Use of Circ-0000818 in the preparation of a kit for detecting liver fibrosis and a drug for treating liver fibrosis

Abstract

The present invention provides the use of Circ-0000818 in preparing a biomarker for diagnosing liver fibrosis. The present invention also provides the use of a reagent for detecting Circ-0000818 in preparing a kit for diagnosing liver fibrosis. The present invention also provides the use of circ-0000818 in preparing a drug for treating liver fibrosis. Through research, it was found that the expression of circ-0000818 in liver tissue of patients with liver fibrosis was significantly decreased, and increasing the expression of circ-0000818 in hepatic stellate cells can alleviate the progression of liver fibrosis. Circ_0000818 adenovirus was used to treat mice with liver fibrosis induced by CCL4, and the reporter gene found that circ-0000818 can inhibit the expression of miR-484, thereby regulating the expression of autophagy-related genes and liver fibrosis-related genes in stellate cells.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a kit for detecting liver fibrosis and a drug for treating liver fibrosis, specifically, the use of Circ-0000818 in preparing a kit for detecting liver fibrosis and a drug for treating liver fibrosis. Background Art

[0002] Liver fibrosis refers to the diffuse excessive deposition and abnormal distribution of liver extracellular matrix (i.e. collagen, glycoproteins and proteoglycans, etc.). It is the pathological repair response of the liver to chronic damage. It is a key step in the development of various chronic liver diseases to cirrhosis and an important link affecting the prognosis of chronic liver diseases. The further development of liver fibrosis can cause disorder of liver lobule structure, nodular regeneration of liver cells, and the formation of pseudolobule structure, i.e. liver cirrhosis, and clinical manifestations of liver dysfunction and portal hypertension.

[0003] At present, there is no specific and effective anti-liver fibrosis treatment in clinical practice. The main method is to relieve liver damage and inflammation and prevent and treat liver fibrosis by treating the underlying diseases that cause liver damage. The development of anti-liver fibrosis drugs still faces great challenges, mainly because the formation process and mechanism of liver fibrosis are complex, there are many influencing factors, and there are large differences between individuals. Therefore, there are no effective chemical drugs and biological agents for clinical treatment so far.

[0004] The main problems with clinical trials are: chronic liver disease and liver fibrosis generally have a long course, and it is not easy for clinical trials to use survival benefits or reductions in clinical decompensation events as clinical endpoints; the discovery of new drugs requires a long period of time (8.5 to 14.0 years) and a large amount of economic investment; current anti-liver fibrosis drug trials still require liver biopsy to determine efficacy, and there is an urgent need for ideal biomarkers and imaging detection technologies to shorten trial intervals and non-invasive evaluations.

[0005] The discovery of free RNA in plasma and serum, including miRNA, snoRNA, lncRNA and circularRNAs (circRNAs), is a major breakthrough in the history of scientific development. At present, the source of circRNAs in circulating blood and the mechanism of their stable existence have not been fully elucidated. Previous studies have speculated that the sources of circulating RNA include passive and active processes. The passive process is that free RNA enters the circulating blood after disease cell necrosis; the active process refers to the release of circRNA from cells in the form of apoptotic bodies or microsomes. Other studies have pointed out that the structure of circRNA is mainly composed of a circular ring and multiple microRNA binding sites. The closed structure enables circRNA to resist RNA degradation pathways. Due to the convenience of collecting and relative non-invasiveness of circulating biomarkers, it can become a screening tool for diseases. Therefore, identifying circRNAs that are directly related to the process of liver fibrosis and can be used as diagnostic markers for liver fibrosis has far-reaching clinical significance.

[0006] In addition, circRNAs act as miRNA sponges to regulate gene expression. Many circRNAs have been shown to exist in the nucleus, and the circRNA-miRNA axis is involved in various cascade signaling pathways, including those related to apoptosis, invasion, vascularization, and metastasis. Importantly, some evidence suggests that circRNAs can regulate the expression of pathogenicity-related genes at the transcriptional or post-transcriptional level. Non-coding RNAs such as microRNAs and long non-coding RNAs have been reported as important regulators of hepatic stellate cell activation and are involved in the process of liver fibrosis / cirrhosis. Like microRNAs and long non-coding RNAs, circRNAs have also been reported to be associated with hepatic stellate cell activation.

[0007] There are many targets and experimental drugs for anti-liver fibrosis treatment under research and development, mainly including angiotensin-converting enzyme inhibitors and angiotensin receptor antagonists (such as irbesartan and losartan) that resist the renin-angiotensin system, CXC chemokine receptors (CXC Chemokine receptor, CCR)2 and CCR5 dual antagonist (cenicriviroc), small molecule pan-caspase inhibitor (emricasan), apoptosis signaling regulator hormone enzyme 1 inhibitor (selonsertib), leptin's natural reverse regulator adiponectin, peroxisome mediator proliferator-activated receptor-γ nuclear receptor synthetic ligand thiazolidinediones, glucagon-like peptide-1 analog liraglutide, inhibit TGF-β1 and soluble receptor antagonists or proteases (such as hydroxynidone), prolyl hydroxylase inhibitors, matrix metalloproteinase tissue inhibitor-1 antibody, relaxin (serelaxin), endothelin-1 antagonist and receptor antagonist, lysyl oxidase-like protein 2 antibody (GS-6624), liver cell protectors hepatocyte nuclear factor 1α and 4α, etc. These drugs are still in the preclinical and clinical trial stage, and good efficacy and safety are expected.

[0008] At present, there is still a lack of serum-specific liver fibrosis diagnostic indicators. The evaluation of liver fibrosis based on a single blood indicator is limited. Combined detection and evaluation can improve the diagnostic value, but it cannot replace liver puncture. At the same time, effective intervention for liver fibrosis is still unsatisfactory. The present invention takes into account both detection and treatment, and is expected to become a choice for non-invasive diagnosis and effective treatment of liver fibrosis.

[0009] Circ-0000818 (the name comes from the circbase online database) is a circRNA. Different from traditional linear RNA, circRNA, as a special type of non-coding RNA molecule, has a closed ring structure in its spatial configuration. It is not affected by RNA exonucleases, has more stable expression, and is not easily degraded. Summary of the invention

[0010] In view of the above-mentioned technical problems in the prior art, the present invention provides the use of Circ-0000818 in the preparation of a kit for detecting liver fibrosis and a drug for treating liver fibrosis. The use of Circ-0000818 in the preparation of a kit for detecting liver fibrosis and a drug for treating liver fibrosis is to solve the technical problems in the prior art that the accuracy of liver fibrosis detection is low and there is no specific drug to effectively prevent or reverse liver fibrosis.

[0011] The present invention provides use of Circ-0000818 in preparing a biomarker for diagnosing liver fibrosis.

[0012] The present invention also provides the use of a reagent for detecting Circ-0000818 in preparing a kit for diagnosing liver fibrosis. The primers for detecting Circ-0000818 include two pairs of primers:

[0013] First primer pair: upstream primer gtcctgatgtcaagcaaagca (SEQ ID NO. 1);

[0014] Downstream primer: cagatgtacagggaagctgg (SEQ ID NO. 2);

[0015] Second primer pair: Upstream primer: gcaagatggctggttcctg (SEQ ID NO. 3);

[0016] Downstream primer: tcttgcactatgtccaacaaca (SEQ ID NO. 4).

[0017] The present invention also provides the use of Circ-0000818 in preparing a kit for diagnosing liver fibrosis.

[0018] The present invention also provides the use of circ-0000818 in preparing a drug for treating liver fibrosis.

[0019] The present invention also provides a use of a vector expressing circ-0000818 in preparing a drug for treating liver fibrosis.

[0020] Furthermore, the vector is an adenovirus.

[0021] The present invention studies the expression of circ-0000818 in human liver tissue and its role and mechanism in the process of liver fibrosis, and finds that the expression of circ-0000818 in liver tissue of patients with liver fibrosis is significantly decreased, and increasing the expression of circ-0000818 in hepatic stellate cells can alleviate the progression of liver fibrosis. Circ-0000818 adenovirus is used to treat mice with liver fibrosis induced by CCL4, and reporter genes show that circ-0000818 can inhibit the expression of miR-484, thereby regulating the expression of autophagy-related genes and liver fibrosis-related genes in stellate cells.

[0022] Compared with the existing technology, the present invention has significant technical progress. The present invention has important reference significance for the selection of early non-invasive diagnosis and treatment strategies for liver fibrosis in the future. At the same time, it avoids the complicated detection in the past, saves time and labor costs, and facilitates clinicians to adopt personalized prevention and treatment plans in a timely manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1The expression of circ_0000818 was shown to be associated with human liver fibrosis.

[0024] Figure 2 It was shown that overexpression of circ_0000818 in vitro could inhibit liver fibrosis.

[0025] Figure 3 It was shown that overexpression of circ_0000818 in vitro could inhibit liver fibrosis.

[0026] Figure 4 It was shown that circ_0000818 inhibited miR-484 expression through the ceRNA mechanism to regulate HSC autophagy and liver fibrosis. DETAILED DESCRIPTION

[0027] Example 1 Basic information and full sequence length of hsa_circ_0000818

[0028] We collected 5 human liver fibrosis tissue specimens and 5 human normal liver tissues for RNA-Seq sequencing analysis to determine the expression differences of human circ_0000818 in liver fibrosis liver tissue and normal liver tissue and the full-length sequence of circ_0000818.

[0029] The full-length sequence was compared with the circRNA online database circbase to confirm the RNA information.

[0030] Methods: Extract RNA from tissues to be sequenced, prepare sequencing reaction system, purify labeled / amplified RNA and perform quality control on the generated cRNA, perform base sequence hybridization, wash hybridization sequence, scan computer results and perform data analysis. The full-length sequence obtained after analysis was compared with the circRNA online database circbase to confirm the RNA information.

[0031] Parental gene: TBCD Length: 536 nt Chromosome location: chr17:80721840-80739597

[0032] All sequences:

[0033] . (SEQ ID NO.5)

[0034] Example 2

[0035] In order to better study the role of circ_0000818 in liver fibrosis, we performed pathological analysis on the liver fibrosis and normal liver tissues collected above, and divided the 10 liver tissue specimens into 5 grades according to international common standards by conventional histological staining techniques (HE, Masson and Sirius red staining). We continued to collect 20 human liver fibrosis tissue specimens and 21 human normal liver tissues for RT-qPCR detection, which confirmed that circ_0000818 was negatively correlated with the progression of liver fibrosis.

[0036] HE staining steps:

[0037] (1) Dewaxing: Place the paraffin sections in xylene I for 20 minutes, then place them in xylene II and let them stand at room temperature for 20 minutes (if the room temperature is too low, place the xylene in a 37°C incubator);

[0038] (2) Hydration: Remove the paraffin sections from xylene II and rehydrate them in gradient anhydrous ethanol at 100%, 95%, 85%, and 75% for 5 minutes each. Drain each section slightly; then wash with distilled water 3 times, 5 minutes each time.

[0039] (3) Nuclear staining: Dry the water around the tissue block, place the slide in a 5-staining cup filled with hematoxylin, completely immerse the slide, and let it stand at room temperature for 8 minutes;

[0040] (4) Blueing: Prepare ten staining jars filled with tap water, rinse with hematoxylin, and place the slides for 20 min. The cell nuclei will gradually turn blue. Observe under a microscope until the blue color is obvious, and proceed to the next step.

[0041] (5) Cytoplasm staining: Dry the water around the tissue block, place the slide in a staining cup filled with eosin, completely immerse the slide, let it stand at room temperature for 3 minutes, and observe the cytoplasm under a microscope until it is red enough;

[0042] (6) Transparency: Use tweezers to quickly rinse the slide in 70%, 80%, 90%, and 95% ethanol, and then place it in 100% anhydrous ethanol I and II for 1 min and 3 min respectively; take the slide out of 100% anhydrous ethanol II, drain it slightly, and place it in xylene I for 5 min and II for 8 min;

[0043] (7) Sealing: Take out the slide, wipe dry with xylene, place it horizontally, add an appropriate amount of neutral resin on one side of the slide, use tweezers to take the cover slip and slowly lower it from the resin side until the tissue block is completely sealed; keep the tissue block moist during all operation steps.

[0044] Sirius red staining steps:

[0045] (1) Conventional dewaxing and hydrating paraffin sections;

[0046] (2) Remove the slide from PBS and wipe off the PBS remaining around the tissue with a paper towel;

[0047] (3) Stain with Sirius red solution for 45 minutes;

[0048] (4) Rinse with running water to remove the stain on the surface of the slice;

[0049] (5) Wash the slides in 70%, 80%, 90%, and 95% gradient ethanol at a high speed, place them in 100% anhydrous ethanol I for 2 minutes, and place them in 100% anhydrous ethanol II for 3 minutes;

[0050] (6) Transparency: xylene I for 3 to 5 minutes, xylene II for 5 to 10 minutes;

[0051] (7) Add neutral gum to the tissue block and seal it with a coverslip. After it dries naturally, it can be observed under a microscope.

[0052] In situ hybridization steps:

[0053] (1) Rinse briefly in 1x PBS and then fix in 4% paraformaldehyde for 10 min at room temperature;

[0054] (2) The cells were perforated in 1x PBS containing 0.5% Tritonx-100 at 4°C for 5 min, and then washed with 1x PBS for 5 min;

[0055] (3) Add 200 μl of pre-hybridization buffer and incubate at 37° for 30 min;

[0056] (4) Hybridization was performed overnight in a humid chamber at 37°C using the probe and the Ribo-FISH kit (C10910, RiboBio);

[0057] (5) Wash three times with 1×PBS, 5 min each time; wash the slides three times with wash buffer I (4XSSC with 0.1% Tween 20), once with wash buffer II (2XSSC), incubate with wash buffer III (1X SSC) at 42° in the dark for 5 min, and then wash once with 1XPBS at room temperature;

[0058] (6) Then the cell nuclei were stained with DAPI for 10 min;

[0059] (7) Take photos using a confocal microscope.

[0060] Subsequently, we designed two pairs of specific primers for circ_0000818 (upstream primer 1: GTCCTGATGTCAAGCAAAGCA (SEQ ID NO.1); downstream primer 1: CAGATGTACAGGGAAGCTGG (SEQ ID NO.2); upstream primer 2: GCAAGATGGCTGGTTCCTG (SEQ ID NO.3); downstream primer 2: TCTTGCACTATGTCCAACAACA (SEQ ID NO.4)), and used qPCR technology to detect the expression of circ_0000818 and verify the molecular ring formation. It was found that compared with normal liver tissue, the expression of circ_0000818 in fibrotic and cirrhotic liver tissues was significantly decreased, and the expression of circ_0000818 was negatively correlated with the fibrosis stage. The expression levels of the two pairs of primers were consistent with the characteristics of the ring structure, confirming that the molecular structure was ring-shaped. In situ hybridization results showed that circ_0000818 was mainly deposited in the hepatocyte region.

[0061] The above results indicate that circ_0000818 is closely related to the degree of liver fibrosis, revealing that circ_0000818 has the potential to be used as a serum marker for detecting fibrosis in clinical practice, thereby enabling early detection and diagnosis of liver fibrosis through non-invasive means. Figure 1 As shown in the figure, circ_0000818 expression in liver tissue of patients with liver fibrosis decreased: A. RNA-seq sequencing found that circ_0000818 was lowly expressed in liver fibrosis tissue; B. circ_0000818 expression was negatively correlated with fibrosis stage; C. In situ hybridization suggested that circ_0000818 was mainly deposited in the hepatocyte area. *p<0.05.

[0062] Example 3

[0063] To further verify the role of circ_0000818 in liver fibrosis, we infected LX2 cells with circ_0000818 lentivirus, observed cell fluorescence after 48 hours, and observed that 90% of LX2 cells showed green fluorescence, screened with puro, and collected RNA after continued culture for 14 days. After RNA extraction and reversal into cDNA, qRT-PCR experiments were performed to verify the overexpression of circ_0000818. Finally, LX-2 stable transfectant circ_0000818-LX2 and NC stable transfectant NC-LX2 overexpressing circ_0000818 were constructed. The stable transfectant was used for in vitro proliferation (CCK-8 experiment), and about 3000 cells per well were seeded into 96-well plates for daily continuous cell proliferation detection. A migration experiment (transwell experiment) was performed using a stable transfected cell line. About 30,000 LX2 cells per well were seeded into a 24-well plate with a chamber for a cell migration experiment. After 48 hours, the cells were stained with crystal violet to observe the cell migration.

[0064] The results showed that after overexpression of circ_0000818, the proliferation and migration ability of circ_0000818-LX2 decreased. Further RT-PCR results showed that fibrosis-related genes TIMP1, TIMP2, MMP9, COL-Ⅲ, α-SMA, etc. decreased significantly, and Western-blotting results showed that the expression of COLⅠA1 and α-SMA proteins decreased significantly. At the same time, CCl4 was used to induce a mouse liver fibrosis model to verify the effect of circ_0000818 on liver fibrosis in vivo. The results are as follows Figure 2 As shown, overexpression of circ_0000818 can inhibit the proliferation and migration ability of LX2: A. Overexpression of circ_0000818 can inhibit the proliferation of LX2; B. Overexpression of circ_0000818 can inhibit the migration ability of LX2; C. Overexpression of circ_0000818 can downregulate the expression of fibrosis-related genes TIMP1, TIMP2, MMP9, COL-Ⅲ, and α-SMA in LX2; D. Overexpression of circ_0000818 can downregulate the expression of fibrosis-related COLⅠA1 and α-SMA proteins in LX2. *p<0.05.

[0065] We divided the experimental animals into two groups, namely the CCL4 modeling + control adenovirus (Ad-NC) treatment group and the CCL4 modeling + circ_0000818 adenovirus (Ad-circ_0000818) treatment group. 5% CCL4 was injected into the peritoneum of the two groups of mice twice a week. At the 8th week of modeling, Ad-NC and Ad-circ_0000818 were injected into the tail vein of the mice, respectively, and then 5% CCL4 was injected into the peritoneum of the two groups of mice. At 10 weeks, the mice were anesthetized and killed to obtain liver tissues for freezing and paraffin embedding. HE and Masson staining of liver tissue sections of the Ad-NC group and the Ad-circ_0000818 group showed that the liver structure of the Ad-NC group mice was destroyed, the hepatocytes were necrotic, and the hepatic cords were disordered. Compared with the Ad-NC group, the liver structure of the Ad-circ_0000818 group was significantly restored, the hepatocyte necrosis was reduced, and the hepatic cords were arranged radially around the central vein.

[0066] The above results indicate that overexpression of circ_0000818 can inhibit liver fibrosis, revealing that circ_0000818 can be used as a clinical intervention measure to alleviate the progression of liver fibrosis and achieve the purpose of reversing liver fibrosis. Figure 3 As shown, in vivo overexpression of circ_0000818 can inhibit CCl4-induced liver fibrosis in mice. Figure 4 As shown, in vitro overexpression of circ_0000818 can inhibit liver fibrosis: A. Overexpression of circ_0000818 can inhibit LX-2 proliferation, *p<0.05; B. Overexpression of circ_0000818 can inhibit LX-2 migration; C. Overexpression of circ_0000818 can downregulate the expression of LX-2 related genes; D. Overexpression of circ_0000818 can downregulate the expression of fibrosis-related proteins in LX-2.

[0067] Example 4

[0068] In order to explore the mechanism of circ_0000818 and the development of liver fibrosis, we performed reporter gene detection. First, the binding sites of circular RNA and miRNA and the binding sites of miRNA and ATG4B were predicted using the bioinformatics website and Miranda v3.3a software, and the base sequences of the corresponding gene fragments were obtained. Circ_0000818 and miR-484 cDNA fragments were obtained by PCR; the DNA fragments were purified by the GenClean column method; after the above DNA fragments were digested and ligated, they were transformed with DH5α competent cells and clones were selected. Plasmids were extracted from the selected clones, and then sequenced and identified. The wild-type and predicted binding site mutant circ_0000818 reporter gene plasmids WT-circ_0000818 and MUT-circ_0000818, as well as the miR-484 mimic and its negative control NC mimic were screened. The wild-type and predicted binding site mutant ATG4B reporter gene plasmids WT-ATG4B 3′-UTR and MUT-ATG4B 3′-UTR were prepared in the same way.

[0069] Reporter gene experiment process:

[0070] (1) HEK-293 cells were evenly plated in a 24-well plate, with the number of cells per well controlled at 1.5 × 10 5 . Experimental groups: WT-circ_0000818+miR-484mimic co-transfection group, MUT-circ_0000818+miR-484mimic co-transfection group, WT-circ_0000818+NC mimic co-transfection group and MUT-circ_0000818+NC mimic co-transfection group, a total of 4 groups. The above four groups of "reporter gene plasmid + mimic" were co-transfected into HEK-293 cell lines, RNA:lipofectamine 2000=1.5μl:1μl, 5% FBS complete culture medium. After 10h, the same concentration of culture medium was changed. Lipofectamine 2000 transferred the reporter gene plasmid into HEK-293 cells, the transfection ratio was: plasmid DNA:lipofectamine 2000=400ng:1μl, overnight. It was found that the luciferase activity of the WT-circ_0000818+miR-484mimic group was decreased compared with the MUT-circ_0000818+miR-484mimic group, the WT-circ_0000818+NC mimic group, and the MUT-circ_0000818+NC mimic group, indicating that miR-484 is the target gene of circ_0000818.

[0071] (2) The above-mentioned experimental and grouping methods were used to co-transfect HEK-293 cell lines with WT-ATG4B 3′-UTR+miR-484mimic co-transfection group, MUT-ATG4B 3′-UTR+miR-484mimic co-transfection group, WT-ATG4B 3′-UTR+NC mimic co-transfection group, and MUT-ATG4B 3′-UTR+NC mimic co-transfection group. It was found that the luciferase activity of the WT-ATG4B 3′-UTR+miR-484mimic group was reduced compared with the MUT-ATG4B 3′-UTR+miR-484mimic group, the WT-ATG4B 3′-UTR+NC mimic group, and the MUT-ATG4B 3′-UTR+NC mimic group. This indicates that ATG4B is a target gene of miR-484.

[0072] The LX-2 cell line was infected with the lentivirus lenti-circ_0000818 overexpressing circ_0000818 and the negative control lentivirus lenti-NC at an MOI of 20, and then the stable transfected strains lenti-circ_0000818-LX2 and lenti-NC-LX2 were selected with 2 ng / ml puromycin. RNA was extracted by the trizol method, and the corresponding cDNA was obtained by the TAKARA reverse transcription kit. RT-qPCR was used to detect the changes in downstream genes (experimental method: SYBR Green method. Reaction conditions: 94℃30s pre-denaturation→95℃5s→60℃30s, 40 cycles, and melting curve detection).

[0073] The results showed that the expression of autophagy-related genes ATG5, LC3, Beclin1 and other genes increased significantly. Western-blotting showed that after overexpression of circ_0000818, the expression of autophagy-related proteins ATG5 and ATG7 increased, while the expression of fibrosis indicators COLIA1 and α-SMA decreased significantly.

[0074] Shanghai Dongfang Hospital(Dongfang Hospital Affiliated to TongjiUniversity

[0075] First primer pair: Upstream primer: gtcctgatgtcaagcaaagca (SEQ ID NO. 1);

[0076] Downstream primer: cagatgtacagggaagctgg (SEQ ID NO. 2);

[0077] Second primer pair: Forward primer: gcaagatggctggttcctg (SEQ ID NO.3);

[0078] Reverse primer: tcttgcactatgtccaacaaca (SEQ ID NO.4).

[0079] hsa_circ_0000818:

[0080] aatggatgatgaacttgttgttggacatagtgcaagatcagacatctccagcttcccttgtacatctggcttttaaatttctttacatcatcaccaaggttcgaggctataaaacatttcttcgtttatttcctcatgaagttgccgatgtagagcctgttttagatttggtcacaattcagaatcccaaggaccatgaagcttgggaaacccgctacatgcttttgctctggctctccgtgacctgcctgatcccttttgatttttctcgccttgacgggaacctcctcacccagcctgggcaagcacgaatgtccataatggaccgtattctccaaatagcagagtcctacttgattgtcagtgacaaggcccgagatgcagctgctgtccttgtgtccagatttatcacacgtcctgatgtcaagcaaagcaagatggctgagttcctggactggagcctgtgcaatctggcccgttcctccttccagaccatgcagggggtcatcaccatggatgggacgctgcaggccctg. (SEQ ID NO.5)

Claims

1. Use of a reagent for detecting Circ-0000818 in preparing a kit for diagnosing liver fibrosis, wherein the reagent for detecting Circ-0000818 comprises a primer.

2. Use of a vector expressing circ-0000818 in the preparation of a drug for treating liver fibrosis.

3. The use according to claim 2, characterized in that: The vector is adenovirus.

Images