A serum exosomal tsRNA marker, probe and application thereof for diagnosing lupus nephritis

By using serum exosome tsRNA markers tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2, combined with specific probes and PCR reaction reagents, a diagnosis kit of lupus nephritis was developed, solving the shortcomings of existing diagnostic methods and achieving more accurate and convenient LN diagnosis.

CN115992211BActive Publication Date: 2025-07-29NANJING DRUM TOWER HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210962493.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2022-08-10
Filing Date
2022-08-11
Publication Date
2025-07-29
Estimated Expiration
2042-08-11

AI Technical Summary

Technical Problem

In the prior art, the diagnosis method of lupus nephritis has problems such as inaccurate time, high invasiveness, poor patient compliance, and lack of effective biomarkers for early diagnosis.

Method used

The serum exosome tsRNA markers tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2 were used to combine specific probes and PCR reaction reagents to develop a diagnostic kit for lupus nephritis to detect the expression of tsRNA in serum exosomes.

Benefits of technology

It improves the sensitivity and specificity of the diagnosis of lupus nephritis, provides more accurate and convenient diagnostic methods, and confirms the application value of tsRNA in LN diagnosis for the first time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115992211B_ABST
    Figure CN115992211B_ABST
Patent Text Reader

Abstract

The present invention provides a serum exosomal tsRNA (tRNA-derived small RNA, tsRNA) biomarker, a probe and their applications for the diagnosis of lupus nephritis, belonging to the field of molecular biology; the biomarker is one or a combination of tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2; the exosomal tsRNA screened by the present invention is significantly highly expressed in the serum exosomes of lupus nephritis patients, has a good correlation with the clinical indicators of lupus nephritis, and can be used to identify whether SLE patients have kidney involvement; the biomarker can be used to prepare a diagnostic kit for the auxiliary early diagnosis of lupus nephritis in clinical practice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to a serum exosome tsRNA marker, a probe and applications thereof for diagnosing lupus nephritis. Background Art

[0002] Lupus nephritis (LN) is one of the most severe organ manifestations of systemic lupus erythematosus (SLE) and a type of glomerulonephritis. LN can be categorized into six distinct histological types based on the manifestation and severity of renal involvement in SLE. Approximately 65% of SLE patients will develop nephritis at some stage of their disease, and 25% of patients with lupus nephritis who have been ill for more than 10 years will progress to end-stage renal disease. This disease is both a key and challenging aspect of the clinical diagnosis and treatment of SLE. Clearly, early diagnosis and prompt initiation of treatment for LN are crucial for preventing disease progression. Currently, the most commonly used methods for diagnosing LN in clinical practice are 24-hour urine protein quantification and renal biopsy. However, these methods suffer from limitations such as inaccurate timing, partial loss of urine samples during sample collection, poor patient compliance with urine protein testing, and the invasive nature of the renal biopsy procedure. Therefore, the search for new biomarkers to differentiate LN from SLE is urgent.

[0003] Derived from mature tRNA or its precursor, tsRNA is a novel type of small noncoding RNA discovered in recent years, approximately 18-40 nt in length. Based on their production mechanism, tRNA is primarily classified into two types: tRNA halves and tRNA-derived RNA fragments (tRFs). tRNA is the most extensively and richly modified RNA in the body, particularly nuclear-encoded tRNA, which exhibits an average of 13 modifications per tRNA molecule. Derived from tRNA, tsRNA possesses a rich array of RNA modifications and exhibits tissue- and cell-specific properties. Through mechanisms such as protein translation and transposons, tsRNA participates in a variety of biological functions, including cellular and tissue stress responses, protein translation regulation, and epigenetic regulation, making it a research hotspot. tsRNA may be more abundant in body fluids and exosomes than miRNA. Furthermore, tsRNA possesses a rich array of modifications and a stable structure, exhibiting tissue- and time-specific properties, making it an ideal biomarker for clinical testing.

[0004] However, the research on exosomal tsRNA in the field of autoimmune diseases, especially lupus nephritis, has not been reported. Serum exosomal tsRNA has great development potential and broad application prospects in the field of liquid biopsy diagnostic markers for lupus nephritis. Summary of the invention

[0005] The problem to be solved by the present invention is to differentially diagnose patients with systemic lupus erythematosus and lupus nephritis in clinical practice, propose a class of serum exosome tsRNA markers related to lupus nephritis, and the use of this class of tsRNA markers in the preparation of a lupus nephritis diagnostic kit.

[0006] To achieve the above object, the technical solution of the present invention is as follows:

[0007] The present invention provides a serum exosome tsRNA marker associated with lupus nephritis, wherein the tsRNA marker is any one or a combination of the following sequences:

[0008] tRF-Thr-TGT-4-M3: SEQ ID NO.1;

[0009] tRF-Tyr-GTA-1-M2: SEQ ID NO. 2.

[0010] The present invention provides a probe that can specifically capture serum exosomal tsRNA markers associated with lupus nephritis, including the aforementioned ones. The probe is a custom-synthesized TaqMan tsRNA probe from GenScript. The probe sequences are shown in SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6. SEQ ID NO. 3 and SEQ ID NO. 5 can specifically capture tRF-Thr-TGT-4-M3 (SEQ ID NO. 1), while SEQ ID NO. 4 and SEQ ID NO. 6 can specifically capture tRF-Tyr-GTA-1-M2 (SEQ ID NO. 2).

[0011] The present invention provides the use of the above-mentioned serum exosome tsRNA markers and probes in the preparation of a lupus nephritis diagnostic kit.

[0012] The present invention also provides a lupus nephritis diagnostic kit, which is used to detect the expression level of one or more of the above-mentioned tsRNA markers in serum exosomes.

[0013] In a further technical solution, the kit includes the above-mentioned probe.

[0014] In a further technical solution, the kit also includes reagents and enzymes commonly used in PCR reactions.

[0015] In a further technical solution, the reagents and enzymes commonly used in PCR reactions in the kit include dNTP / AMV reverse transcriptase and buffer, MgCl2, DEPC water and Taq DNA polymerase.

[0016] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0017] (1) Compared with traditional protein biomarkers and miRNAs, the tsRNAs present in serum exosomes have higher stability, which helps to resist the degradation by RNases in serum, and the quantification is accurate, which helps to improve the sensitivity and specificity of disease diagnosis.

[0018] (2) The present invention studies the diagnostic role of serum exosome tsRNAs in lupus nephritis and explores their clinical value for the screening of lupus nephritis. The tsRNA biomarkers screened by the present invention can be used to prepare a diagnostic kit, which can make the diagnosis of lupus nephritis more convenient.

[0019] (3) The present invention for the first time confirms a group of novel exosome tsRNA biomarkers, namely tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2, which are the first confirmed exosome tsRNA biomarkers for LN diagnosis, laying a foundation for the in-depth study of tsRNAs in LN. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 (A) Volcano plot of differential expression of exosome tsRNAs; (B) Heat map of expression of the top 10 high / low expressed tsRNAs in the systemic lupus erythematosus without nephritis (SLE-LN) and lupus nephritis (LN) groups;

[0021] Figure 2 shows the expression levels of 5 exosome tsRNAs between the serum exosomes of the systemic lupus erythematosus without nephritis group and the lupus nephritis patient group;

[0022] Figure 3 is a heat map of the correlation analysis between 5 exosome tsRNAs and the clinical detection indexes of patients;

[0023] Figure 4 is the ROC curve diagram for the diagnosis of the systemic lupus erythematosus without nephritis group and the lupus nephritis group by 2 tsRNAs respectively and in combination. DETAILED DESCRIPTION OF THE INVENTION

[0024] The following further clarifies the present invention in conjunction with the drawings and specific embodiments. It should be understood that the following specific embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0025] Example 1

[0026] A serum exosome tsRNA biomarker related to lupus nephritis, and the tsRNA biomarker is any one or combination of the following sequences.

[0027] tRF-Thr-TGT-4-M3: SEQ ID NO.1

[0028] tRF-Tyr-GTA-1-M2: SEQ ID NO.2

[0029] A probe that can specifically capture the serum tsRNA markers related to lupus nephritis as described above. This probe is a TaqMan tsRNA probe custom-synthesized by GenScript Biotech Corporation. The sequences of the probe are shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6. SEQ ID NO.3 and SEQ ID NO.5 can specifically capture tRF-Thr-TGT-4-M3 (SEQ ID NO.1), and SEQ ID NO.4 and SEQ ID NO.6 can specifically capture tRF-Tyr-GTA-1-M2 (SEQ ID NO.2).

[0030] SEQ ID NO.1 (RNA, Homo, tRF-Thr-TGT-4-M3)

[0031] AAAUCUCGCUGGGGCCUCCA

[0032] SEQ ID NO.2 (RNA, Homo, tRF-Tyr-GTA-1-M2)

[0033] CGAAUCCGGCUCGAAGGACCA

[0034] SEQ ID NO.3 (DNA, artificial probe sequence)

[0035] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGAGG

[0036] SEQ ID NO.4 (DNA, artificial probe sequence)

[0037] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGTCC

[0038] SEQ ID NO.5 (DNA, artificial probe sequence)

[0039] GCGAAATCTCGCTGGGG

[0040] SEQ ID NO.6 (DNA, artificial probe sequence)

[0041] GCGAATCCGGCTCGAA

[0042] The application of the above-mentioned serum exosomal tsRNA markers and probes in the preparation of a diagnostic kit for lupus nephritis.

[0043] A diagnostic kit for lupus nephritis, which is used to detect the expression levels of one or more of the above-mentioned tsRNA markers in serum exosomes.

[0044] The kit includes the above-mentioned probes. The kit also includes reagents and enzymes commonly used in PCR reactions. The reagents and enzymes commonly used in the PCR reaction of the kit include dNTP / AMV reverse transcriptase and buffer, MgCl2, DEPC water, Taq DNA polymerase, etc.

[0045] The present invention first isolated serum exosomes from lupus nephritis patients and systemic lupus erythematosus patients without nephritis who were matched by gender and age, extracted RNA for high-throughput sequencing analysis of tsRNA, and obtained a group of exosomal tsRNA markers related to lupus nephritis through preliminary screening with small samples and clinical verification with large samples. Based on this, a kit for clinical diagnosis of lupus nephritis was developed, which can be used for clinical auxiliary diagnosis of lupus nephritis.

[0046] The technical solutions for solving the problems of the present invention include:

[0047] (1) Collect serum specimens that meet the standards according to the standard operating procedure (SOP), and collect complete clinical medical record information for each sample.

[0048] (2) Screening and analysis of the differential expression profile of serum exosomal tsRNA: Screen lupus nephritis patients and systemic lupus erythematosus patients without nephritis who are matched by gender and age, isolate serum exosomes, analyze the expression profile of tsRNA in exosomes by sequencing, screen out differentially expressed tsRNAs and verify them through multiple stages with clinical samples.

[0049] (3) Perform real-time fluorescence quantitative analysis (RT-qPCR) on the above-mentioned screened exosomal tsRNA to identify tsRNAs related to lupus nephritis.

[0050] (4) Develop a diagnostic kit for lupus nephritis based on the above-screened tsRNAs.

[0051] Specifically, it includes the following steps:

[0052] (1) According to the classification criteria for systemic lupus erythematosus established by the American College of Rheumatology in 1997, collect serum specimens from patients diagnosed with systemic lupus erythematosus without nephritis (SLE-LN) and lupus nephritis (LN). In this study, 111 cases of SLE specimens without nephritis and 113 cases of LN specimens met the standards.

[0053] (2) Exosomes were extracted from 100 μL of serum using a precipitation kit, and total RNA of the exosomes was further extracted using the Trizol (Invitrogen Life Technologies) method.

[0054] (3) RNA quality detection: RNA purity and concentration were detected by agarose gel electrophoresis and qubit.

[0055] (4) High-throughput sequencing of tsRNA.

[0056] ① Recover the above RNA by PAGE electrophoresis;

[0057] ② tsRNA contains numerous epigenetic modifications that can interfere with small RNA sequencing library construction. RNA samples were treated with ALKB demethylase before library construction. tsRNA was screened using a second-generation sequencing system and high-throughput gene expression database big data analysis.

[0058] ③ Delete duplicate, mismatched, and low-abundance sequences, and select tsRNAs with a fold difference > 10 and P < 0.01 for differential analysis;

[0059] (5) Quantitative detection of tsRNA by RT-qPCR.

[0060] ④ Extraction of serum exosome total RNA by Trizol method;

[0061] ⑤ Use tsRNA stem-loop primers synthesized by GenScript to reverse transcribe RNA samples into cDNA;

[0062] ⑥ Quantitative PCR was performed on cDNA using tsRNA forward primers synthesized by GenScript;

[0063] ⑦ Detect and compare the differences in tsRNA expression levels in serum exosome samples from patients with lupus nephritis and systemic lupus erythematosus without nephritis.

[0064] (6) Preparation of tsRNA diagnostic kit for lupus nephritis

[0065] ⑧ Two serum exosomal tsRNAs screened previously by sequencing and RT-qPCR constitute diagnostic markers;

[0066] ⑨ Contains the reverse transcription and quantification probes specific for the two serum exosome tsRNAs mentioned above;

[0067] ⑩Contains common PCR reagents such as AMV reverse transcriptase Taq DNA polymerase, MgCl2, DEPC water and dNTP.

[0068] (7) Data processing and analysis

[0069] All data were analyzed using Excel, Graphpad Prism 8.0, and SPSS 24.0 software. Values are expressed as mean ± SEM, and P < 0.05 was considered statistically significant. When samples between groups were normal and had equal variances, the t-test or one-way analysis of variance was used. When samples between groups were not normally distributed, the U-test or nonparametric tests were used.

[0070] The following is a further description of the present invention:

[0071] Before the exploration, the inventors performed small RNA high-throughput sequencing on serum exosomes from 24 patients with systemic lupus erythematosus without nephritis and 33 patients with lupus nephritis. The screening found that 154 tsRNAs had significant changes in serum exosome samples of lupus nephritis (fold change > 10 and P < 0.01, such as Figure 1 A).

[0072] Based on the sequencing results, the inventors selected the top 10 tsRNAs with increased expression in lupus nephritis patients for analysis ( Figure 1 B) Five tsRNAs were selected and the corresponding TaqMan probes were custom-synthesized by GenScript for detection, including tRF-iMet-CAT-1, tRF-Thr-TGT-4-M3, tRF-Ala-AGC-2-M4, tRF-Tyr-GTA-1-M2, and tRF-Gly-CCC-1-M4.

[0073] The above five tsRNAs were further verified by absolute quantification in 20 SLE cases without nephritis and 20 SLE cases with lupus nephritis (e.g. Figure 2 ).

[0074] (1) Serum exosome extraction: Exosomes were extracted from 100 μL serum sample using an exosome sedimentation kit, and total RNA was further extracted from the exosomes using the Trizol method.

[0075] (2) Absolute quantitative analysis: Synthesize the corresponding tsRNA standard, draw a standard curve, and detect it by RT-qPCR to obtain the sample CT value, which is converted into the absolute concentration of the target tsRNAs through the standard curve. The tsRNAs screened include: tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2, the sequences of which are shown in SEQ ID No. 1 and SEQ ID No. 2

[0076] Based on the above results, the above five tsRNAs were further detected and verified in the serum exosomes of another 87 patients with systemic lupus erythematosus without nephritis and 89 patients with lupus nephritis. The results showed that tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2 were significantly elevated in the lupus nephritis samples, and the results were as Figure 2 shown.

[0077] Further analyzing the correlation between the above five tsRNAs and the clinical diagnostic indicators of lupus nephritis, the results showed that tRF-Tyr-GTA-1-M2 had a good correlation with the lupus nephritis activity index SLEDAI-2K, and the results were as Figure 3 shown.

[0078] Further analyzing the receiver operating characteristic curve (ROC curve) of tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2 for the diagnostic effect of lupus nephritis, it was shown that both tsRNAs had good diagnostic value for lupus nephritis, and the area under the combined diagnostic ROC curve could reach 0.7950, and the results were as Figure 4 shown.

[0079] It should be noted that the above content only illustrates the technical idea of the present invention and cannot limit the protection scope of the present invention. For those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements all fall within the protection scope of the claims of the present invention.

Claims

1. Use of a probe in the preparation of a diagnostic kit for lupus nephritis, characterized in that, The sequences of the probes are shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.

6.

2. Use of a probe according to claim 1 in the preparation of a diagnostic kit for lupus nephritis, characterized in that, The probe can specifically capture the tsRNA markers of exosomes in the serum of lupus nephritis. The tsRNA markers are any one or more of tRF-Thr-TGT-4-M3 and tRF-Tyr-GTA-1-M2. The sequence of tRF-Thr-TGT-4-M3 is shown in SEQ ID NO.1; the sequence of tRF-Tyr-GTA-1-M2 is shown in SEQ ID NO.

2.

3. Use of a probe according to claim 2 in the preparation of a lupus nephritis diagnostic kit, characterized in that: The probes shown in SEQ ID NO.3 and SEQ ID NO.5 can specifically capture tRF-Thr-TGT-4-M3, and the probes shown in SEQ ID NO.4 and SEQ ID NO.6 can specifically capture tRF-Tyr-GTA-1-M2.