Centrifugal microfluidic chip
By designing arc channels and reflux channels in a centrifugal microfluidic chip, the surface tension of the liquid inside the liquid reflux can be used to achieve automatic reflux of the sample, solving the problem of complex positioning after sample processing, simplifying the operation process and improving accuracy.
Patent Information
- Application Number
- CN202211281531.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-19
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2042-10-19
AI Technical Summary
Existing centrifugal microfluidic chips require complex positioning operations during the automatic recovery process after sample processing, which is difficult to simplify.
A centrifugal microfluidic chip is designed, including arc-shaped channels and reflux channels. The inner wall of the channel has liquid repellent characteristics. The surface tension is used to automatically return the sample liquid to the recovery chamber under the action of centrifugal forces, simplifying the positioning process.
The sample liquid automatically returns to the recycling chamber after the microfluidic chip stops rotating, avoiding complex positioning operations and improving operation simplicity and accuracy.
Smart Images

Figure CN115970773B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the technical field of microfluidic chips, and more particularly to centrifugal microfluidic chips. Background Art
[0002] Centrifugal microfluidic chips are a type of microfluidic chips commonly used in some fields such as immunoassay and nucleic acid detection. The flow of microfluid is driven by centrifugal force to achieve the detection of samples. However, in the process of its application, it is found that when automatically recovering the processed samples, complex processing is required for the chamber where the product is located according to parameters such as the reference point and the position and angle of the chamber from the center of the circle to complete positioning, and then the recovery operation can be completed by a manipulator. Therefore, it is necessary to provide a microfluidic chip that can simplify the operation. Summary of the Invention
[0003] This application aims to solve at least one of the technical problems existing in the prior art. For this purpose, this application proposes a centrifugal microfluidic chip, which can effectively solve the positioning problem and make the operation simpler.
[0004] In the first aspect of this application, a centrifugal microfluidic chip is provided. The centrifugal microfluidic chip includes a processing structure and a reflux structure arranged in sequence along the movement direction of the sample liquid. The reflux structure includes:
[0005] An arc-shaped channel, which is connected to the processing structure;
[0006] A recovery chamber, which is located at the center of the centrifugal microfluidic chip;
[0007] A reflux channel, which connects the arc-shaped channel and the recovery chamber. The size of the reflux channel gradually decreases in the direction away from the recovery chamber, and the size of the reflux channel is larger than that of the arc-shaped channel;
[0008] Among them, the arc-shaped channel and the reflux channel have liquid-repellent inner walls, which can make the sample liquid flowing through the arc-shaped channel flow back to the recovery chamber through the reflux channel in the opposite direction of the centrifugal force.
[0009] The centrifugal microfluidic chip according to the embodiment of this application has at least the following beneficial effects:
[0010] The centrifugal microfluidic chip provided by the embodiments of the present application is added with a reflux structure. Under the centrifugal state, after the microfluidic chip completes the processing of the sample solution, the sample solution containing the product enters the arc-shaped channel. Due to the liquid-repellent inner walls of the arc-shaped channel and the reflux channel, the contact angle between the sample solution and the arc-shaped channel and the reflux channel is large, and the sliding angle is small, so that the sample solution cannot slide and spread in the two channels. At the position where the channel size is smaller, the surface tension effect is stronger, and the size of the reflux channel is larger than that of the arc-shaped channel. Therefore, after the microfluidic chip stops rotating, the sample solution in the arc-shaped channel will enter the reflux channel under the action of the surface tension and further enter the recovery chamber located at the center of the circle. In this way, when it is necessary to recover or detect the reaction product, the recovery chamber with a relatively unchanged position can be directly operated and processed, avoiding the positioning problem.
[0011] In some embodiments of the present application, the liquid-repellent inner walls of the arc-shaped channel and the reflux channel are super-liquid-repellent inner walls.
[0012] In some embodiments of the present application, the liquid-repellent inner walls of the arc-shaped channel and the reflux channel are hydrophobic inner walls.
[0013] In some embodiments of the present application, the liquid-repellent inner walls of the arc-shaped channel and the reflux channel are super-hydrophobic inner walls.
[0014] In some embodiments of the present application, the liquid-repellent inner walls of the arc-shaped channel and the reflux channel are inner walls modified with a liquid-repellent coating.
[0015] In some embodiments of the present application, the liquid-repellent coatings of the arc-shaped channel and the reflux channel are super-liquid-repellent coatings.
[0016] In some embodiments of the present application, the liquid-repellent coatings of the arc-shaped channel and the reflux channel are hydrophobic coatings.
[0017] In some embodiments of the present application, the liquid-repellent coatings of the arc-shaped channel and the reflux channel are super-hydrophobic coatings.
[0018] In some embodiments of the present application, the raw materials of the super-hydrophobic coating include polymers and micro-nano particles.
[0019] In some embodiments of the present application, the polymer includes a low surface energy polymer.
[0020] In some embodiments of the present application, the low surface energy polymer includes a low surface energy polysiloxane.
[0021] In some embodiments of the present application, the polymer includes polydimethylsiloxane (PDMS).
[0022] In some embodiments of the present application, the low surface energy is a surface energy lower than 100 mN / m.
[0023] In some embodiments of the present application, the low surface energy is a surface energy lower than 50 mN / m.
[0024] In some embodiments of the present application, the low surface energy is a surface energy lower than 25 mN / m.
[0025] In some embodiments of the present application, the micro-nano particles include silica nanoparticles.
[0026] In some embodiments of the present application, the micro-nano particles are modified with a coupling agent.
[0027] In some embodiments of the present application, the coupling agent is a silane coupling agent.
[0028] In some embodiments of the present application, the size of the arc-shaped channel gradually decreases or remains unchanged along the flow direction of the sample liquid.
[0029] In some embodiments of the present application, the distance from the arc-shaped channel to the center of the circle gradually increases or remains unchanged along the flow direction of the sample liquid.
[0030] In some embodiments of the present application, a waste liquid chamber is further provided downstream of the arc-shaped channel along the movement direction of the sample liquid.
[0031] In some embodiments of the present application, the arc-shaped channel and the waste liquid chamber are connected through a first connecting pipe. The first connecting pipe has a liquid-repellent inner wall, and the size of the first connecting pipe is smaller than the size of the end of the arc-shaped channel along the movement direction of the sample liquid.
[0032] In some embodiments of the present application, the arc-shaped channel and the processing structure are connected through a second connecting pipe. The second connecting pipe has a liquid-repellent inner wall.
[0033] In some embodiments of the present application, the liquid-repellent inner walls of the first connecting pipe and the second connecting pipe are super-liquid-repellent inner walls.
[0034] In some embodiments of the present application, the liquid-repellent inner walls of the first connecting pipe and the second connecting pipe are hydrophobic inner walls.
[0035] In some embodiments of the present application, the liquid-repellent inner walls of the first connecting pipe and the second connecting pipe are super-hydrophobic inner walls.
[0036] In some embodiments of the present application, the liquid-repellent inner walls of the first connecting pipe and the second connecting pipe are inner walls modified with a liquid-repellent coating.
[0037] In some embodiments of the present application, the liquid-repellent coatings of the first connecting pipe and the second connecting pipe are super-liquid-repellent coatings.
[0038] In some embodiments of the present application, the liquid-repellent coatings of the first connecting pipe and the second connecting pipe are hydrophobic coatings.
[0039] In some embodiments of the present application, the liquid-repellent coatings of the first connection pipe and the second connection pipe are superhydrophobic coatings.
[0040] In some embodiments of the present application, the processing structure includes, arranged in sequence along the movement direction of the sample liquid:
[0041] A sample injection chamber for injecting a sample liquid containing a first encapsulation body, and the first encapsulation body includes nucleic acid molecules;
[0042] A de-encapsulation unit for releasing the nucleic acid molecules from the first encapsulation body;
[0043] An amplification unit for amplifying the released nucleic acid molecules;
[0044] A re-encapsulation unit for forming a second encapsulation body with the nucleic acid molecules, and the re-encapsulation unit is connected to the arc-shaped channel.
[0045] In some embodiments of the present application, the sample injection chamber is communicated with the de-encapsulation unit through a third connection pipe, the de-encapsulation unit is communicated with the amplification unit through a fourth connection pipe, and the amplification unit is communicated with the re-encapsulation unit through a fifth connection pipe. The third connection pipe, the fourth connection pipe, and the fifth connection pipe have liquid-repellent inner walls.
[0046] In some embodiments of the present application, the liquid-repellent inner walls of the third connection pipe, the fourth connection pipe, and the fifth connection pipe are super-liquid-repellent inner walls.
[0047] In some embodiments of the present application, the liquid-repellent inner walls of the third connection pipe, the fourth connection pipe, and the fifth connection pipe are hydrophobic inner walls.
[0048] In some embodiments of the present application, the liquid-repellent inner walls of the third connection pipe, the fourth connection pipe, and the fifth connection pipe are superhydrophobic inner walls.
[0049] In some embodiments of the present application, the liquid-repellent inner walls of the third connection pipe, the fourth connection pipe, and the fifth connection pipe are inner walls modified with liquid-repellent coatings.
[0050] In some embodiments of the present application, the liquid-repellent coatings of the third connection pipe, the fourth connection pipe, and the fifth connection pipe are super-liquid-repellent coatings.
[0051] In some embodiments of the present application, the liquid-repellent coatings of the third connection pipe, the fourth connection pipe, and the fifth connection pipe are hydrophobic coatings.
[0052] In some embodiments of the present application, the liquid-repellent coatings of the third connection pipe, the fourth connection pipe, and the fifth connection pipe are superhydrophobic coatings.
[0053] In some embodiments of the present application, the amplification unit includes an amplification chamber and a buffer chamber that are in communication with each other, and the amplification chamber is located downstream of the buffer flow direction. In some embodiments of the present application, the amplification chamber is used to perform nucleic acid amplification reactions. The specific types of amplification reactions include, but are not limited to, traditional PCR amplification, loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), recombinase polymerase amplification (RPA), recombinase-mediated isothermal nucleic acid amplification (RAA), cross-priming amplification (CPA), rolling circle amplification (RCA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), nicking enzyme amplification reaction (NEAR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), signal-mediated RNA amplification (SMART), single primer isothermal amplification (SPIA), chimeric primer-mediated isothermal amplification (ICAN), ligase chain reaction (LCR), reticulated branching amplification method (RAM).
[0054] In a second aspect of the present application, there is also provided the use of the centrifugal microfluidic chip described above in nucleic acid data storage and reading.
[0055] In some embodiments of the present application, the nucleic acid data storage and reading is DNA data storage and reading.
[0056] In a third aspect of the present application, there is also provided a method for lossless reading of nucleic acid data, the lossless reading method including the following steps:
[0057] Providing a sample solution containing a first encapsulation body, the first encapsulation body including nucleic acid molecules, and the nucleic acid molecules storing data information;
[0058] Inputting the sample solution into the sample injection chamber of the centrifugal microfluidic chip described above;
[0059] Adjusting the rotation speed of the centrifugal microfluidic chip so that the sample solution sequentially passes through the de-encapsulation unit, the amplification unit, and the re-encapsulation unit to complete de-encapsulation, amplification, and re-encapsulation, and recovering a second encapsulation body from the recovery chamber;
[0060] Performing de-encapsulation on the second encapsulation body, collecting the nucleic acid molecules and sequencing them, and decoding the sequencing results into data information.
[0061] The reflux structure design provided by the centrifugal microfluidic chip in the embodiments of the present application can drive the second encapsulation body back to the central reflux chamber without relying on an additional external power source, avoiding the positioning problem, and thus making the nucleic acid data storage and reading more convenient and effective. In addition, combined with a specific liquid-repellent modification method, the opening and closing of the chambers in the microfluidic chip under different rotation speeds and the flow of the sample liquid therein are more accurate. Moreover, a processing structure including a de-encapsulation unit, an amplification unit, and a re-encapsulation unit is designed. In this way, during the storage and reading of nucleic acid data, by re-encapsulating the released nucleic acid molecules to form a second encapsulation body, the loss of the original sample in the process of nucleic acid molecule release and reading of the first encapsulation body is compensated, realizing lossless reading of nucleic acid data.
[0062] Additional aspects and advantages of the present application will be given in part in the following description, become apparent in part from the following description, or be learned through the practice of the present application. Brief Description of the Drawings
[0063] Figure 1 is a partial schematic diagram of a centrifugal microfluidic chip in an embodiment of the present application.
[0064] Figure 2 is a partial schematic diagram of the de-encapsulation chamber (a), amplification chamber (b), and re-encapsulation chamber (c) of a centrifugal microfluidic chip in an embodiment of the present application.
[0065] Figure 3 are photos of different processes in the simulation experiment of a centrifugal microfluidic chip in an embodiment of the present application and schematic diagrams of nucleic acids and encapsulation bodies in the corresponding processes.
[0066] Figure 4 is the electrophoresis result of the re-encapsulation experiment in an embodiment of the present application.
[0067] Reference Numerals: arc-shaped channel 110, recovery chamber 120, reflux channel 130, de-encapsulation chamber 200, first de-encapsulation sub-chamber 201, second de-encapsulation sub-chamber 202, first fence 210, amplification chamber 300, first amplification sub-chamber 301, second amplification sub-chamber 302, buffer chamber 310, second fence 320, re-encapsulation chamber 400, first re-encapsulation sub-chamber 401, second re-encapsulation sub-chamber 402, first raw material chamber 410, second raw material chamber 420, third fence 430, waste liquid chamber 500, air inlet hole 600, sample liquid 700, first connection pipe 810, second connection pipe 820, third connection pipe 830, fourth connection pipe 840, fifth connection pipe 850. Detailed Embodiments
[0068] The concept of this application and the resulting technical effects will be clearly and completely described below in conjunction with embodiments to fully understand the purpose, features, and effects of this application. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all embodiments. Based on the embodiments of this application, other embodiments obtained by those skilled in the art without creative efforts shall fall within the scope of protection of this application.
[0069] The embodiments of this application will be described in detail below. The described embodiments are exemplary and are only used to explain this application and should not be construed as a limitation of this application.
[0070] In the description of this application, the meaning of "several" is more than one, the meaning of "multiple" is more than two, "greater than", "less than", "exceeding", etc. are understood as not including the number itself, "above", "below", "within", etc. are understood as including the number itself, and the meaning of "about" is within the range of ±20%, 10%, 8%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, 0.1%, etc. of the number itself. If there is a description of "first" and "second", it is only for the purpose of distinguishing technical features and should not be construed as indicating or implying relative importance or implicitly indicating the quantity of the indicated technical features or implicitly indicating the sequence relationship of the indicated technical features.
[0071] In the description of this application, the description with reference to terms such as "one embodiment", "some embodiments", "schematic embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of this application. In this specification, the schematic descriptions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples.
[0072] Reference Figure 1 , a partial schematic diagram of a centrifugal microfluidic chip in an embodiment of this application is shown. The centrifugal microfluidic chip is provided with a reflux structure, and the reflux structure includes an arc-shaped channel 110, a recovery chamber 120, and a reflux channel 130. The size of the reflux channel 130 also gradually decreases in the direction away from the recovery chamber 120 (that is, from the d end to the c end, the size of the reflux channel 130 gradually decreases), and at the same time, the size of the reflux channel 130 is larger than the size of the arc-shaped channel 110. The reflux channel 130 communicates with the arc-shaped channel 110 and the recovery chamber 120. The recovery chamber 120 is located at the center of the centrifugal microfluidic chip. When the centrifugal microfluidic chip is working, it rotates around the center position, so the relative position of its center does not change.
[0073] In some of the specific embodiments, the connection mode between the reflux channel 130 and the arc channel 110 can be at least that the reflux channel 130 is connected to the middle of the arc channel 110. The specific position of the middle can be understood as at least any other position outside the end (b end) or the starting end (a end) of the arc channel 110 along the flowing direction of the sample liquid. Further, it can be any position within 1% - 99%, 5% - 95%, 10% - 90%, 15% - 85%, 20% - 80%, 25% - 75%, 30% - 70%, 35% - 65%, 40% - 60%, 45% - 55% of the length (the channel length from the a end to the b end) of the arc channel 110 along the flowing direction of the sample liquid 700. For example, the arc channel 110 is connected to the reflux channel 130 at the position of 1%, 2%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of its length starting from the a end.
[0074] The size of the reflux channel 130 or the arc channel 110 can be understood as at least the cross-sectional area perpendicular to the flowing direction of the sample liquid 700, which is determined by the width and height of the channel cross-section. The size of the reflux channel 130 is larger than that of the arc channel 110, at least the size of the c end, which is the smallest size of the reflux channel 130, is larger than the size of the a end, which is the largest size of the arc channel 110. To ensure the overall smoothness of the reflux channel 130 and facilitate the transfer of the sample liquid therein, the size of the reflux channel 130 gradually decreases along the direction away from the recovery chamber 120, which means that both its height and width gradually change, so as to make the size gradually decrease. The maximum size (the size of the d end) of the reflux channel 130 is related to the amount of the sample liquid 700 fed into the arc channel 110 by the processing structure. The larger the amount of the sample liquid 700 fed into the arc channel 110, the larger the maximum size of the reflux channel 130. For example, when the amount of the sample liquid 700 fed into the arc channel 110 is about 10 μl, the maximum size of the reflux channel 130 is (1 - 2) × (1 - 2) mm 2 , and so on.
[0075] In some of these embodiments, the arc-shaped channel 110 is a circular arc-shaped channel. For example, it can be a circular arc-shaped channel with a set central angle and radius centered on the center of the centrifugal microfluidic chip. In this case, the radius is related to the length of the reflux channel 130 and the specific settings of the processing structure of the centrifugal microfluidic chip, and the central angle can be adjusted arbitrarily according to the specific settings of the processing structure, which will not be elaborated here. For the above-mentioned arc-shaped channel 110, the distance from the center of the circle remains unchanged along the flow direction of the sample liquid 700. Of course, it can be understood that according to the movement process of the sample liquid 700 therein, the arc-shaped channel 110 can also be such that the distance from the center of the circle gradually increases along the flow direction of the sample liquid 700, that is, the radius of the arc-shaped channel 110 gradually increases along the flow direction of the sample liquid 700, showing a gradual expansion in the direction away from the center of the circle.
[0076] Reference Figure 1 , the principle of the reflux structure is further explained as follows:
[0077] When a part of the sample liquid 700 enters the arc-shaped channel 110 under the action of centrifugal force during the centrifugation process, at this time, the sample liquid 700 in the arc-shaped channel 110 is subjected to surface tensions (capillary forces) in three different directions, including the pressure p1 of the surface tension of the liquid surface near the a end, the pressure p3 of the surface tension of the liquid surface near the b end, and the pressure p2 of the surface tension of the liquid surface near the c end. The smaller the channel size, the stronger the surface tension, so the pressure p2 < p1 < p3. Therefore, the sample liquid 700 has a tendency to transfer from the position with a smaller size to the position with a larger size under the action of surface tension. At a set rotational speed, due to the action of additional centrifugal force, the sample liquid 700 remains in the arc-shaped channel 110. However, when the rotation stops, since the size of the c end of the reflux channel 130 is larger than the sizes of the arc-shaped channel 110, the sample liquid 700 will transfer to the reflux channel 130 under the action of surface tension and further move to the recovery chamber 120 under the action of surface tension. In this way, the position of the sample liquid 700 is fixed to the center position of the centrifugal microfluidic chip. Whether it is necessary to recover the product in the sample liquid 700 or collect image information and other operations, they can be directly performed by aligning with the center position. In the existing centrifugal microfluidic chips, during the automated operation process, it is necessary to program according to relevant parameter information such as the set reference point, the distance and angle of the target area from the center of the circle, etc., so as to complete the positioning of the sample liquid, and then control machines such as cameras or manipulators to operate. In this way, through the setting of the reflux structure, after the processing is completed, without relying on an external additional power source (such as an injection pump, etc.), the sample liquid containing the product can be self-driven to the center of the circle, reducing the positioning difficulty during automated operation and making the operation more convenient.
[0078] In addition to the setting of the reflux structure, the realization of the above principle also depends on the hydrophilicity and hydrophobicity of the inner walls of the arc-shaped channel 110 and the reflux channel 130 with respect to the sample liquid 700. Here, the inner walls of the arc-shaped channel 110 and the reflux channel 130 are hydrophobic inner walls. Among them, the "liquid" in hydrophobicity refers to the sample liquid. In other words, it is required that the contact angle of the sample liquid 700 with the inner walls of the arc-shaped channel 110 and the reflux channel 130 is greater than 90 degrees. Further, the hydrophobic inner wall can be a super-hydrophobic inner wall with super-hydrophobic properties, and it is required that the contact angle of the sample liquid 700 with the inner walls of the arc-shaped channel 110 and the reflux channel 130 is greater than 150 degrees and the sliding angle is less than 10 degrees. Taking the sample liquid 700 as a hydrophilic liquid (such as an aqueous solution) as an example, for the sample liquid 700 to undergo a reflux movement in the arc-shaped channel 110 and the reflux channel 130 into the recovery chamber 120, it is also required that the arc-shaped channel 110 and the reflux channel 130 have hydrophobic inner walls, and further it can be a super-hydrophobic inner wall (contact angle greater than 150 degrees and sliding angle less than 10 degrees). The capillary force (surface tension) generated between the hydrophobic inner wall and the sample liquid can drive the movement of the sample liquid to complete the reflux. Compared with ordinary hydrophobic inner walls, super-hydrophobic inner walls have excellent properties, so that the interfacial surface tension between the sample liquid and the inner wall is large enough while the frictional resistance is extremely small. Therefore, the surface tension of the liquid can be efficiently utilized to drive the sample liquid 700 to move in the channel, realizing more precise control of the reflux movement. Specifically, the super-hydrophobic inner wall has high control precision and a small error from the theoretically calculated centrifugal threshold. Therefore, for the processing structure, more grading can be set within a limited centrifugal speed range, and the rotational speed requirement for entering the reflux structure can also be lower. In some specific embodiments, the contact angle of the sample liquid 700 with the inner walls of the arc-shaped channel 110 and the reflux channel 130 is greater than 155 degrees, greater than 160 degrees, or greater than 165 degrees. In some specific embodiments, the sliding angle of the sample liquid 700 with the inner walls of the arc-shaped channel 110 and the reflux channel 130 is less than 9 degrees, 8 degrees, 7 degrees, 6 degrees, or 5 degrees.
[0079] The factors determining the hydrophobicity of the inner wall include the roughness of the material surface and the chemical composition of the material. Therefore, it can be achieved by at least one of modifying low-surface-energy substances on the inner wall or constructing micro-nano rough structures on the inner wall. Based on the above principle, specifically, hydrophobic channel inner walls can be obtained by methods such as the template method, etching method, phase separation method, chemical vapor deposition method, electrospinning method, layer-by-layer assembly method, sol-gel method, electrochemical deposition method, solution immersion method, etc.
[0080] In some of these specific embodiments, the inner walls of the arc-shaped channel 110 and the reflux channel 130 having superhydrophobicity are achieved by modifying a hydrophobic coating on the inner walls, that is, the liquid-repellent inner wall is the inner wall modified with a liquid-repellent coating. Further, the hydrophobic coating can be a superhydrophobic coating. Specifically, the hydrophobic coating can be completed by a processing technique using a hydrophobic coating reagent containing raw materials of a polymer and micro-nano particles. The specific method of processing can at least be completed by the method of covering the hydrophobic coating reagent on the inner wall of the channel and then drying. Further, the diameter D50 of the micro-nano particles is 1 nm to 1 μm, 1 nm to 100 nm, 5 nm to 50 nm, 5 nm to 20 nm. For example, it can be 1 nm, 2 nm, 3 nm, 5 nm, 10 nm, 20 nm, 50 nm, 100 nm, 200 nm, 500 nm, 1 μm. In some of these preferred embodiments, the diameter D50 of the micro-nano particles is about 15 nm. In some of these specific embodiments, the micro-nano particles can be inorganic micro-nano particles, organic micro-nano particles, hybrid micro-nano particles, metal micro-nano particles, etc. Non-limiting examples of inorganic micro-nano particles include at least one of carbon, calcium carbonate, silicon dioxide, titanium dioxide, aluminum oxide, zinc oxide, aluminum silicate, aluminum hydroxide, zinc phosphate, aluminum phosphate, zinc sulfate, barium sulfate, etc. Non-limiting examples of organic micro-nano particles include at least one of polyethylene, polyvinyl chloride, polystyrene, polypropylene, polycarbonate, etc. Non-limiting examples of hybrid micro-nano particles include at least one of MOF (such as ZIF, UiO, MIL, PCN), COF, etc. Non-limiting examples of metal micro-nano particles include at least one of iron, copper, zinc, etc. In some of these specific embodiments, the polymer is a polymer with a low surface energy, and the hydrophobic property of the inner wall is achieved by the combined action of the low surface energy polymer and the micro-nano particles. The low surface energy polymers include, but are not limited to, low surface energy silicone resins (such as polysiloxanes), fluorocarbon resins, fluorosilicone resins, epoxy resins, etc. In some of these specific embodiments, the polymer includes the most commonly used polydimethylsiloxane (PDMS). Among them, the low surface energy means that the surface energy is lower than 100 mN / m, further lower than 50 mN / m, lower than 25 mN / m, 22 mN / m, 20 mN / m.Due to the poor compatibility between micro-nano particles and polymers, to avoid agglomeration affecting stability, the micro-nano particles can be hydrophobically modified to further improve the interfacial properties between the micro-nano particles and the polymers. Specific hydrophobic modification methods include, but are not limited to, using coupling agents such as silane coupling agents: 1H,1H,2H,2H-perfluorodecyltriethoxysilane (PFDTES), octadecyltrichlorosilane (OTS), aminopropyltriethoxysilane (APTES), fluorinated poly(butyl hexafluoromethacrylate-glycidyl methacrylate) polymer (PFG), hexadecyltrimethoxysilane (HDTMS), tetraethoxysilane (TEOS), ethoxymethyltrimethoxysilane (TMES), KH-550, KH-560, KH-570, and so on. The mass-volume ratio of the micro-nano particles to the coupling agent varies according to the specific type. In some specific embodiments, the mass-volume ratio is 1 g of micro-nano particles: 0.1 - 1 ml of coupling agent, further it can be 1 g of micro-nano particles: 0.3 - 0.6 ml of coupling agent, still further it is 1 g of silica micro-nano particles: 0.3 - 0.6 ml of coupling agent, and still further it is 1 g of silica micro-nano particles: 0.3 - 0.6 ml of PFDTES. In some specific embodiments, the mass ratio of the micro-nano particles to the polymer is 1:(0.1 - 10), further, the mass ratio of the micro-nano particles to the polymer is approximately 1:(0.2 - 5), 1:(0.5 - 3), 1:(1 - 2), 2:3.
[0081] It can be understood that the above embodiments are only illustrated by taking the sample liquid 700 as a hydrophilic liquid. When the sample liquid 700 is an oily liquid, the inner walls of the arc-shaped channel 110 and the reflux channel 130 can be oleophobic inner walls or super-oleophobic inner walls, as long as they have the corresponding liquid-repellent or super-liquid-repellent properties. Similarly, for the realization of the oleophobic inner wall or super-oleophobic inner wall, an oleophobic or super-oleophobic coating can be modified on its inner wall, as long as it belongs to the corresponding liquid-repellent coating or super-liquid-repellent coating. In addition, hydrophobic and oleophobic, as well as super-hydrophobic and super-oleophobic, are not completely opposite. In some embodiments, a super-dual-liquid-repellent inner wall can be considered, that is, it has liquid-repellent or super-liquid-repellent properties for both aqueous and oily sample liquids. For example, at least a super-dual-liquid-repellent coating can be prepared with a coating reagent containing an aluminum phosphate aqueous solution and fluorosilane-modified silica micro-nano particles.
[0082] In addition to the reflux structure, a processing structure connected to the reflux structure is provided upstream of the reflux structure along the movement direction of the sample liquid in the centrifugal microfluidic chip. According to the different uses of the centrifugal microfluidic chip, its processing structure also varies.
[0083] With the exponential growth of digital information volume, nucleic acid molecules including DNA are considered to be potential alternative storage media for data storage. Compared with traditional storage media such as optical discs and magnetic tapes, these nucleic acid molecules have higher data storage density and preservation time. For example, an end-to-end nucleic acid data storage system integrating nucleic acid molecule synthesis, storage, and sequencing has been developed for automated access to nucleic acid data. However, it is difficult to solve the problem of system miniaturization in the above-mentioned manner. For this reason, the above-mentioned centrifugal microfluidic chip can be considered to solve the problem, and multiple functional units are integrated in the processing structure thereof. The processing structure therein will be further described below by taking a centrifugal microfluidic chip for nucleic acid molecule data storage as an example.
[0084] In some specific embodiments, nucleic acid molecule data storage is completed by encapsulating nucleic acid molecules to form a protective encapsulation body, such as an encapsulation body that plays at least one of the roles of antioxidant, anti-free radical, anti-water vapor, anti-high and low temperature, anti-ultraviolet, anti-sunlight, anti-enzyme reaction, etc. For this reason, the material of the encapsulation body can be at least one of organic materials, inorganic materials, organic-inorganic composite materials, etc. Among them, organic materials include but are not limited to at least one of polyoxymethylene, polyether, polyacrylic acid, polyacrylamide, polypropylene, polyethylene, etc., inorganic materials include but are not limited to at least one of silicon dioxide, calcium carbonate, calcium phosphate, etc., and organic-inorganic composite materials include but are not limited to metal-organic frameworks MOFs (such as ZIF, UiO, PCN, MIL), covalent organic frameworks COFs (such as Py-Azine, TpPa-1, TPB-DMTP, TpOMe-Pa1, DhaTph, LZU1), etc. It can be understood that the encapsulation body can at least complete the encapsulation in a way of forming a shell outside the nucleic acid molecule or forming a solid blend with the nucleic acid molecule. The specific diameter of the encapsulation body can be, for example, 0.01μm to 1mm, further, it can be above 0.02μm, above 0.05μm, above 0.1μm, above 0.2μm, above 0.5μm, above 1μm, above 2μm, above 5μm, above 10μm, and at the same time below 500μm, below 200μm, below 100μm, below 50μm, below 20μm, etc. For example, the diameter is in the range of 0.02 to 500μm, 0.1 to 200μm, 1 to 100μm, 2 to 50μm, 5 to 20μm, etc.
[0085] After encapsulation, if it is necessary to read the information stored therein, it is first necessary to perform de-encapsulation processing to release the nucleic acid molecule from the encapsulation body, and then sequence and decode the information stored therein according to the original coding method. It can be understood that when using next-generation sequencing or other methods, it is also necessary to amplify the amount of nucleic acid molecules in advance by amplification for subsequent sequencing. In some specific embodiments, the amplification can be performed by traditional polymerase chain reaction (PCR) amplification. In other specific embodiments, the amplification program uses isothermal amplification to simplify the requirements of the microfluidic chip for heating components, such as loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HAD), recombinase polymerase amplification (RPA), recombinase-mediated isothermal nucleic acid amplification (RAA), cross-priming amplification (CPA), rolling circle amplification (RCA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), nicking enzyme amplification reaction (NEAR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), signal-mediated RNA amplification (SMART), single primer isothermal amplification (SPIA), chimeric primer-mediated isothermal amplification (ICAN), etc. Further, RPA technology can be used, which is fast, has low temperature requirements, and wide applicability. Of course, methods such as ligase chain reaction (LCR) and ramified network amplification (RAM) can also be used for amplification. After sequencing, it is also necessary to re-encapsulate the nucleic acid molecules and return them to their original positions to make up for the loss of the original sample, so as to achieve lossless extraction of nucleic acid samples. It can be understood that the nucleic acid molecule can be a DNA molecule or an RNA molecule. For the sake of stability and simplicity of amplification and sequencing, the nucleic acid molecule is preferably a DNA molecule.
[0086] In summary, in some specific embodiments, the functions of de-encapsulation, amplification, and re-encapsulation are integrated on the centrifugal microfluidic chip. Continuing to refer to Figure 1 , the processing structure includes a sample injection chamber, a de-encapsulation unit, an amplification unit, and a re-encapsulation unit arranged in sequence along the movement direction of the sample solution.
[0087] In some specific embodiments, in order to avoid the positioning problem during machine sample injection operation, the sample injection chamber is also arranged at the center of the centrifugal microfluidic chip. In this case, the sample injection chamber and the recovery chamber 120 are the same chamber, that is, during sample injection, the sample solution is input from the recovery chamber 120, and finally the sample solution 700 with the product returns to the recovery chamber 120 through the reflux structure for recovery or other operations such as collecting image information. In other embodiments, the sample injection chamber can also be set as another chamber different from the recovery chamber 120.
[0088] In some of the specific embodiments, the de-encapsulation unit disposed downstream of the sample introduction chamber along the direction of sample solution movement includes a de-encapsulation chamber 200, and a certain amount of de-encapsulation reagent can be added to the de-encapsulation chamber 200 in a pre-loading manner. Depending on the material type of the encapsulation body, the de-encapsulation reagent is also different. For example, for an encapsulation body mainly composed of calcium carbonate, the de-encapsulation reagent can be ethylenediaminetetraacetic acid (EDTA); for an encapsulation body mainly composed of a metal-organic framework, the de-encapsulation reagent can be a citrate buffer solution.
[0089] In some of the specific embodiments, the amplification unit disposed downstream of the de-encapsulation unit along the direction of sample solution movement includes a buffer chamber 310 and an amplification chamber 300. The amplification chamber 300 is located downstream of the de-encapsulation chamber 200, and the amplification chamber 300 is also located downstream of the buffer chamber 310. In some of the embodiments, there is no direct upstream-downstream relationship between the de-encapsulation chamber 200 and the buffer chamber 310. In some of the embodiments, the amplification chamber 300 is pre-loaded with amplification reagents, such as enzymes, dNTPs, etc. used in the amplification reaction.
[0090] In some of the specific embodiments, the re-encapsulation unit disposed downstream of the amplification unit along the direction of sample solution movement includes a re-encapsulation chamber 400. Considering the re-encapsulation reaction, in some of the embodiments, at least one re-encapsulation raw material chamber that is only connected to the re-encapsulation chamber 400 is separately provided upstream of the re-encapsulation chamber 400. In some of the embodiments, a first raw material chamber 410 and a second raw material chamber 420 that are separately connected to the re-encapsulation chamber 400 are at least provided upstream of the re-encapsulation chamber 400. For example, when re-encapsulating to form a calcium carbonate encapsulation body, the first raw material chamber 410 and the second raw material chamber 420 are respectively loaded with calcium chloride and sodium carbonate solutions; when re-encapsulating to form a metal-organic framework encapsulation body, the first raw material chamber 410 and the second raw material chamber 420 are respectively loaded with an organic ligand and a metal ion solution. The downstream of the re-encapsulation chamber 400 is connected to an arc-shaped channel 110 with a reflux structure.
[0091] In some of the specific embodiments, a waste liquid chamber 500 is further provided downstream of the arc-shaped channel 110 to prevent excessive sample solution inside the arc-shaped channel 110 or too high a centrifugal rotation speed, so as to collect the excess sample solution.
[0092] In some of these embodiments, the arcuate channel 110 gradually decreases in size along the flow direction of the sample liquid 700 therein (i.e., from the a end to the b end, the size of the arcuate channel 110 gradually decreases), so that the sample liquid therein gradually flows towards the waste liquid chamber 500 under the action of surface tension and centrifugal force at a specific rotational speed, and the arcuate channel 110 is directly used as a liquid-repellent valve. It can be understood that the size of the arcuate channel 110 can also remain unchanged along the flow direction of the sample liquid 700 therein. In some specific embodiments, the arcuate channel 110 and the waste liquid chamber 500 are connected through a first connecting pipe 810, and the inner wall of the first connecting pipe 810 has liquid-repellent or super-liquid-repellent characteristics, becoming a separate liquid-repellent valve. For this purpose, the size of the first connecting pipe 810 is preferably also smaller than the size of the end (b end) of the arcuate channel 110 along the movement direction of the sample liquid 700. The liquid-repellent valve formed in this way can ensure that the sample liquid 700 can preferentially return to the center through the reflux channel 130 without entering the waste liquid chamber 500 in advance. Among them, the size of the arcuate channel 110 gradually decreasing or remaining unchanged can at least refer to the cross-sectional area perpendicular to the flow direction of the sample liquid 700 gradually decreasing or remaining unchanged, which can be achieved by at least one of the height and width of the cross-section gradually decreasing or remaining unchanged, or both decreasing simultaneously. The relative relationship between the size of the first connecting pipe and the size of the end of the arcuate channel 110 is the same.
[0093] In some specific embodiments, the sample introduction chamber and the de-encapsulation unit are connected through a third connecting pipe 830, the de-encapsulation unit and the amplification unit are connected through a fourth connecting pipe 840, and the amplification unit and the re-encapsulation unit are connected through a fifth connecting pipe 850. The third connecting pipe 830, the fourth connecting pipe 840, and the fifth connecting pipe 850 have liquid-repellent inner walls. Similarly, the liquid-repellent inner wall can further be a super-liquid-repellent inner wall, a hydrophobic inner wall, or a super-hydrophobic inner wall, which can be achieved at least by modifying a liquid-repellent coating, a super-liquid-repellent coating, a hydrophobic coating, or a super-hydrophobic coating on the inner wall.
[0094] In some specific embodiments, the processing structure and the arcuate channel 110 are connected through a second connecting pipe 820, and the second connecting pipe 820 has a liquid-repellent inner wall. Further, the re-encapsulation chamber 400 (or the second small re-encapsulation chamber 402) and the arcuate channel 110 are connected through a second connecting pipe 820. Similarly, the liquid-repellent inner wall can further be a super-liquid-repellent inner wall, a hydrophobic inner wall, or a super-hydrophobic inner wall, which can be achieved at least by modifying a liquid-repellent coating, a super-liquid-repellent coating, a hydrophobic coating, or a super-hydrophobic coating on the inner wall. Using these second connecting pipes 820, third connecting pipes 830, fourth connecting pipes 840, and fifth connecting pipes 850 with liquid-repellent or super-liquid-repellent inner walls as valves, the rotational speed threshold for controlling the switch of the sample liquid flowing between different chambers is more accurate.
[0095] In some of these specific embodiments, a number of air inlets 600 are provided near the center of the circle in some of the chambers, such as the de-encapsulation chamber 200, the buffer chamber 310, the first raw material chamber 410, the second raw material chamber 420, and the re-encapsulation chamber 400, to balance the internal and external air pressures and prevent the influence of atmospheric pressure on fluid manipulation.
[0096] Reference Figure 2 of a, in some of these specific embodiments, a first fence 210 is provided in the de-encapsulation chamber 200, and the first fence 210 divides the de-encapsulation chamber 200 into a de-encapsulation first sub-chamber 201 and a de-encapsulation second sub-chamber 202. Reference Figure 2 of b, in some of these specific embodiments, a second fence 320 is provided in the amplification chamber 300, and the second fence 320 divides the amplification chamber 300 into an amplification first sub-chamber 301 and an amplification second sub-chamber 302. Reference Figure 2 of c, in some of these specific embodiments, a third fence 430 is provided in the re-encapsulation chamber 400, and the third fence 430 divides the re-encapsulation chamber 400 into a re-encapsulation first sub-chamber 401 and a re-encapsulation second sub-chamber 402. The structure of the fence is used to precisely control the dosage of the reagent for the next reaction. Only the reaction solution that enters the de-encapsulation second sub-chamber 202, the amplification second sub-chamber 302, and the re-encapsulation second sub-chamber 402 can enter the subsequent chambers to participate in the reaction, and the remaining reaction solution retained in the de-encapsulation first sub-chamber 201, the amplification first sub-chamber 301, and the re-encapsulation first sub-chamber 401 will be blocked by the fence, thus effectively realizing the quantitative control of the reagent.
[0097] In some of these specific embodiments, the sample injection chamber and the recovery chamber 120 are the same chamber. Therefore, the recovery chamber 120 is connected to the de-encapsulation unit through a third connecting pipe 830, and further the recovery chamber 120 is connected to the de-encapsulation chamber 200 or the de-encapsulation first sub-chamber 201 through the third connecting pipe 830.
[0098] In some of these specific embodiments, the de-encapsulation unit is connected to the amplification unit through a fourth connecting pipe 840. For example, the de-encapsulation chamber 200 (or the de-encapsulation second sub-chamber 202) can be connected to the amplification chamber 300 (or the amplification first sub-chamber 301) through the fourth connecting pipe 840.
[0099] In some of these specific embodiments, the amplification unit is connected to the re-encapsulation unit through a fifth connecting pipe 850. For example, the amplification chamber 300 (or the amplification second sub-chamber 302) can be connected to the re-encapsulation chamber 400 (or the re-encapsulation first sub-chamber 401) through the fifth connecting pipe 850.
[0100] In addition to the above-mentioned first connecting pipe 810, second connecting pipe 820, third connecting pipe 830, fourth connecting pipe 840, and fifth connecting pipe 850, the inner walls of any other one or more micro-pipes used to connect the chambers such as the de-encapsulation chamber 200, the first de-encapsulation sub-chamber 201, the second de-encapsulation sub-chamber 202, the amplification chamber 300, the first amplification sub-chamber 301, the second amplification sub-chamber 302, the buffer chamber 310, the re-encapsulation chamber 400, the first re-encapsulation sub-chamber 401, the second re-encapsulation sub-chamber 402, the first raw material chamber 410, the second raw material chamber 420, and the waste liquid chamber 500 can also be super-liquid-repellent inner walls, so as to better meet the control requirements for fluids such as sample liquids, and make the threshold requirements for the rotation speed of the fluid flowing between different chambers more accurate.
[0101] In addition, it should be noted that the connection between chambers (or pipes, channels) means that two chambers (or pipes, channels) are physically connected to each other. However, limited by the surface tension (capillary force) of the channels, in some of the connected or joined pipes, channels, and chambers, only when specific conditions such as a specific rotation speed are met, the resultant force of the surface tension and the centrifugal force will enable the sample liquid or reaction liquid such as reaction raw materials in them to enter another chamber from one chamber. The downstream of the sample liquid or buffer means the downstream of the flow direction of these reaction liquids. Further considering the basic working principle of the centrifugal microfluidic chip, one chamber (or pipe, channel) being located downstream of another chamber (or pipe, channel) means that while one chamber (or pipe, channel) is connected to another chamber (or pipe, channel), the distance between one chamber (or pipe, channel) and the center of the microfluidic chip is farther than the distance between the other chamber (or pipe, channel) and the center of the microfluidic chip, so that during rotation, under the action of centrifugal force, the reaction liquid can enter another chamber (or pipe, channel) from one chamber (or pipe, channel).
[0102] Combined Figure 1 , the specific principles and reaction processes of the processing structure and the reflux structure in some specific embodiments are described as follows:
[0103] (1) After the sample liquid is input from the recovery chamber 120, the microfluidic chip starts to rotate, thereby sending the sample liquid into the de-encapsulation chamber 200. The sample liquid reacts with the pre-loaded de-encapsulation reagent in it, dissolving the first encapsulation body encapsulating the nucleic acid molecules in the sample liquid, so that the nucleic acid molecules are released into the sample liquid therefrom.
[0104] (2) Increase the rotation speed to send the sample liquid containing free nucleic acid molecules in the de-encapsulation chamber 200 and the buffer in the buffer chamber 310 into the amplification chamber 300 pre-loaded with the amplification reagent for reaction, thereby amplifying the nucleic acid molecules in the sample liquid.
[0105] (3) After the amplification is completed, the rotation speed is continuously increased, so that the amplified products in the amplification chamber 300 and the re-encapsulated raw materials in the first raw material chamber 410 and the second raw material chamber 420 are sent into the re-encapsulation chamber 400, and the nucleic acid molecules are re-encapsulated to form a second encapsulation body of the nucleic acid molecules.
[0106] (4) After the re-encapsulation is completed, the rotation speed is continuously increased, and the sample solution carrying the second encapsulation body formed by the nucleic acid molecules is sent into the arc-shaped channel 110. After stopping the rotation, the sample solution enters the reflux channel 130 from the arc-shaped channel 110 under the action of capillary force, and then returns to the recovery chamber 120 again. Operations such as recovery or acquisition of image information can be performed on it.
[0107] In some of these embodiments, in order to facilitate the encapsulation and de-encapsulation of nucleic acid molecules, the nucleic acid molecules in the sample solution are fixed to a carrier, and then encapsulation and de-encapsulation are performed on the carrier. Specifically, the nucleic acid molecules can be fixed to the carrier by at least one of the methods including but not limited to electrostatic adsorption, chemical bonding, biotin-avidin, etc. The methods of chemical bonding include but are not limited to bonding between amino and carboxyl groups, bonding between metal and sulfhydryl groups, bonding between amino and aldehyde groups, and formation of coordination bonds between metal and nucleic acids. Among them, common carriers include nanospheres, such as microspheres with nanoscale sizes, which are preferably silica microspheres, such as monodisperse spherical silica, which have a large specific surface area, good dispersibility, and good optical properties and stability. Using it as a carrier can fix more nucleic acid fragments, thereby increasing the data load, and good dispersibility can ensure that encapsulation bodies can be formed on the surfaces of each nanosphere during the encapsulation and re-encapsulation processes, avoiding aggregation and affecting the encapsulation and protection effects. In addition, by means of controlling parameters such as the particle size of the nanospheres themselves and fluorescence labeling modification of the nanospheres fixed with different nucleic acid molecules as index conditions during the subsequent reading process, directional reading can be performed. For example, after encapsulation, the nanospheres are sorted by a flow cytometer, and nanospheres with specific particle sizes and fluorescence labels are selected for de-encapsulation and data reading, thereby avoiding the defect of requiring whole-library access. In addition, the first encapsulation body formed by the encapsulation of nucleic acid molecules and the second encapsulation body formed during re-encapsulation can be encapsulation bodies with the same structure. Of course, in some of these embodiments, the first encapsulation body and the second encapsulation body can also be different.
[0108] In some other embodiments, the nucleic acid molecules are directly mixed and reacted with the encapsulation material to achieve encapsulation, forming a first encapsulation body; the first encapsulation body is directly mixed and reacted with the de-encapsulation reagent to achieve de-encapsulation. For example, the nucleic acid molecules can be directly mixed and co-precipitated with the encapsulation material to form an encapsulation body. For example, the nucleic acid molecules are co-precipitated by mixing with protamine and binding to the encapsulation material to form an encapsulation body, and then the nucleic acid molecules are further released from protamine by means such as heparin sodium for the protamine-nucleic acid complex released from the encapsulation body.
[0109] In some of the above specific embodiments, the sample solution is a sample solution (or dispersion), specifically a solution or dispersion containing nucleic acid molecules. According to the functions corresponding to the processing structure and the reflux structure, the sample solution added to the sample injection chamber is a dispersion containing the first encapsulation body (for example, a suspension), and after the de-encapsulation treatment, the nucleic acid molecules are released from the first encapsulation body, and the sample solution becomes a solution of nucleic acid molecules; after amplification and re-encapsulation, the sample solution becomes a dispersion containing the second encapsulation body again, and finally the dispersion containing the second encapsulation body flows back to the recovery chamber through the arc-shaped channel and the reflux channel.
[0110] It should be noted that according to the different specific applications of the microfluidic chip, the target substances to be detected or processed may be other optional biological macromolecules, small molecules, ions, organisms, etc. in addition to the above-mentioned nucleic acid molecules. For example, it may be at least one of antigens, antibodies or their fragments, haptens, ligands, receptors, proteins, polypeptides, polysaccharides, oligosaccharides, monosaccharides, lipids, lipopolysaccharides, lipoproteins, glycoproteins, steroids, anions, cations, viruses, bacteria, cells, etc. Therefore, in addition to the above-mentioned nucleic acid solution, or an artificially prepared solution or dispersion containing at least one of the above-mentioned target substances, the sample solution may also be a solution or dispersion derived from environmental samples or biological samples. Among them, environmental samples include, but are not limited to, at least one of water bodies (such as domestic water, industrial water, medical water, agricultural water, and other various sewage and wastewater, or river and ocean water bodies), air, soil, compost, sludge (such as river channel sludge, wastewater sedimentation tank sludge, etc.), volcanic ash, frozen soil, food (such as solid food, fluid food, beverages, etc.); biological samples include, but are not limited to, at least one of body fluids (such as extracellular fluids such as blood, tissue fluid, lymph fluid, cerebrospinal fluid, etc., secretions such as urine, sweat, sputum, saliva, gastric juice, intestinal juice, pancreatic juice, bile, prostatic fluid, vaginal secretions, semen, etc., serous cavity effusions, joint cavity effusions, bronchoalveolar lavage fluids, amniotic fluid, etc.), skin, feces, intestinal contents, histological samples (such as samples obtained by surgery, endoscopy, or percutaneous biopsy).
[0111] The present application also provides the use of the aforementioned centrifugal microfluidic chip in nucleic acid data storage and reading. For the first time in the present application, a CD-like centrifugal microfluidic chip is proposed for application in the field of nucleic acid data storage, and operations such as reading and storing a storage medium storing data in the form of nucleic acids are performed through the microfluidic chip. The reflux structure design provided by the centrifugal microfluidic chip can drive the second encapsulation body back to the central reflux chamber without relying on an additional external power source, avoiding the positioning problem, and thus making the storage and reading of nucleic acid data more simple and effective. In addition, in combination with a specific liquid-repellent modification method, the opening and closing of the chambers in the microfluidic chip under different rotation speeds and the flow of the sample liquid therein are more precise. Moreover, a processing structure including a de-encapsulation unit, an amplification unit, and a re-encapsulation unit is designed. In this way, during the storage and reading of nucleic acid data, by re-encapsulating the released nucleic acid molecules to form a second encapsulation body, the loss of the original sample in the nucleic acid molecule release and reading process of the first encapsulation body can be compensated, and lossless reading of nucleic acid data can be achieved.
[0112] For the sake of stability and the simplicity of amplification and sequencing, in some specific embodiments, the nucleic acid data storage and reading are the storage and reading of DNA data.
[0113] The embodiment of the present application also provides a method for lossless reading of nucleic acid data, and the lossless reading method includes the following steps:
[0114] Providing a sample liquid containing a first encapsulation body, the first encapsulation body includes nucleic acid molecules, and the nucleic acid molecules store data information;
[0115] Inputting the sample liquid into the sample injection chamber of the aforementioned centrifugal microfluidic chip;
[0116] Adjusting the rotation speed of the centrifugal microfluidic chip to enable the sample liquid to sequentially pass through the de-encapsulation unit, the amplification unit, and the re-encapsulation unit to complete de-encapsulation, amplification, and re-encapsulation, and recovering the second encapsulation body from the recovery chamber;
[0117] Performing de-encapsulation on the second encapsulation body, collecting nucleic acid molecules and sequencing, and decoding the base sequence of the sequencing result into data information.
[0118] Among them, the data information includes, but is not limited to, different types of information such as text, audio, video, etc., such as books, periodicals, medical records, emails, web pages, e-mails, text messages, call records, drawings, pictures, photos, broadcasts, short videos, movies, etc. In some specific embodiments, the nucleic acid molecules store the data information by converting the data information into the base sequence of nucleic acid molecules in a specific coding manner, including but not limited to storing by direct conversion, linear block code, fountain code, convolutional code, etc., and decoding the base sequence into data information is also decoded according to the corresponding coding manner. In some specific embodiments, the sequencing methods include but are not limited to NGS sequencing, nanopore sequencing, etc.
[0119] In this solution, for the first time, a centrifugal microfluidic chip similar to a compact disc is applied to the storage and reading of nucleic acid data. Utilizing its reflux structure, without relying on an additional external power source, it drives the second encapsulation body back to the central reflux chamber, avoiding the positioning problem and making the nucleic acid data reading process more convenient. At the same time, the structural design of the de-encapsulation unit, amplification unit, and re-encapsulation unit can compensate for the loss of the original sample through secondary encapsulation of nucleic acid molecules, achieving lossless reading.
[0120] The above embodiments will be described below in conjunction with specific examples.
[0121] Example 1
[0122] This example provides a superhydrophobic reagent, and the specific preparation process includes the following steps:
[0123] (1) Add 1 g of silica nanoparticles (D50 is about 15 nm) to a 50 mL centrifuge tube containing 40 mL of toluene, and perform ultrasonic treatment with a power of 300 W for 30 minutes using an ultrasonic instrument.
[0124] (2) After ultrasonic treatment, add 0.6 mL of 1H,1H,2H,2H-perfluorodecyltriethoxysilane (PFDTES) and magnetically stir at room temperature for 48 hours. Wash the silica nanoparticles modified with silane with absolute ethanol and dry them.
[0125] (3) Mix the silica nanoparticles modified with silane obtained in step (2) and polydimethylsiloxane (PDMS) in a mass ratio of 2:3 and add them to 10 mL of ethyl acetate. Perform ultrasonic treatment with a power of 300 W for 30 minutes using an ultrasonic instrument and magnetically stir at room temperature for 1 hour to obtain the superhydrophobic reagent.
[0126] Example 2
[0127] This example provides a centrifugal microfluidic chip, refer to Figure 1 and Figure 2, the centrifugal microfluidic chip includes a processing structure and a reflux structure arranged in sequence along the movement direction of the sample liquid. The processing structure includes a sampling chamber, a de-encapsulation unit, an amplification unit, and a re-encapsulation unit arranged in sequence along the movement direction of the sample liquid. The de-encapsulation unit includes a de-encapsulation chamber 200, in which a first fence 210 is provided. The first fence 210 divides the de-encapsulation chamber 200 into a first de-encapsulation sub-chamber 201 and a second de-encapsulation sub-chamber 202. The amplification unit includes a buffer chamber 310 and an amplification chamber 300. The amplification chamber 300 is located downstream of the de-encapsulation chamber 200 and also downstream of the buffer chamber 310. A second fence 320 is provided in the amplification chamber 300. The second fence 320 divides the amplification chamber 300 into a first amplification sub-chamber 301 and a second amplification sub-chamber 302. The re-encapsulation unit includes a re-encapsulation chamber 400. Upstream of the re-encapsulation chamber 400, a first raw material chamber 410 and a second raw material chamber 420 are separately connected to the re-encapsulation chamber 400. A third fence 430 is provided in the re-encapsulation chamber 400. The third fence 430 divides the re-encapsulation chamber 400 into a first re-encapsulation sub-chamber 401 and a second re-encapsulation sub-chamber 402. The reflux structure includes an arc-shaped channel 110, a recovery chamber 120, and a reflux channel 130. The size of the arc-shaped channel 110 gradually decreases along the flow direction of the sample liquid 700 therein. The size of the reflux channel 130 gradually decreases along the direction away from the recovery chamber 120, and at the same time, the size of the reflux channel 130 is larger than that of the arc-shaped channel 110. The reflux channel 130 connects the arc-shaped channel 110 and the recovery chamber 120. The recovery chamber 120 is located at the center of the centrifugal microfluidic chip. The recovery chamber 120 is also the sampling chamber. Downstream of the arc-shaped channel 110, a waste liquid chamber 500 is further provided. The arc-shaped channel 110 and the waste liquid chamber 500 are connected through a first connecting pipe 810. The size of the first connecting pipe 810 is smaller than the size of the end (b end) of the arc-shaped channel 110. The second re-encapsulation sub-chamber 402 is communicated with the arc-shaped channel 110 through a second connecting pipe 820. The recovery chamber 120 is connected to the de-encapsulation chamber 200 or the first de-encapsulation sub-chamber 201 through a third connecting pipe 830. The second de-encapsulation sub-chamber 202 is connected to the first amplification sub-chamber 301 through a fourth connecting pipe 840. The second amplification sub-chamber 302, the first raw material chamber 410, and the second raw material chamber 420 are connected to the first re-encapsulation sub-chamber 401 through a fifth connecting pipe 850. A number of air inlets 600 are provided at positions of the de-encapsulation chamber 200, the buffer chamber 310, the first raw material chamber 410, the second raw material chamber 420, and the re-encapsulation chamber 400 close to the center of the circle.
[0128] The superhydrophobic reagent prepared in Example 1 was added to the reflux channel 130, the arc channel 110, the first connecting pipe 810, the second connecting pipe 820, the third connecting pipe 830, the fourth connecting pipe 840, and the fifth connecting pipe 850. After drying, a superhydrophobic coating can be formed on the inner walls of the reflux channel 130, the arc channel 110, the first connecting pipe 810, the second connecting pipe 820, the third connecting pipe 830, the fourth connecting pipe 840, and the fifth connecting pipe 850.
[0129] The de-encapsulation chamber 200 was pre-loaded with an EDTA solution, the buffer chamber 310 was pre-loaded with an RPA buffer solution, the amplification chamber 300 was pre-loaded with an RPA reaction reagent, and the first raw material chamber 410 and the second raw material chamber 420 were respectively pre-loaded with a calcium chloride solution and a sodium carbonate solution.
[0130] Example 3
[0131] The centrifugal microfluidic chip in Example 2 was used for simulation experiments, referring to Figure 3 , as shown in a of Figure 3 , a green dye was used as the encapsulated nucleic acid sample and added to the recovery chamber (1) at the center of the centrifugal microfluidic chip. As shown in b of Figure 3 , then the microfluidic chip was rotated for 10 seconds with a custom rotor at a speed of 350 rpm to send the green dye into the de-encapsulation chamber (2) pre-loaded with an EDTA solution (simulated with a red dye) for de-encapsulation treatment. As shown in c of Figure 3 , after the rotation speed returned to zero and it was left standing for 15 minutes, the rotation speed was increased to 450 rpm to send the de-encapsulated nucleic acid sample and the amplification buffer solution (simulated with a red dye) in the buffer chamber (3) into the amplification chamber (5) pre-loaded with the amplification reagent. The chip was heated at 39 °C for 1 hour for isothermal amplification. As shown in d of Figure 3 , the rotation speed was continuously increased to 550 rpm to send the amplified nucleic acid and the re-encapsulation reagent (simulated with a blue dye) in the first raw material chamber (4) and the second raw material chamber (6) into the re-encapsulation chamber (7) for re-encapsulation. Finally, as shown in e of Figure 3 and combined with Figure 1 , the re-encapsulated nucleic acid sample was driven by centrifugal force into the arc channel modified with the superhydrophobic coating at a rotation speed of 750 rpm, and returned to the recovery chamber (1) at the center through the reflux channel under the capillary action of the superhydrophobic arc channel. Among them, the morphologies and quantities of the target nucleic acid and the encapsulation shell in each step are shown below a - e.
[0132] Example 4
[0133] Re-encapsulation experiment
[0134] Perform the experimental group experiment with reference to Example 3. Take a sample of the DNA forming the first encapsulation body, and use the centrifugal microfluidic chip provided in Example 2 to perform the de-encapsulation-amplification-re-encapsulation process. Extract the re-encapsulated DNA sample from the recovery chamber at the center of the chip, and compare it with the control experiment results outside the chip.
[0135] Among them, the formation process of the first encapsulation body refers to the encapsulation method in step 1 of the following control group experiment. The first encapsulation body includes 7 nucleic acid molecules, and the sequences are as follows:
[0136] TCTGCAAGTAGCCAAGGGTAAGCAAGGATCAAAGAAAGGGAAGGAACGCTCGCCCAAGCGACCTATCGCCCGCACATTCGTGCATCCGGCCGATTGCTAGATGATGCTTTCAAGGGTTCATAAGTGCTTCGTGCAGATTC (SEQ ID No.1).
[0137] TCTGCAAGTAGCCAAGGGTAAGCAAGGATCAAGAAAGGGAAGGAAACACACATGCAACCACACGACCTCACGACCCATCTCACGTTCTAGCGACTTCGCAGAACCGGAGACAAGGGTTCATAAGTGCTTCGTGCAGATTC (SEQ ID No.2).
[0138] TCTGCAAGTAGCCAAGGGTAAGCAAGGATCACCCAACCAATACCAACACACATGCAACCACACGACCTCACGACCCATCTCACGTTCTAGCGACCGTATCGCCAAGGCGTCAAGGGTTCATAAGTGCTTCGTGCAGATTC (SEQ ID No.3).
[0139] TCTGCAAGTAGCCAAGGGTAAGCAAGGATCCCAACCAATACCTACCAGATAGGTAAATAGCCACAGACACAACCACTAACGGAGAGACGTAAAGCGTTTGACAGTAGTCTCAAGGGTTCATAAGTGCTTCGTGCAGATTC (SEQ ID No.4).
[0140] TCTGCAAGTAGCCAAGGGTAAGCAAGGATCCAACCAATACCTTCACCCACCACACGCCCAGCCGCTCTGACGACCTCCCTGCCCACACGTAAAGATAGATTTCAATGAGCCAAGGGTTCATAAGTGCTTCGTGCAGATTC(SEQ ID No.5).
[0141] TCTGCAAGTAGCCAAGGGTAAGCAAGGATCAAGGACGAGTTTAAAGATCGAGACAGCTAGGAACCAACTCAACCATGGACCTACTACTAGCGACCTAGCACTTGATCATTCAAGGGTTCATAAGTGCTTCGTGCAGATTC(SEQ ID No.6).
[0142] TCTGCAAGTAGCCAAGGGTAAGCAAGGATCGGACGAGTTTAAAGAAATCGAGACAGCTAGGAACCAACTCAACCATGGACCTACTACTAGCGACTGCTATCCGGTGGTAACAAGGGTTCATAAGTGCTTCGTGCAGATTC(SEQ ID No.7).
[0143] Amplification primer sequences:
[0144] Forward primer: TCTGCAAGTAGCCAAGGGTAAGCAAGGATC(SEQ ID No.8);
[0145] Reverse primer: GAATCTGCACGAAGCACTTATGAACCCTTG(SEQ ID No.9);
[0146] The amplification reagent uses a commercial kit TwistAmp Basic Kit, which contains the enzymes, dNTPs and buffers required for isothermal amplification.
[0147] The experimental method for the control group is as follows:
[0148] 1. Encapsulation: Take 10 μl of DNA solution (20 ng / μl), 1 μl of protamine solution (0.4 mg / mL), and mix them evenly with 50 μl of calcium chloride solution (20 nM). Then add 50 μl of sodium carbonate solution (0.2 nM), vortex for 30 seconds, and let it stand for 20 minutes. Centrifuge to remove the supernatant, add an equal volume of deionized water, and centrifuge and wash repeatedly 3 times. Take 100 μl of deionized water to resuspend the mineralized precipitate to obtain a suspension of the first encapsulation body formed by the co-precipitation of calcium carbonate and DNA.
[0149] 2. De-encapsulation: Take 50 μl of the mineralized precipitate suspension, add 50 μl of EDTA solution (0.1 M) and 1 μl of heparin sodium solution (15 mg / mL), pipette and mix well, and let it stand for 15 minutes.
[0150] 3. Amplification: Take 10 μl of the sample after de-encapsulation and add it to the amplification system with a volume of 50 μl, heat at 39 °C for 1 hour to obtain the amplification product.
[0151] 4. Re-encapsulation: According to step 1, take 10 μl of the amplification product and re-encapsulate it to form the second encapsulation body.
[0152] The above steps 2-4 correspond to the reactions in the de-encapsulation unit, amplification unit, and re-encapsulation unit of the centrifugal microfluidic chip respectively.
[0153] After re-de-encapsulating the products of the experimental group and the control group and performing gel electrophoresis analysis, DNA target bands with a length of 140 bp were shown. It shows that the microfluidic chip provided by the embodiment can more conveniently and accurately realize the full-process reaction of DNA storage encapsulation-amplification-de-encapsulation, integrates multiple functional units, and makes the implementation of the entire operation process more convenient.
[0154] Example 5
[0155] This example provides a method for storing and reading nucleic acid data:
[0156] The picture file is stored in 1000 pieces of 100bp DNA in a specific coding manner, and the first encapsulation body is formed according to the encapsulation method in Example 4 to obtain a sample containing the first encapsulation body. The centrifugal microfluidic chip provided in Example 2 is used for de-encapsulation-amplification-re-encapsulation processing. The re-encapsulated DNA sample is extracted from the recovery chamber at the center of the chip, subjected to NGS sequencing, and the sequencing result is decoded back into a picture file. Among them, the coding and decoding methods refer to Yaniv Erlich, Dina Zielinski. DNA Fountain enables a robust and efficient storage architecture. Science, 03 Mar 2017, 355(6328):950-954,
[0157] Combined with the above experimental results, it can be seen that for the centrifugal microfluidic chip provided in the embodiments of the present application, the introduction of superhydrophobic modification to assist fluid control only requires an additional rotor to meet all fluid driving requirements without the assistance of other instrument devices. This centrifugal microfluidic chip integrates functions such as de-encapsulation, DNA amplification, and encapsulation, and pre-loads the required reagents. When in use, only a DNA sample needs to be added to the recovery chamber at the center of the circle, and the centrifugal speed is gradually increased. The centrifugal force can drive the DNA sample and the reagents to enter the subsequent chambers in sequence to complete de-encapsulation, DNA amplification, and encapsulation. Finally, the re-encapsulated DNA sample will return to the recovery chamber at the center of the circle under the drive of capillary force. This structural design also avoids the common positioning problems in the operation process of the centrifugal microfluidic chip. And by using the isothermal amplification method to replace the traditional PCR technology, the miniaturization and automation level of the DNA data storage system are maximally improved, and lossless reading of data can be achieved.
[0158] The above has described the present application in detail in combination with the embodiments, but the present application is not limited to the above embodiments. Within the knowledge scope of those of ordinary skill in the art to which the present application pertains, various changes can be made without departing from the purpose of the present application. In addition, without conflict, the embodiments of the present application and the features in the embodiments can be combined with each other.
Claims
1. A centrifugal microfluidic chip, characterized in that, It includes a processing structure and a reflux structure arranged in sequence along the moving direction of the sample solution. The reflux structure includes: An arc-shaped channel, which is connected to the processing structure; A recovery chamber, which is located at the center of the centrifugal microfluidic chip; A reflux channel, which connects the arc-shaped channel and the recovery chamber. The size of the reflux channel gradually decreases in the direction away from the recovery chamber, and the size of the reflux channel is larger than that of the arc-shaped channel; Wherein, the arc-shaped channel and the reflux channel have liquid-repellent inner walls, which can make the sample solution flowing through the arc-shaped channel flow back to the recovery chamber through the reflux channel in the opposite direction of the centrifugal force; The fact that the size of the reflux channel gradually decreases in the direction away from the recovery chamber means that both the height and width of the reflux channel gradually change, so that the size gradually decreases; the size of the reflux channel being larger than that of the arc-shaped channel means that at least the size of the smallest part of the reflux channel is larger than the size of the largest part of the arc-shaped channel.
2. The centrifugal microfluidic chip according to claim 1, wherein The liquid-repellent inner wall is a super-liquid-repellent inner wall.
3. The centrifugal microfluidic chip according to claim 1, wherein The liquid-repellent inner wall is a hydrophobic inner wall.
4. The centrifugal microfluidic chip according to claim 1, wherein, The liquid-repellent inner wall is a super-hydrophobic inner wall.
5. The centrifugal microfluidic chip according to claim 1, wherein The liquid-repellent inner walls of the arc-shaped channel and the reflux channel are inner walls modified with a liquid-repellent coating.
6. The centrifugal microfluidic chip according to claim 5, wherein The liquid-repellent coating is a super-liquid-repellent coating.
7. The centrifugal microfluidic chip according to claim 5, wherein, The liquid-repellent coating is a hydrophobic coating.
8. The centrifugal microfluidic chip according to claim 5, wherein The liquid-repellent coating is a super-hydrophobic coating.
9. The centrifugal microfluidic chip according to claim 7, characterized in that, The raw materials of the hydrophobic coating include polymers and micro-nano particles.
10. The centrifugal microfluidic chip according to claim 1, characterized in that, The size of the arc-shaped channel gradually decreases or remains unchanged in the direction of the flow of the sample solution. The fact that the size of the arc-shaped channel gradually decreases or remains unchanged means that at least one of the height and width of the cross-section of the arc-shaped channel perpendicular to the flow direction of the sample solution gradually decreases or remains unchanged.
11. The centrifugal microfluidic chip according to claim 1, wherein, The distance between the arc-shaped channel and the center of the circle gradually increases or remains unchanged in the direction of the flow of the sample solution.
12. The centrifugal microfluidic chip according to claim 1, wherein A waste liquid chamber is further arranged downstream of the arc-shaped channel in the direction of the movement of the sample solution. The arc-shaped channel is connected to the waste liquid chamber through a first connecting pipe. The first connecting pipe has a liquid-repellent inner wall, and the size of the first connecting pipe is smaller than the size of the end of the arc-shaped channel in the direction of the movement of the sample solution.
13. The centrifugal microfluidic chip according to any one of claims 1 to 12, characterized in that, The processing structure includes, arranged in sequence along the moving direction of the sample solution: A sample injection chamber, which is used for injecting the sample solution. The sample solution contains a first encapsulation body, and the first encapsulation body includes nucleic acid molecules; A de-encapsulation unit, which is used for releasing the nucleic acid molecules from the first encapsulation body; An amplification unit, which is used for amplifying the released nucleic acid molecules; A re-encapsulation unit, which is used for forming a second encapsulation body with the nucleic acid molecules. The re-encapsulation unit is connected to the arc-shaped channel.
14. The centrifugal microfluidic chip according to claim 13, wherein The amplification unit includes an amplification chamber and a buffer solution chamber that are connected to each other. The amplification chamber is located downstream of the flow direction of the buffer solution.
15. The centrifugal microfluidic chip according to claim 14, characterized in that, The amplification chamber is used for performing nucleic acid amplification reactions.
16. The centrifugal microfluidic chip according to claim 13, wherein The sample injection chamber communicates with the de-encapsulation unit through a third connecting pipe, the de-encapsulation unit communicates with the amplification unit through a fourth connecting pipe, the amplification unit communicates with the re-encapsulation unit through a fifth connecting pipe, and the third connecting pipe, the fourth connecting pipe and the fifth connecting pipe have liquid-repellent inner walls.
17. Application of the centrifugal microfluidic chip according to any one of claims 1 to 16 in nucleic acid data storage and reading.
18. A method for lossless reading of nucleic acid data, characterized in that, Comprising the following steps: Providing a sample solution containing a first encapsulation body, the first encapsulation body comprising nucleic acid molecules, and the nucleic acid molecules storing data information; Inputting the sample solution into the sample injection chamber of the centrifugal microfluidic chip according to any one of claims 13 to 16; Adjusting the rotation speed of the centrifugal microfluidic chip to enable the sample solution to sequentially pass through the de-encapsulation unit, the amplification unit and the re-encapsulation unit to complete de-encapsulation, amplification and re-encapsulation, and recovering a second encapsulation body from the recovery chamber; Performing de-encapsulation on the second encapsulation body, collecting the nucleic acid molecules and sequencing them, and decoding the sequencing results into data information.
Citation Information
Patent Citations
Nucleic acid hybridized platform based on micro-flow control and hybridization analysis method thereof
CN101748204A
Lateral flow immune detection system based on centrifugal microfluidic system
CN109884328A