A genetic modification method for changing cat fur color

Abstract

The present invention discloses a genetic modification method for changing the fur color of a cat, comprising: using CRISPR / Cas9 technology to target the 17th exon of the cat KIT gene for gene editing. The present invention also provides a sgRNA specifically targeting the 17th exon of the cat KIT gene, a CRISPR / Cas9 expression vector comprising the sgRNA, and its use in changing the fur color of a cat. The present invention uses CRISPR / Cas9 technology to edit the 17th exon of the KIT gene of a civet cat, so that accurate gene modification can be achieved in the genome of the civet cat, and the fur color traits of the civet cat can be changed in a targeted manner, which can avoid the introduction of foreign cat bloodlines while changing the fur color traits in the traditional hybrid breeding process, affecting the original appearance and characteristics of the civet cat, and at the same time, no exogenous DNA sequence is introduced, effectively avoiding the biosafety risks that may be caused by traditional transgenic technology.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a genetic modification method for changing cat fur color. Background Art

[0002] In the field of changing the coat color of cats, the hybridization method between different breeds is usually used. This technology usually uses one cat as the mother and another cat as the father to breed to obtain the first generation of hybrids, and then backcrosses with the mother for multiple times to fix the coat color phenotype. However, this technology will change other traits such as the appearance and body shape of a cat while changing its coat color, and the phenotypic changes are difficult to control. This may be because, when using traditional hybrid breeding technology, while changing the coat color of a cat, the introduction of the genome of another cat will change the expression of most genes, thereby changing other traits except coat color. Summary of the invention

[0003] The object of the present invention is to provide a method for specifically and stably changing the fur color of a cat in view of the above technical problems to be solved.

[0004] In order to achieve the above invention objectives, the present invention provides a genetic modification method for changing cat fur color, which comprises: using CRISPR / Cas9 technology to target exon 17 of the cat KIT gene for gene editing.

[0005] The method according to the present invention can be used for non-disease diagnosis and treatment purposes.

[0006] According to the method of the present invention, preferably, the specific steps of the method are:

[0007] (1) Construction of a CRISPR / Cas9 expression vector targeting exon 17 of the feline KIT gene;

[0008] (2) Transfecting the CRISPR / Cas9 expression vector into cat skin fibroblasts.

[0009] According to the method of the present invention, preferably, in step (1), in step (1), the sgRNA specifically targeting exon 17 of the cat KIT gene includes pX458-KIT-sgRNA1 and pX458-KIT-sgRNA2, the nucleotide sequence of pX458-KIT-sgRNA1 is shown in SEQ ID NO: 1, and the nucleotide sequence of pX458-KIT-sgRNA2 is shown in SEQ ID NO: 2.

[0010] According to the method of the present invention, preferably, in step (1), pX458 is used to construct a CRISPR / Cas9 expression vector.

[0011] According to the method of the present invention, preferably, the cat is a tabby cat.

[0012] On the other hand, the present invention also provides an sgRNA that specifically targets exon 17 of the cat KIT gene, wherein the sgRNA includes pX458-KIT-sgRNA1 and pX458-KIT-sgRNA2, the nucleotide sequence of pX458-KIT-sgRNA1 is shown in SEQ ID NO: 1, and the nucleotide sequence of pX458-KIT-sgRNA2 is shown in SEQ ID NO: 2.

[0013] On the other hand, the present invention also provides a CRISPR / Cas9 expression vector, which comprises the sgRNA that specifically targets exon 17 of the cat KIT gene.

[0014] On the other hand, the present invention also provides the use of the sgRNA specifically targeting exon 17 of the cat KIT gene in changing the cat's coat color.

[0015] On the other hand, the present invention also provides the use of a recombinant expression vector containing the sgRNA specifically targeting exon 17 of the cat KIT gene in changing the coat color of a cat.

[0016] On the other hand, the present invention also provides the use of the sgRNA specifically targeting exon 17 of the cat KIT gene in constructing a cat KIT gene mutation library.

[0017] This technology constructs a CRISPR / Cas9 expression vector targeting exon 17 of the cat KIT gene, transfects cat skin fibroblasts, enriches EGFP-positive cells by flow sorting technology, extracts genomic PCR products for TA cloning and sequencing analysis, and detects the editing activity of CRISPR / Cas9 on the KIT gene. After verifying that its editing efficiency is more than 80%, gene-edited cloned embryos are constructed by somatic cell nuclear transfer technology, and further implanted into the fallopian tube of a surrogate tabby cat through embryo transfer surgery. After a normal pregnancy, a KIT gene-edited tabby cat with white fur is obtained.

[0018] First, the present invention uses CRISPR / Cas9 technology to edit the 17th exon of the KIT gene of the tabby cat, so that accurate gene modification can be achieved in the genome of the tabby cat without introducing any exogenous DNA sequence, effectively avoiding the biosafety risks that may be caused by traditional transgenic technology. Secondly, the present invention uses gene editing technology to change the coat color traits of the tabby cat in a targeted manner, which can avoid the introduction of foreign cat bloodlines while changing the coat color traits in the traditional hybrid breeding process, affecting the original appearance and characteristics of the tabby cat. It can be seen that the present invention uses CRISPR / Cas9 to accurately edit the cat KIT gene, does not introduce any exogenous DNA sequence, and specifically changes the cat's coat color, which is of great significance for breeding cats of various colors that meet consumer needs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A map of the Cas9 / sgRNA co-expression vector pX458 is shown.

[0020] Figure 2 Flow cytometric sorting of edited cells and gene identification results are shown.

[0021] Figure 3 The results of TA cloning sequencing analysis of the gene editing efficiency of pX458-KIT-sgRNA1 and pX458-KIT-sgRNA2 in cat skin fibroblasts are shown.

[0022] Figure 4 Genotype identification results are shown.

[0023] Figure 5 The TA cloning sequencing results of the gene-edited cat are shown.

[0024] Figure 6 The image shows how KIT ​​gene editing changes the coat color of a tabby cat. The left image shows a gene-edited tabby cat, and the right image shows a wild-type tabby cat.

[0025] Figure 7 Shown is KIT gene editing changing the color of a tabby cat's foot pads.

[0026] Figure 8 The results of hair follicle melanin staining are shown. DETAILED DESCRIPTION

[0027] The present invention will be further described below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention, rather than to limit the scope of the present invention.

[0028] 1. KIT gene target site selection:

[0029] The full-length sequence of the cat KIT gene (NC_058371) was downloaded from NCBI, and two sgRNAs targeting the cat KIT gene were designed. The specific sequences are shown in Table 1.

[0030] Table 1: sgRNA sequence information targeting cat KIT gene

[0031] name sequence PAM pX458-KIT-sgRNA1 GGCTTCGCACTGAAACTATT (SEQ ID NO: 1) CGG pX458-KIT-sgRNA2 TCTGCTTGACAGTCCAATGA (SEQ ID NO: 2) AGG

[0032] In Table 1, PAM (protospacer-adjacent motif) refers to the sgRNA binding motif.

[0033] 2. Construction of sgRNA / Cas9 co-expression vector targeting cat KIT gene:

[0034] The construction method of the sgRNA / Cas9 co-expression vector targeting the cat KIT gene is as follows:

[0035] The pX458 vector can simultaneously express sgRNA, Cas9 protein with humanized optimized codons, and the reporter gene EGFP. The map of the Cas9 / sgRNA co-expression vector pX458 is as follows: Figure 1 shown.

[0036] According to the two sgRNA sequences in Table 1, the corresponding oligonucleotide positive and negative single strands were synthesized, and the corresponding sticky ends of BbsⅠ were added to each single strand. First, the positive and negative oligonucleotide chains of sgRNA were phosphorylated and annealed using T4 PNK enzyme to form double-stranded DNA short fragments with BbsⅠ sticky ends, and the synthesized positive and negative single strands were phosphorylated. 1μg pX458 vector was digested with BbsⅠ, and the linearized plasmid was subjected to electrophoresis. At the same time, the double-stranded DNA short fragment with BbsⅠ sticky ends was connected to the linearized pX458 vector using T4 ligase, and then the connection product was transformed into DH5α bacterial competent cells and coated on ampicillin-resistant LB plates. Finally, bacterial monoclones were selected, and sequencing was used to identify whether the sgRNA sequence was correctly inserted into the pX458 vector. The correct clone was selected for shaking culture, and the Cas9 / sgRNA expression vector targeting the cat KIT gene was extracted.

[0037] 3.Culture and transfection of fetal fibroblasts:

[0038] Isolation of cat fetal fibroblasts.

[0039] A female cat that died of dystocia was brought back from the pet hospital. The fetus (about 40 days old) was obtained by hysterectomy. The surface of the uterus was cleaned with PBS, soaked in alcohol for 1 min, and then immediately washed with PBS. The uterus was carefully cut open, the fetus wrapped in the placenta was peeled off, and it was washed with PBS several times. Then the placenta was cut open, the fetus was taken out, and it was washed with PBS several times. The fetal skin tissue was cut and chopped, then transferred to a 50ml centrifuge tube, 0.1% (w / v) type I collagenase was added, placed in a water bath shaker, digested at 37°C for 1 hour, cell culture medium was added to terminate the digestion, 1500rpm / min, centrifuged for 10min, the supernatant was discarded, cell culture medium was added again, after blowing and mixing the cells, 1500rpm / min, centrifuged for 10min, and the supernatant was discarded. The cells were resuspended in cell culture medium, inoculated into a 100mm cell culture dish, and placed in a CO2 incubator for culture. The cell adhesion was observed for 48 hours, the medium was changed every 2 days, and the cell confluence was 70-80% when the cell was passaged to obtain fetal fibroblasts.

[0040] Feline fetal fibroblasts were grown in DMEM / F12 medium containing 20% ​​fetal bovine serum and double antibodies (100U / mL penicillin and 100mg / mL streptomycin). The medium was changed once after 1-2 days of cell culture. When the cells grew to a confluence of about 80%, they were washed twice with PBS, then digested with trypsin for 2 minutes, and then serum was added to terminate the digestion. The digested cells were collected in a 15mL centrifuge tube for centrifugation, the supernatant was discarded, and then washed with PBS and centrifuged a second time. After centrifugation, the supernatant was discarded, and the cells were resuspended with an appropriate amount of Buffer R solution (Thermo Fisher, Cat. No.: MPK10096) to a cell density of 5.0×10 6 cells / mL.

[0041] The sgRNA / Cas9 expression vector targeting the cat KIT gene was transfected into cat fetal fibroblasts by electroporation. TM The transfection system electroporates the cells under the following conditions: voltage 1600 V, width 10 ms, and pulse number 3.

[0042] 24 h after cell transfection, the culture medium was replaced, double antibodies (100 U / mL penicillin and 100 mg / mL streptomycin) were added, and the cells were cultured under 5% CO2 and 37°C.

[0043] After 2 days, perform flow cytometry analysis, sort or collect cells to extract DNA for subsequent experiments.

[0044] 4. Flow cytometric analysis and sorting:

[0045] First, the adherent fetal fibroblasts were digested with 2% trypsin, then resuspended into single cells with PBS, filtered into a flow tube through a nylon membrane with a pore size of 40 μm, and the fluorescence ratio and intensity of the cells were analyzed on a flow cytometer. EGFP-positive cells were sorted out using a flow cytometer and inoculated into a 12-well plate for further culture. Figure 2 The results of flow cytometry-sorted edited cells and gene identification are shown. Figure 2 As shown, the band at 430 bp is the gene band size of unedited fetal fibroblasts of cats, and the band at 144 bp is the gene band size of edited fetal fibroblasts of cats.

[0046] Among the sorted cells, some cells were used for somatic cell nuclear transplantation, and the remaining cells were used to extract genomic DNA.

[0047] 5. Sequencing analysis:

[0048] The KIT gene fragment containing the site recognized by sgRNA was amplified using high-fidelity Taq enzyme, separated by agarose gel electrophoresis, and then recovered using a gel recovery kit. The recovered fragment was cloned into the pMD19-T vector, and several single colonies were selected after transformation for sequencing analysis of the efficiency of CRISRP / Cas9 in causing mutations at the cleavage site.

[0049] TA cloning to evaluate gene editing efficiency Figure 3 As shown in the figure, among the 8 PCR clones obtained, 7 of the pX458-KIT-sgRNA1 and pX458-KIT-sgRNA2 target sites were mutated, and the gene editing efficiency was about 80% ( Figure 3 ).

[0050] Based on the above results, pX458-KIT-sgRNA1 and pX458-KIT-sgRNA2 have high gene editing efficiency in fetal fibroblasts and can be used for subsequent nuclear transplantation experiments.

[0051] 6. In vitro maturation of oocytes:

[0052] The ovaries of female cats were collected, and the ovarian follicles were cut with a blade under a stereoscope, and the oocytes with more cumulus cells were selected. After washing with TALP-HEPES culture medium, the basal culture medium DMEM was used, and 10% FBS (Fetal Bovine Serum), 1μg / ml FSH (follicle-stimulating hormone), 1μg / ml LH (Luteinizing Hormone), and 20ng / ml EGF (Epidermal Growth Factor) were added for in vitro maturation for 22-24h.

[0053] 7. Somatic Cell Nuclear Transfer Operation:

[0054] First, the gene-edited cat fetal fibroblasts sorted above were digested with 2% trypsin, and then the cells were evenly dispersed and added to the DMEM culture medium for standby use. The mature cat oocytes cultured for 22-24 hours were repeatedly blown with a glass pipette until the cumulus cells were completely removed.

[0055] Oocytes containing the first polar body were selected under a stereoscope. Oocytes with uniform cytoplasm and normal morphology were stained with Hochest33342.

[0056] After cleaning, the oocytes were completely enucleated using a NIKON micromanipulator under a 200x objective. After enucleation, smooth, uniform, and transparent fibroblasts were selected and injected into the interoocyte space to form reconstructed embryos.

[0057] After the reconstructed embryos were equilibrated in fusion solution (0.3 M mannitol, 0.1 mM CaCl2, 0.1 mM MgSO4·7H2O), they were electrofused at 210 kv / cm for 50 μs. After 30 min, the fused cloned embryos were chemically activated with 5 μM ionomycin for 5 min, then washed and cultured in SOF medium containing 2 mM 6-DMAP for 4 h. Finally, the cloned embryos were transferred to SOF medium for in vitro culture in a CO2 incubator (38.5°C, 5% CO2, 100% humidity). The embryonic division was observed for 2 days, and the blastocyst development was observed for 7 days.

[0058] 8. Embryo transfer:

[0059] The female cats in estrus were selected and anesthetized by intravenous injection of domitor (0.03ml / kg). After disinfecting the abdomen, the skin and subcutaneous tissue were cut in turn below the navel in the midline of the abdomen, the muscle layer was bluntly separated, the peritoneum was cut, and the ovaries and fallopian tubes were taken out of the abdominal cavity. The cloned embryos were sucked out with a straw, and the embryos were injected from the fimbria of the fallopian tube. Finally, the wound was sutured and disinfected. After the operation, the recipient cat's wound was disinfected with iodine for three consecutive days to prevent infection. Depending on the recovery of the wound, the stitches were removed in about 7 days.

[0060] 9. Pregnancy test and delivery of recipient cats:

[0061] Monitor the mother cat's pregnancy with ultrasound at 28 days; one week before delivery, pay attention to whether there is red mucus discharge from the vagina and be prepared for delivery at any time until the kittens are born.

[0062] 10. Identification of CRISPR / Cas9 editing efficiency in newborn tabby cats:

[0063] Umbilical cord samples of newborn civet cats (Feles maculosa) were taken to extract genomic DNA for genotyping. The results are as follows: Figure 4 As shown, the wild-type tabby cat has only one distinct band of 430bp, while the edited cat has two distinct bands of 430bp and 144bp, which preliminarily indicates that the KIT gene carried by the tabby cat has been edited.

[0064] The exon 17 fragment of the KIT gene was amplified by PCR for each individual, and then TA cloning and sequencing were performed to determine the genotype. Figure 5 As shown, in the KIT gene fragment, one allele produced a 9bp deletion, while the other allele produced a 286bp deletion, further proving that the KIT gene of the tabby cat was edited. Figure 3 is the result of gene identification at the cellular level, and Figure 5 This is the result of gene identification at the in vivo level. Figure 3 The edited cell nucleus was successfully transplanted into the living body.

[0065] The statistical results of embryo transplantation and editing efficiency of born kittens are shown in Table 2 below.

[0066] Table 2: Editing efficiency of embryo transplantation and newborn civet cats

[0067]

[0068] 11. Editing exon 17 of the KIT gene changes the fur and skin color of the tabby cat:

[0069] like Figure 6As shown, after exon 17 of the KIT gene was knocked out in newborn kittens, the expression of pigment-related genes was affected, causing the original black and gray stripes and "tiger-skin" shaped tabby cat's fur color to turn light gray. Figure 6 Middle: The left is a gene-edited tabby cat, and the right is a wild-type tabby cat.

[0070] In addition, it can be found through observation that the skin of the paws of the tabby cat is originally black ( Figure 7 , left, wild type), after exon 17 of the KIT gene was knocked out, the skin in this area also turned white ( Figure 7 , right, gene-edited type).

[0071] 12. Effect of editing exon 17 of KIT gene on hair follicle melanin:

[0072] The distribution of melanin in the hair follicles of gene-edited cats was observed by melanin staining.

[0073] Skin tissues of wild-type tabby cats and gene-edited tabby cats of about 1cm×1cm were selected and fixed with 4% paraformaldehyde in a 4°C refrigerator for 48h. After fixation, the skin tissues were removed, rinsed three times with PBS, and then immersed in 70% v / v alcohol for permanent preservation or for the next experiment.

[0074] Select skin samples with relatively uniform hair follicle distribution, rinse with running water for 4 h to clean out the paraformaldehyde, and then dehydrate and wax. The procedure is shown in Table 3.

[0075] Table 3: Cat skin tissue dehydration procedure

[0076] step Components time 1 70% v / v ethanol 1h 2 80% v / v ethanol 1h 3 90% v / v ethanol 1h 4 95% v / v ethanol 1h 5 100% v / v ethanol 30min 6 100% v / v ethanol 30min 7 100% v / v ethanol / TO (biological product clearing agent) (50 / 50) 30min 8 TO (Biological Products Transparent Agent) 30min 9 TO (Biological Products Transparent Agent) 1h 10 paraffin 30min 11 paraffin 3h 12 paraffin 2h

[0077] After the procedure, the skin tissue was transferred to a tissue embedding machine and embedded with high melting point paraffin, with the longitudinal section facing upward. After embedding, the skin tissue was sliced ​​with a paraffin slicer with a thickness of 5 μm. After slicing, the skin tissue was placed in a 65°C oven for 30 min. The slices were removed from the oven and transferred to a xylene solution for dewaxing for 10 min, and repeated 3 times. The skin tissue was rehydrated with gradient alcohol: 100% v / v ethanol, 5 min; 100% v / v ethanol, 5 min; 90% v / v ethanol, 5 min; 80% v / v ethanol, 5 min; 70% v / v ethanol, 5 min; 50% v / v ethanol, 5 min; ultrapure water, 5 min; ultrapure water, 5 min. After rehydration, the next step of the melanin staining experiment was performed according to the instructions of the Fontana-Masson melanin staining kit.

[0078] like Figure 8As shown, the section staining results showed that the hair follicles of wild-type tabby cats were full of melanin, while the melanin content in the hair follicles of gene-edited tabby cats was relatively low.

Claims

1. A genetic modification method for changing cat fur color, comprising: CRISPR / Cas9 technology was used to target exon 17 of the cat KIT gene for gene editing; The specific steps of the method are: (1) Construction of a CRISPR / Cas9 expression vector targeting exon 17 of the cat KIT gene; (2) transfecting cat skin fibroblasts with the CRISPR / Cas9 expression vector; In the step (1), the sgRNA specifically targeting exon 17 of the cat KIT gene includes pX458-KIT-sgRNA1 and pX458-KIT-sgRNA2, the nucleotide sequence of pX458-KIT-sgRNA1 is shown in SEQ ID NO: 1, and the nucleotide sequence of pX458-KIT-sgRNA2 is shown in SEQ ID NO:

2.

2. The method according to claim 1, characterized in that In the step (1), pX458 is used to construct a CRISPR / Cas9 expression vector.

3. The method according to claim 1, characterized in that The cat is a tabby cat.

4. A sgRNA specifically targeting exon 17 of the cat KIT gene, characterized in that: The sgRNA includes pX458-KIT-sgRNA1 and pX458-KIT-sgRNA2, the nucleotide sequence of pX458-KIT-sgRNA1 is shown in SEQ ID NO: 1, and the nucleotide sequence of pX458-KIT-sgRNA2 is shown in SEQ ID NO:

2.

5. A CRISPR / Cas9 expression vector comprising the sgRNA specifically targeting exon 17 of the cat KIT gene according to claim 4.

6. Use of the sgRNA specifically targeting exon 17 of the cat KIT gene according to claim 4 in changing cat fur color.

7. Use of a recombinant expression vector containing the sgRNA specifically targeting exon 17 of the cat KIT gene according to claim 4 in changing cat fur color.

Images