P6R3.1 subtype of the fusion gene PML-RARA; The forward primer for detecting the C5M12 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.118; The forward primer for detecting the C5M8 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.119; The forward primer for detecting the E5R2 subtype of the fusion gene ETV6-RUNX1 is shown in SEQ ID NO.3 and the reverse primer is shown in SEQ ID NO.120; The forward primer whose sequence is shown in SEQ ID NO.51 and the reverse primer whose sequence is shown in SEQ ID NO.45 for detecting the M10A4 subtype of the fusion gene MLL-AFF1; The forward primer for detecting the M9A5 subtype of the fusion gene MLL-AFF1 is shown in SEQ ID NO.48 and the reverse primer is shown in SEQ ID NO.121; The forward primer whose sequence is shown in SEQ ID NO.122 and the reverse primer whose sequence is shown in SEQ ID NO.42 for detecting the P6R3 subtype of the fusion gene PML-RARA; The forward primer for detecting the T13P2 subtype of the fusion gene TCF3-PBX1 is shown in SEQ ID NO.123 and the reverse primer is shown in SEQ ID NO.124; The forward primer for detecting the E4N15 subtype of the fusion gene ETV6-NTRK3 is shown in SEQ ID NO.5 and the reverse primer is shown in SEQ ID NO.125; The forward primer for detecting the E5N15 subtype of the fusion gene ETV6-NTRK3 is shown in SEQ ID NO.3 and the reverse primer is shown in SEQ ID NO.125; The forward primer whose sequence is shown as SEQ ID NO.30 and the reverse primer whose sequence is shown as SEQ ID NO.26 for detecting the B12A2 subtype of the fusion gene BCR-ABL1; The forward primer whose sequence is shown as SEQ ID NO.30 and the reverse primer whose sequence is shown as SEQ ID NO.23 for detecting the B12A3 subtype of the fusion gene BCR-ABL1; A forward primer having a sequence as shown in SEQ ID NO.126 and a reverse primer having a sequence as shown in SEQ ID NO.26 for detecting the B20A2 subtype of the fusion gene BCR-ABL1; The forward primer whose sequence is shown as SEQ ID NO.126 and the reverse primer whose sequence is shown as SEQ ID NO.23 for detecting the B20A3 subtype of the fusion gene BCR-ABL1; The forward primer for detecting the C4M29 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.32 and the reverse primer is shown in SEQ ID NO.113; The forward primer for detecting the C4M30 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.32 and the reverse primer is shown in SEQ ID NO.127; The forward primer for detecting the C4M31 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.32 and the reverse primer is shown in SEQ ID NO.128; The forward primer for detecting the C5M30 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.127; The forward primer for detecting the C5M31 subtype of the fusion gene CBFB-MYH11 is shown in SEQ ID NO.112 and the reverse primer is shown in SEQ ID NO.128; The forward primer for detecting the D9N19 subtype of the fusion gene DEK-NUP214 is shown in SEQ ID NO.115 and the reverse primer is shown in SEQ ID NO.129; The forward primer for detecting the E5R3 subtype of the fusion gene ETV6-RUNX1_AML1 is shown in SEQ ID NO.3 and the reverse primer is shown in SEQ ID NO.130; The forward primer for detecting the M7F2 subtype of the fusion gene MLL_KMT2A-FOXO4 is shown in SEQ ID NO.49 and the reverse primer is shown in SEQ ID NO.131; The forward primer for detecting the N4M4 subtype of the fusion gene NPM1-MLF1 is shown in SEQ ID NO.132 and the reverse primer is shown in SEQ ID NO.133; The forward primer for detecting the N4R5 subtype of the fusion gene NPM1-RARA is shown in SEQ ID NO.132 and the reverse primer is shown in SEQ ID NO.134; The forward primer for detecting the S1T1 subtype of the fusion gene STIL-TAL1 is shown in SEQ ID NO.102 and the reverse primer is shown in SEQ ID NO.135; The forward primer for detecting the T14H4 subtype of the fusion gene TCF3-HLF is shown in SEQ ID NO.136 and the reverse primer is shown in SEQ ID NO.106; The forward primer for detecting the Z4R5 subtype of the fusion gene ZBTB16-RARA is shown in SEQ ID NO.110 and the reverse primer is shown in SEQ ID NO.134; The forward primer whose sequence is shown as SEQ ID NO.7 and the reverse primer whose sequence is shown as SEQ ID NO.10 for detecting the F6E9 subtype of the fusion gene FUS-ERG; The forward primer for detecting the M1E2 subtype of the fusion gene MNX1-ETV6 is shown in SEQ ID NO.137 and the reverse primer is shown in SEQ ID NO.138; and The sequence of the forward primer for detecting the M1E3 subtype of the fusion gene MNX1-ETV6 is shown as SEQ ID NO.137 and the sequence of the reverse primer is shown as SEQ ID NO.

139.

2. Use of the primer set according to claim 1 in preparing a kit for detecting blood tumor fusion genes.

3. A kit for detecting blood tumor fusion genes, characterized in that: The kit comprises the primer set for detecting blood tumor fusion gene according to claim 1.

4. The kit for detecting blood tumor fusion gene according to claim 3, characterized in that: The working concentration of the primer set is 0.08 μM to 0.12 μM.

Images