NKP46 gene humanized non-human animal and its construction method and application

Abstract

The present invention provides a non-human animal with a humanized NKP46 gene and a construction method thereof, a humanized NKP46 protein, a humanized NKP46 gene, a targeting vector, and the non-human animal obtained by the above construction method and its application in the field of biomedicine. The non-human animal utilizes homologous recombination to introduce a nucleotide sequence encoding a human NKP46 protein into the genome of the non-human animal. The animal can normally express the humanized NKP46 protein in the body and can serve as an animal model for studying the human NKP46 signaling mechanism and screening drugs for tumors and immune-related diseases, and has important application value for the development of new drugs for immune targets.

Description

Technical Field

[0001] The present invention belongs to the field of animal genetic engineering and genetic modification, and specifically relates to a non-human animal with humanized NKP46 gene, a construction method thereof, and application in the field of biomedicine. Background Art

[0002] The natural killer cell-associated protein NKP46, also known as natural cytotoxicity-triggering receptor 1 (NCR1) and lymphocyte antigen 94 homologous protein (LY94), is a member of the natural cytotoxicity agonist receptor (NCR) family, along with NKP30 and NKP44. Unlike NKP30 and NKP44, which are expressed only on human NK cells, NKP46 is expressed on both human and mouse NK cells. Activated NK cells have a potent tumor-killing effect, and NKP46 is required for transmitting activation stimuli. Studies have found that NKP46-positive lymphocytes have been detected in solid tumors such as human colon cancer, head and neck cancer, kidney cancer, lung cancer, pancreatic cancer, and gastric cancer. This makes NKP46 an important target for activating the anti-tumor immunity of NK cells in tumors.

[0003] In addition to killing tumors, NKP46 also serves as the first line of defense against early viral infection. Studies have found that NK cells recognize viral hemagglutinin through NKP46 and agglutinate with it, thereby killing virus-infected cells.

[0004] With the continuous development and maturity of genetic engineering technology, the replacement or substitution of homologous animal genes with human genes has become a reality. The development of humanized experimental animal models through this approach is a future direction for animal models. Genetically humanized animal models, which utilize gene editing technology to replace homologous genes in the animal genome with normal or mutant human genes, can create animal models with normal or mutant genes that more closely resemble human physiological or disease characteristics. However, due to the differences in physiology and pathology between animals and humans, coupled with genetic complexity (for example, the NKP46 protein shares only 56.9% identity between humans and mice), the development of effective humanized animal models for new drug development remains a major challenge.

[0005] Given the potential application value of NKP46 in the field of tumor treatment, in order to further explore its relevant biological characteristics, improve the effectiveness of preclinical efficacy trials, increase the success rate of R&D, make preclinical trials more effective and minimize R&D failures, there is an urgent need to develop non-human animal models of NKP46-related signaling pathways in this field. Summary of the Invention

[0006] The NKP46 gene humanized non-human animals described in this application can improve and enhance cell or tissue transplantation humanized animal models through gene humanization. More importantly, due to the insertion of human gene fragments, human or humanized NKP46 proteins can be expressed in the animals, which can be used as targets for drugs that can only recognize human NKP46 protein sequences, providing the possibility of screening anti-human antibodies and other drugs at the animal level. In addition, the non-human animals obtained by this method can also be mated with other genetically modified non-human animals (preferably humanized non-human animals) to obtain multi-gene humanized animal models for screening and evaluating the efficacy of human drugs and combination drugs targeting this signaling pathway. The present invention has broad application prospects in academic and clinical research.

[0007] In a first aspect, the present invention provides a method for constructing a non-human animal with humanized NKP46 gene, wherein the non-human animal expresses human or humanized NKP46 protein in vivo.

[0008] Preferably, the expression of endogenous NKP46 protein in the non-human animal is reduced or absent.

[0009] Preferably, the humanized NKP46 protein comprises all or part of the human NKP46 protein.

[0010] Preferably, the humanized NKP46 protein comprises all or part of the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of the human NKP46 protein.

[0011] Preferably, the humanized NKP46 protein comprises all or part of the extracellular region of the human NKP46 protein, further preferably comprises at least 100 to at least 237 (e.g., 100, 150, 200, 210, 220, 230, 232, 233, 234, 235, 236, 237) consecutive amino acid sequences of the extracellular region of the human NKP46 protein, and further preferably comprises the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; The amino acid sequence shown at positions 22-253 of NO:2 differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or, comprises an amino acid sequence shown at positions 22-253 of SEQ ID NO:2, including substitution, deletion and / or insertion of one or more amino acid residues.

[0012] Preferably, the humanized NKP46 protein comprises all or part of the signal peptide of the human NKP46 protein, further preferably comprises at least 10 (e.g., 10, 15, 16, 17, 18, 19, 20, 21) consecutive amino acid sequences of the signal peptide of the human NKP46 protein, and further preferably comprises the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid difference from the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid difference from the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; NO: 2 The amino acid sequence shown in positions 1-21 or 2-21, including substitution, deletion and / or insertion of one or more amino acid residues.

[0013] In one embodiment of the present invention, the humanized NKP46 protein comprises all or part of the extracellular region and / or signal peptide of the human NKP46 protein. The amino acid sequence of the humanized NKP46 protein comprises any one of the following groups:

[0014] A) all or part of the amino acid sequence set forth in positions 2-253 or 1-253 of SEQ ID NO: 2;

[0015] B) at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in positions 2-253 or 1-253 of SEQ ID NO: 2;

[0016] C) differs from the amino acid sequence as set forth in positions 2-253 or 1-253 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0017] D) an amino acid sequence comprising substitutions, deletions and / or insertions of one or more amino acid residues as shown in positions 2-253 or 1-253 of SEQ ID NO: 2.

[0018] Preferably, the humanized NKP46 protein further comprises a portion of a non-human NKP46 protein, preferably a cytoplasmic region and / or a transmembrane region of a non-human NKP46 protein, and further preferably comprises a partial amino acid sequence of an extracellular region and / or a signal peptide of a non-human NKP46 protein. In a specific embodiment of the present invention, the humanized NKP46 protein comprises all or part of the amino acids set forth at positions 1 and / or 254-325 of SEQ ID NO: 1, or comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity to the amino acid sequence set forth at positions 1 and / or 254-325 of SEQ ID NO: 1.

[0019] In a specific embodiment of the present invention, the humanized NKP46 protein comprises a human NKP46 protein signal peptide, a non-human animal NKP46 transmembrane region, a non-human animal NKP46 cytoplasmic region and a human NKP46 extracellular region, and preferably further comprises a portion of the non-human animal NKP46 extracellular region and / or signal peptide.

[0020] Preferably, the humanized NKP46 protein comprises the amino acid sequence encoded in whole or in part by the human NKP46 gene, more preferably comprises the amino acid sequence encoded in whole or in part by exons 1 to 7 of the human NKP46 gene, further preferably comprises the amino acid sequence encoded in one, two or more than three exons of exons 1 to 7 of the human NKP46 gene, and even more preferably comprises the amino acid sequence encoded in part by exon 1, all by exons 2 to 6, and part by exon 7 of the human NKP46 gene. The portion of exon 1 comprises a nucleotide sequence of at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 70, or 74 bp), preferably comprises at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, or 5) amino acids of the signal peptide in exon 1. The portion of exon 7 comprises a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380, or 384 bp).

[0021] In a specific embodiment of the present invention, the humanized NKP46 protein comprises the amino acid sequence encoded by SEQ ID NO: 7; or, comprises an amino acid sequence encoded by nucleotides that are at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence of SEQ ID NO: 7; or, comprises an amino acid sequence encoded by a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 7 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotides; or, comprises an amino acid sequence encoded by a nucleotide sequence having a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence of SEQ ID NO: 7.

[0022] Preferably, the humanized NKP46 protein comprises an amino acid sequence encoded by a non-human animal NKP46 gene, and further preferably comprises an amino acid sequence encoded in whole or in part by exon 1 and / or exon 7 of a non-human animal.

[0023] In a specific embodiment of the present invention, the amino acid sequence of the humanized NKP46 protein comprises any one of the following groups:

[0024] (A) all or part of the amino acid sequence shown in SEQ ID NO: 9;

[0025] (B) is at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence of SEQ ID NO: 9;

[0026] (C) differs from the amino acid sequence of SEQ ID NO: 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0027] (D) An amino acid sequence as shown in SEQ ID NO: 9, comprising a substitution, deletion and / or insertion of one or more amino acid residues.

[0028] Preferably, the non-human animal genome comprises a human or humanized NKP46 gene, and further preferably, the humanized NKP46 gene comprises a portion of a human NKP46 gene.

[0029] Preferably, the humanized NKP46 gene comprises all or part of the nucleotide sequence encoding the human NKP46 protein, preferably comprises all or part of the nucleotide sequence encoding the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of the human NKP46 protein.

[0030] Preferably, the humanized NKP46 gene comprises all or part of a nucleotide sequence encoding the extracellular region of the human NKP46 protein, further preferably comprises a nucleotide sequence encoding the amino acids as set forth at positions 22-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that are at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth at positions 22-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that differ from the amino acid sequence as set forth at positions 22-253 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or, comprises a nucleotide sequence encoding one or more amino acid residues as set forth at positions 22-253 of SEQ ID NO: 2, including substitutions, deletions, and / or insertions.

[0031] Preferably, the humanized NKP46 gene comprises all or part of a nucleotide sequence encoding a signal peptide of a human NKP46 protein, further preferably comprises a nucleotide sequence encoding the amino acids as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that are at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that differ from the amino acid sequence as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2 in no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or, comprises a nucleotide sequence encoding one or more amino acid residues as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2, including substitutions, deletions, and / or insertions.

[0032] In a specific embodiment of the present invention, the humanized NKP46 gene comprises all or part of the nucleotide sequence encoding the extracellular region and / or signal peptide of human NKP46 protein, preferably comprising a nucleotide sequence encoding amino acids 2-253 or 1-253 of SEQ ID NO: 2.

[0033] In a specific embodiment of the present invention, the humanized NKP46 gene comprises a nucleotide sequence encoding the above-mentioned humanized NKP46 protein.

[0034] Preferably, the humanized NKP46 gene comprises all or part of exons 1 to 7 of the human NKP46 gene, further preferably comprises one, two or more exons from exons 1 to 7 of the human NKP46 gene, and further preferably comprises part of exon 1, all of exons 2 to 6 and part of exon 7 of the human NKP46 gene, wherein the part of exon 1 comprises at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 70 or 74 bp), preferably comprising at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, 5) amino acids of the signal peptide in exon 1, and the portion of exon 7 comprising a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380 or 384 bp), further preferably comprising SEQ ID NO:7; or, comprising a nucleotide sequence that is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence set forth in SEQ ID NO:7; or, comprising no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide difference from the nucleotide sequence set forth in SEQ ID NO:7; or, comprising a nucleotide sequence as set forth in the nucleotide sequence set forth in SEQ ID NO:7, including substitutions, deletions, and / or insertions of one or more nucleotides.

[0035] Preferably, the humanized NKP46 gene further comprises a portion of a non-human animal NKP46 gene, preferably comprises all or part of exon 1 and / or exon 7 of a non-human animal NKP46 gene.

[0036] Preferably, the humanized NKP46 gene comprises the nucleotide sequence shown in SEQ ID NO: 10 and / or SEQ ID NO: 11.

[0037] In a specific embodiment of the present invention, the mRNA transcribed from the humanized NKP46 gene comprises any one of the following groups:

[0038] (a) all or part of the nucleotide sequence shown in SEQ ID NO: 8;

[0039] (b) is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence of SEQ ID NO: 8;

[0040] (c) differs from the nucleotide sequence of SEQ ID NO: 8 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide; or

[0041] (d) A nucleotide sequence comprising a substitution, deletion and / or insertion of one or more nucleotides compared to the nucleotide sequence shown in SEQ ID NO: 8.

[0042] Preferably, the humanized NKP46 gene further comprises a specific inducer or repressor. Further preferably, the specific inducer or repressor can be a conventional inducing or repressing substance.

[0043] In a specific embodiment of the present invention, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0044] Preferably, the genome of the non-human animal comprises all or part of a nucleotide sequence encoding a human NKP46 protein, preferably comprises all or part of a nucleotide sequence encoding a signal peptide, an extracellular region, a cytoplasmic region and / or a transmembrane region of a human NKP46 protein, further preferably comprises all or part of a nucleotide sequence encoding an extracellular region and / or a signal peptide of a human NKP46 protein, and further preferably comprises a nucleotide sequence encoding the amino acids as shown in positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids having at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identity to the amino acid sequence as shown in positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids having at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identity to the amino acid sequence as shown in positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; A nucleotide sequence that differs from the amino acid sequence as set forth in positions 1-21, 2-21, 22-253, 1-253, or 2-253 of SEQ ID NO: 2 in no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid sequence; or, a nucleotide sequence encoding the same amino acid sequence as set forth in positions 1-21, 2-21, 22-253, 1-253, or 2-253 of SEQ ID NO: 2, including substitutions, deletions, and / or insertions of one or more amino acid residues.

[0045] Preferably, the construction method comprises introducing a donor nucleotide sequence into the NKP46 locus of a non-human animal.

[0046] Preferably, the donor nucleotide sequence comprises one of the following groups:

[0047] A) a portion of the human NKP46 gene, preferably comprising all or part of exons 1 to 7 of the human NKP46 gene, more preferably comprising one, two or more exons from exons 1 to 7 of the human NKP46 gene, and even more preferably comprising part of exon 1, all of exons 2 to 6 and part of exon 7 of the human NKP46 gene, wherein the portion of exon 1 comprises at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 71, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 770, 780 0 or 74 bp), preferably comprising at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, 5) amino acids of the signal peptide in exon 1, and the portion of exon 7 comprising a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380 or 384 bp), further preferably comprising SEQ : The nucleotide sequence of SEQ ID NO:7; or, comprising at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity to the nucleotide sequence of SEQ ID NO:7; or, comprising no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide difference from the nucleotide sequence of SEQ ID NO:7; or, comprising a nucleotide sequence having a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence of SEQ ID NO:7;

[0048] B) all or part of the nucleotide sequence encoding human NKP46 protein, preferably comprising all or part of the nucleotide sequence encoding the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of human NKP46 protein, further preferably comprising all or part of the nucleotide sequence encoding the extracellular region and / or signal peptide of human NKP46 protein, more preferably comprising a nucleotide sequence encoding at least 100 consecutive amino acids of the extracellular region of human NKP46 protein and / or a nucleotide sequence of at least 10 consecutive amino acids of the signal peptide, further preferably comprising a nucleotide sequence encoding amino acids shown at positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; or, comprising a nucleotide sequence encoding the amino acids shown at positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; a nucleotide sequence that is at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, 1-253, or 2-253; or a nucleotide sequence that encodes an amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, or 2-253 that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or a nucleotide sequence that encodes an amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, 1-253, or 2-253, comprising a substitution, deletion, and / or insertion of one or more amino acid residues;

[0049] C) a nucleotide sequence encoding a human or humanized NKP46 protein; or

[0050] D) Nucleotide sequence of human or humanized NKP46 gene.

[0051] Preferably, the human or humanized NKP46 gene is operably linked to endogenous regulatory elements.

[0052] Preferably, the introduction is insertion or replacement, and the insertion or replacement site is after the endogenous regulatory element of the NKP46 gene.

[0053] The insertion is to place the target fragment directly between two adjacent bases without deleting nucleotides. The target fragment may be, for example, a human NKP46 gene, a humanized NKP46 gene, a nucleotide sequence encoding a human or humanized NKP46 protein, or a nucleotide sequence obtained by splicing human NKP46 and non-human NKP46 genes. Of course, it can also be a partial nucleotide sequence of the human NKP46 gene, preferably, exon x+1 to exon 7 of the human NKP46 gene are inserted adjacent to exon x of the non-human animal NKP46 gene; for example, exons 2 to 7 of the human NKP46 gene are inserted adjacent to exon 1 of the non-human animal NKP46 gene, exons 3 to 7 of the human NKP46 gene are inserted adjacent to exon 2 of the non-human animal NKP46 gene, exons 4 to 7 of the human NKP46 gene are inserted adjacent to exon 3 of the non-human animal, exons 5 to 7 of the human NKP46 gene are inserted adjacent to exon 4 of the non-human animal, and so on.

[0054] Preferably, depending on the needs of the specific embodiment, the insertion may further include disrupting the coding frame of the non-human animal's endogenous NKP46 gene or disrupting the coding frame of the endogenous NKP46 gene after the insertion sequence, followed by the insertion operation. Alternatively, the insertion step may both cause a frameshift mutation in the endogenous NKP46 gene and achieve the step of inserting the human sequence.

[0055] Further preferably, according to the needs of the specific embodiment, the insertion may also add an auxiliary sequence (such as a stop codon or a sequence containing a termination function, etc.) or other methods (such as flipping the sequence or knocking out the sequence) after the inserted target fragment so that the endogenous NKP46 protein of the non-human animal after the insertion site cannot be normally expressed.

[0056] Wherein, the replacement includes replacement of corresponding positions or replacement of non-corresponding positions. The replacement of corresponding positions does not only mechanically represent the direct corresponding replacement of base sites of human and non-human animal NKP46 genes, but also includes the replacement of corresponding functional regions, such as replacing the nucleotide sequence encoding the extracellular region of non-human animal NKP46 protein with the nucleotide sequence encoding the extracellular region of human NKP46 protein, replacing the nucleotide sequence encoding the signal peptide of non-human animal NKP46 protein with the nucleotide sequence encoding the signal peptide of human NKP46 protein, replacing the nucleotide sequence encoding the transmembrane region of non-human animal NKP46 protein with the nucleotide sequence encoding the transmembrane region of human NKP46 protein, and replacing the nucleotide sequence encoding the cytoplasmic region of human NKP46 protein with the nucleotide sequence encoding the transmembrane region of non-human animal NKP46 protein. The nucleotide sequence encoding the cytoplasmic region of the non-human NKP46 protein is replaced by a nucleotide sequence encoding the signal peptide and extracellular region of the non-human NKP46 protein, the nucleotide sequence encoding the signal peptide and extracellular region of the non-human NKP46 protein is replaced by a nucleotide sequence encoding the signal peptide, extracellular region and cytoplasmic region of the non-human NKP46 protein, the nucleotide sequence encoding the signal peptide, extracellular region and cytoplasmic region of the non-human NKP46 protein is replaced by a nucleotide sequence encoding the signal peptide, extracellular region and cytoplasmic region of the human NKP46 protein, and the nucleotide sequence encoding the signal peptide, extracellular region, cytoplasmic region and transmembrane region of the non-human NKP46 protein is replaced by a nucleotide sequence encoding the signal peptide, extracellular region, cytoplasmic region and transmembrane region of the human NKP46 protein. For example, all or part of exons 1 to 7 of the non-human NKP46 gene is replaced by all or part of exons 1 to 7 of the human NKP46 gene. For example, exons 1 to 6 of the human NKP46 gene are replaced by exons 1 to 6 of the non-human NKP46 gene, and so on.

[0057] Preferably, the introduction into the non-human animal NKP46 locus involves replacing the corresponding region of the non-human animal. Preferably, all or part of exons 1 to 7 of the non-human animal NKP46 gene are replaced. Further preferably, part of exon 1, all of exons 2 to 6, and part of exon 7 of the non-human animal NKP46 gene are replaced. Preferably, the nucleotide sequence encoding amino acids 1-16 or 2-16, 17-253, 1-253, or 2-253 of the non-human animal NKP46 gene is replaced.

[0058] Preferably, the human or humanized NKP46 gene is homozygous or heterozygous for the modification of the endogenous NKP46 gene.

[0059] In a specific embodiment of the present invention, a nucleotide sequence encoding amino acids 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2 is inserted into or replaced by a nucleotide sequence encoding amino acids 1-16 or 2-16, 17-253, 1-253 or 2-253 of SEQ ID NO: 1 in a non-human animal NKP46 gene.

[0060] In a specific embodiment of the present invention, the nucleotide sequence shown in SEQ ID NO: 7 is inserted into or replaced with all or part of exons 1 to 7 of the non-human animal NKP46 gene, or the nucleotide sequence encoding amino acids 1-16 or 2-16, 17-253, 1-253 or 2-253 of SEQ ID NO: 1 in the non-human animal NKP46 gene is inserted into or replaced.

[0061] In a specific embodiment of the present invention, a cDNA sequence encoding human NKP46 protein is inserted into or replaced at the non-human animal NKP46 gene locus, preferably replacing the coding sequence of the non-human animal NKP46 gene.

[0062] In one embodiment of the present invention, a nucleotide sequence comprising a human or humanized NKP46 gene is inserted into or replaced at the non-human animal NKP46 gene locus, preferably replacing the coding sequence of the non-human animal NKP46 gene.

[0063] Preferably, the human or humanized NKP46 gene is regulated in a non-human animal by endogenous regulatory elements.

[0064] Preferably, at least one chromosome in the genome of the non-human animal contains a humanized NKP46 gene.

[0065] Preferably, at least one cell in the non-human animal expresses human or humanized NKP46 protein.

[0066] Preferably, gene editing technology is used to construct non-human animals, and the gene editing technology includes gene targeting technology using embryonic stem cells, clustered regularly interspaced short palindromic repeats (CRISPR / Cas9) technology, zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology, homing nuclease (megabase-wide ribozyme) or other molecular biology technology.

[0067] Preferably, the construction method comprises using a targeting vector and / or sgRNA for construction in non-human animals.

[0068] Preferably, the targeting vector comprises a donor nucleotide sequence.

[0069] Preferably, the donor nucleotide sequence comprises any one of the following groups:

[0070] A) a portion of the human NKP46 gene, preferably comprising all or part of exons 1 to 7 of the human NKP46 gene, more preferably comprising one, two or more exons from exons 1 to 7 of the human NKP46 gene, and even more preferably comprising part of exon 1, all of exons 2 to 6 and part of exon 7 of the human NKP46 gene, wherein the portion of exon 1 comprises at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 71, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 770, 780 0 or 74 bp), preferably comprising at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, 5) amino acids of the signal peptide in exon 1, and the portion of exon 7 comprising a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380 or 384 bp), further preferably comprising SEQ : The nucleotide sequence of SEQ ID NO:7; or, comprising at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity to the nucleotide sequence of SEQ ID NO:7; or, comprising no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide difference from the nucleotide sequence of SEQ ID NO:7; or, comprising a nucleotide sequence having a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence of SEQ ID NO:7;

[0071] B) all or part of the nucleotide sequence encoding human NKP46 protein, preferably comprising all or part of the nucleotide sequence encoding the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of human NKP46 protein, further preferably comprising all or part of the nucleotide sequence encoding the extracellular region and / or signal peptide of human NKP46 protein, more preferably comprising a nucleotide sequence encoding at least 100 consecutive amino acids of the extracellular region of human NKP46 protein and / or a nucleotide sequence of at least 10 consecutive amino acids of the signal peptide, further preferably comprising a nucleotide sequence encoding amino acids shown at positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; or, comprising a nucleotide sequence encoding the amino acids shown at positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; a nucleotide sequence that is at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, 1-253, or 2-253; or a nucleotide sequence that encodes an amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, 1-253, or 2-253 that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or a nucleotide sequence that encodes an amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, 1-253, or 2-253, comprising a substitution, deletion, and / or insertion of one or more amino acid residues;

[0072] C) a nucleotide sequence encoding a human or humanized NKP46 protein; or

[0073] D) Nucleotide sequence of human or humanized NKP46 gene.

[0074] Preferably, the targeting vector comprises the nucleotide sequence shown in SEQ ID NO: 10 and / or SEQ ID NO: 11.

[0075] Preferably, the targeting vector further comprises a 5' arm (5' homology arm) and / or a 3' arm (3' homology arm).

[0076] The 5' arm is a DNA fragment homologous to the 5' end of the switch region to be altered, and is selected from a 100-10,000 nucleotide sequence of genomic DNA of a non-human animal NKP46 gene. Preferably, the 5' arm is at least 90% homologous to NCBI accession number NC_000073.7; further preferably, the 5' arm is 90% homologous to SEQ ID NO: 3 or 5, or comprises the nucleotide sequence set forth in SEQ ID NO: 3 or 5.

[0077] The 3' arm is a DNA fragment homologous to the 3' end of the switch region to be altered, and is selected from genomic DNA of the NKP46 gene of a non-human animal and has a length of 100-10,000 nucleotides. Preferably, the 3' arm is at least 90% homologous to NCBI accession number NC_000073.7; further preferably, the 3' arm is 90% homologous to SEQ ID NO: 4 or 6, or comprises the nucleotide sequence set forth in SEQ ID NO: 4 or 6.

[0078] Preferably, the sgRNA targets the NKP46 gene of a non-human animal, and the sequence of the sgRNA is on the target sequence on the NKP46 gene to be changed.

[0079] Preferably, the sgRNA target site is located on the sequence from exon 1 to exon 7 of the NKP46 gene.

[0080] Preferably, the target site of the sgRNA is located on the exon 1 and / or exon 7 sequence of the NKP46 gene.

[0081] Preferably, the target sequence of the sgRNA on the NKP46 gene is shown in SEQ ID NO: 14 and / or 15.

[0082] In another specific embodiment of the present invention, the construction method includes introducing the above-mentioned targeting vector into embryonic stem cells of a non-human animal, and after a short culture, introducing it into a previously isolated blastocyst. The obtained chimeric blastocyst is transplanted into the oviduct of a recipient mother mouse, allowed to develop, and the non-human animal with humanized NKP46 gene is obtained by identification and screening.

[0083] In a specific embodiment of the present invention, the construction method includes introducing the above-mentioned targeting vector, sgRNA and Cas9 into non-human animal cells, culturing the cells (preferably fertilized eggs), and then transplanting the cultured cells into the oviduct of a female non-human animal, allowing them to develop, and identifying and screening to obtain non-human animals with humanized NKP46 genes.

[0084] Preferably, the construction method further comprises mating, in vitro fertilization, or direct gene editing of the NKP46 gene-humanized non-human animal with other genetically modified non-human animals, and screening to obtain multi-gene modified non-human animals. Preferably, the other genes are selected from at least one of NKG2D, EGFR, HER2, B7H3, BCMA, FAP, CXCR4, CSF2, TNFR2, IL-2, IL-15, IL-15RA, IL-10, PD-1, PD-L1, TIGIT, CD16A, CD2, or CD38.

[0085] Preferably, the human or humanized NKP46 gene and / or other genes are homozygous or heterozygous for the endogenous modified locus.

[0086] Preferably, the non-human animal can be selected from any non-human animal that can be gene-edited to produce humanized genes, such as rodents, pigs, rabbits, monkeys, etc.

[0087] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0088] Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferably, the immunodeficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit, or an immunodeficient monkey. Even more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Most preferably, the immunodeficient mouse is a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - (NRG) mice, Rag 2 - / - -IL2rg - / - (RG) mice, NOD / SCID mice, or nude mice.

[0089] A second aspect of the present invention provides a non-human animal with a humanized NKP46 gene, wherein the non-human animal expresses human or humanized NKP46 protein, or the genome of the non-human animal contains a portion of a human NKP46 gene.

[0090] Preferably, the humanized NKP46 protein comprises all or part of the human NKP46 protein.

[0091] Preferably, the humanized NKP46 protein comprises all or part of the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of the human NKP46 protein.

[0092] Preferably, the humanized NKP46 protein comprises all or part of the extracellular region of the human NKP46 protein, further preferably comprises at least 100 to at least 237 (e.g., 100, 150, 200, 210, 220, 230, 232, 233, 234, 235, 236, 237) consecutive amino acid sequences of the extracellular region of the human NKP46 protein, and further preferably comprises the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; The amino acid sequence shown at positions 22-253 of NO:2 differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or, comprises an amino acid sequence shown at positions 22-253 of SEQ ID NO:2, including substitution, deletion and / or insertion of one or more amino acid residues.

[0093] Preferably, the humanized NKP46 protein comprises all or part of the signal peptide of the human NKP46 protein, further preferably comprises at least 10 (e.g., 10, 15, 16, 17, 18, 19, 20, 21) consecutive amino acid sequences of the signal peptide of the human NKP46 protein, and further preferably comprises the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid difference from the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid difference from the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; NO: 2 The amino acid sequence shown in positions 1-21 or 2-21, including substitution, deletion and / or insertion of one or more amino acid residues.

[0094] In one embodiment of the present invention, the humanized NKP46 protein comprises all or part of the extracellular region and / or signal peptide of the human NKP46 protein. The amino acid sequence of the humanized NKP46 protein comprises any one of the following groups:

[0095] A) all or part of the amino acid sequence set forth in positions 2-253 or 1-253 of SEQ ID NO: 2;

[0096] B) at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in positions 2-253 or 1-253 of SEQ ID NO: 2;

[0097] C) differs from the amino acid sequence as set forth in positions 2-253 or 1-253 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0098] D) an amino acid sequence comprising substitutions, deletions and / or insertions of one or more amino acid residues as shown in positions 2-253 or 1-253 of SEQ ID NO: 2.

[0099] Preferably, the humanized NKP46 protein further comprises a portion of a non-human NKP46 protein, preferably a cytoplasmic region and / or a transmembrane region of a non-human NKP46 protein, and further preferably comprises a partial amino acid sequence of an extracellular region and / or a signal peptide of a non-human NKP46 protein. In a specific embodiment of the present invention, the humanized NKP46 protein comprises all or part of the amino acids set forth at positions 1 and / or 254-325 of SEQ ID NO: 1, or comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity to the amino acid sequence set forth at positions 1 and / or 254-325 of SEQ ID NO: 1.

[0100] In a specific embodiment of the present invention, the humanized NKP46 protein comprises a human NKP46 protein signal peptide, a non-human animal NKP46 transmembrane region, a non-human animal NKP46 cytoplasmic region and a human NKP46 extracellular region, and preferably further comprises a portion of the non-human animal NKP46 extracellular region and / or signal peptide.

[0101] Preferably, the humanized NKP46 protein comprises the amino acid sequence encoded in whole or in part by the human NKP46 gene, more preferably comprises the amino acid sequence encoded in whole or in part by exons 1 to 7 of the human NKP46 gene, further preferably comprises the amino acid sequence encoded in one, two or more than three exons of exons 1 to 7 of the human NKP46 gene, and even more preferably comprises the amino acid sequence encoded in part by exon 1, all by exons 2 to 6, and part by exon 7 of the human NKP46 gene. The portion of exon 1 comprises a nucleotide sequence of at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 70, or 74 bp), preferably comprises at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, or 5) amino acids of the signal peptide in exon 1. The portion of exon 7 comprises a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380, or 384 bp).

[0102] In a specific embodiment of the present invention, the humanized NKP46 protein comprises the amino acid sequence encoded by SEQ ID NO: 7; or, comprises an amino acid sequence encoded by nucleotides that are at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence of SEQ ID NO: 7; or, comprises an amino acid sequence encoded by a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 7 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotides; or, comprises an amino acid sequence encoded by a nucleotide sequence having a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence of SEQ ID NO: 7.

[0103] Preferably, the humanized NKP46 protein comprises an amino acid sequence encoded by a non-human animal NKP46 gene, and further preferably comprises an amino acid sequence encoded in whole or in part by exon 1 and / or exon 7 of a non-human animal.

[0104] In a specific embodiment of the present invention, the amino acid sequence of the humanized NKP46 protein comprises any one of the following groups:

[0105] (A) all or part of the amino acid sequence shown in SEQ ID NO: 9;

[0106] (B) is at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence of SEQ ID NO: 9;

[0107] (C) differs from the amino acid sequence of SEQ ID NO: 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0108] (D) An amino acid sequence as shown in SEQ ID NO: 9, comprising a substitution, deletion and / or insertion of one or more amino acid residues.

[0109] Preferably, the humanized NKP46 gene comprises a portion of the human NKP46 gene.

[0110] Preferably, the humanized NKP46 gene comprises all or part of the nucleotide sequence encoding the human NKP46 protein, preferably comprises all or part of the nucleotide sequence encoding the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of the human NKP46 protein.

[0111] Preferably, the humanized NKP46 gene comprises all or part of a nucleotide sequence encoding the extracellular region of the human NKP46 protein, further preferably comprises a nucleotide sequence encoding the amino acids as set forth at positions 22-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that are at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth at positions 22-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that differ from the amino acid sequence as set forth at positions 22-253 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or, comprises a nucleotide sequence encoding one or more amino acid residues as set forth at positions 22-253 of SEQ ID NO: 2, including substitutions, deletions, and / or insertions.

[0112] Preferably, the humanized NKP46 gene comprises all or part of a nucleotide sequence encoding a signal peptide of a human NKP46 protein, further preferably comprises a nucleotide sequence encoding the amino acids as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that are at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that differ from the amino acid sequence as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2 in no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or, comprises a nucleotide sequence encoding one or more amino acid residues as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2, including substitutions, deletions, and / or insertions.

[0113] In a specific embodiment of the present invention, the humanized NKP46 gene comprises all or part of the nucleotide sequence encoding the extracellular region and / or signal peptide of human NKP46 protein, preferably comprising a nucleotide sequence encoding amino acids 2-253 or 1-253 of SEQ ID NO: 2.

[0114] In a specific embodiment of the present invention, the humanized NKP46 gene comprises a nucleotide sequence encoding the above-mentioned humanized NKP46 protein.

[0115] Preferably, the humanized NKP46 gene comprises all or part of exons 1 to 7 of the human NKP46 gene, further preferably comprises one, two or more exons from exons 1 to 7 of the human NKP46 gene, and further preferably comprises part of exon 1, all of exons 2 to 6 and part of exon 7 of the human NKP46 gene, wherein the part of exon 1 comprises at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 70 or 74 bp), preferably comprising at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, 5) amino acids of the signal peptide in exon 1, and the portion of exon 7 comprising a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380 or 384 bp), further preferably comprising SEQ ID NO:7; or, comprising a nucleotide sequence that is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence set forth in SEQ ID NO:7; or, comprising no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide difference from the nucleotide sequence set forth in SEQ ID NO:7; or, comprising a nucleotide sequence as set forth in the nucleotide sequence set forth in SEQ ID NO:7, including substitutions, deletions, and / or insertions of one or more nucleotides.

[0116] Preferably, the humanized NKP46 gene further comprises a portion of a non-human animal NKP46 gene, preferably comprises all or part of exon 1 and / or exon 7 of a non-human animal NKP46 gene.

[0117] Preferably, the humanized NKP46 gene comprises the nucleotide sequence shown in SEQ ID NO: 10 and / or SEQ ID NO: 11.

[0118] In a specific embodiment of the present invention, the mRNA transcribed from the humanized NKP46 gene comprises any one of the following groups:

[0119] (a) all or part of the nucleotide sequence shown in SEQ ID NO: 8;

[0120] (b) is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence of SEQ ID NO: 8;

[0121] (c) differs from the nucleotide sequence of SEQ ID NO: 8 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide; or

[0122] (d) A nucleotide sequence comprising a substitution, deletion and / or insertion of one or more nucleotides compared to the nucleotide sequence shown in SEQ ID NO: 8.

[0123] Preferably, the humanized NKP46 gene further comprises a specific inducer or repressor. Further preferably, the specific inducer or repressor can be a conventional inducing or repressing substance.

[0124] In a specific embodiment of the present invention, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0125] Preferably, the genome of the non-human animal comprises all or part of a nucleotide sequence encoding a human NKP46 protein, preferably comprises all or part of a nucleotide sequence encoding a signal peptide, an extracellular region, a cytoplasmic region and / or a transmembrane region of a human NKP46 protein, further preferably comprises all or part of a nucleotide sequence encoding an extracellular region and / or a signal peptide of a human NKP46 protein, and further preferably comprises a nucleotide sequence encoding the amino acids as shown in positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids having at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identity to the amino acid sequence as shown in positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids having at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% identity to the amino acid sequence as shown in positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; A nucleotide sequence that differs from the amino acid sequence as shown in positions 1-21, 2-21, 22-253 or 2-253 of SEQ ID NO: 2 in no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid sequence; or, a nucleotide sequence that encodes the same as that shown in positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2, including substitutions, deletions and / or insertions of one or more amino acid residues.

[0126] Preferably, the human or humanized NKP46 gene or the nucleotide sequence encoding the human or humanized NKP46 protein is operably linked to endogenous regulatory elements at the endogenous NKP46 locus in at least one chromosome.

[0127] Preferably, the expression of endogenous NKP46 protein in the non-human animal is reduced or absent.

[0128] Preferably, the non-human animal further comprises other gene modifications, and the other genes are selected from at least one of NKG2D, EGFR, HER2, B7H3, BCMA, FAP, CXCR4, CSF2, TNFR2, IL-2, IL-15, IL-15RA, IL-10, PD-1, PD-L1, TIGIT, CD16A, CD2 or CD38.

[0129] Preferably, the human or humanized NKP46 gene and / or other genes are homozygous or heterozygous for the endogenous modified locus.

[0130] Preferably, the non-human animal is constructed by introducing a nucleotide sequence comprising any one of the following into the NKP46 locus of a non-human animal:

[0131] A) a portion of the human NKP46 gene, preferably comprising all or part of exons 1 to 7 of the human NKP46 gene, more preferably comprising part of exon 1, all of exons 2 to 6, and part of exon 7 of the human NKP46 gene, wherein the portion of exon 1 comprises a nucleotide sequence of at least 20 bp, the portion of exon 7 comprises a nucleotide sequence of at least 10 bp, and even more preferably comprises the nucleotide sequence set forth in SEQ ID NO: 7; or, comprises a nucleotide sequence that is at least 80% identical to the nucleotide sequence set forth in SEQ ID NO: 7; or,

[0132] B) all or part of a nucleotide sequence encoding a human NKP46 protein, preferably comprising all or part of a nucleotide sequence encoding the extracellular region and / or signal peptide of a human NKP46 protein, further preferably comprising a nucleotide sequence encoding at least 100 consecutive amino acids of the extracellular region of a human NKP46 protein and / or a nucleotide sequence of at least 10 consecutive amino acids of a signal peptide, more preferably comprising a nucleotide sequence encoding the amino acids as set forth in positions 1-21, 2-21, 22-253, 1-253, or 2-253 of SEQ ID NO: 2; or, comprising a nucleotide sequence encoding the amino acids as set forth in positions 1-21, 2-21, 22-253, 1-253, or 2-253 of SEQ ID NO: 2 that is at least 60% identical to a nucleotide sequence encoding the amino acids as set forth in positions 1-21, 2-21, 22-253, 1-253, or 2-253 of SEQ ID NO: 2.

[0133] Preferably, the humanized NKP46 gene further includes a specific inducer or repressor. Further preferably, the specific inducer or repressor can be a conventional substance that can be induced or repressed.

[0134] In a specific embodiment of the present invention, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0135] Preferably, the non-human animal can be selected from any non-human animal that can be gene-edited to produce humanized genes, such as rodents, pigs, rabbits, monkeys, etc.

[0136] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0137] Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferably, the immunodeficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit, or an immunodeficient monkey. Even more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Most preferably, the immunodeficient mouse is a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - (NRG) mice, Rag 2 - / - -IL2rg - / - (RG) mice, NOD / SCID mice, or nude mice.

[0138] The third aspect of the present invention provides a targeting vector, wherein the targeting vector comprises a donor nucleotide sequence.

[0139] Preferably, the donor nucleotide sequence comprises any one of the following groups:

[0140] A) a portion of the human NKP46 gene, preferably comprising all or part of exons 1 to 7 of the human NKP46 gene, more preferably comprising one, two or more exons from exons 1 to 7 of the human NKP46 gene, and even more preferably comprising part of exon 1, all of exons 2 to 6 and part of exon 7 of the human NKP46 gene, wherein the portion of exon 1 comprises at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 71, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 770, 780 0 or 74 bp), preferably comprising at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, 5) amino acids of the signal peptide in exon 1, and the portion of exon 7 comprising a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380 or 384 bp), further preferably comprising SEQ : The nucleotide sequence of SEQ ID NO:7; or, comprising at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity to the nucleotide sequence of SEQ ID NO:7; or, comprising no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide difference from the nucleotide sequence of SEQ ID NO:7; or, comprising a nucleotide sequence having a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence of SEQ ID NO:7;

[0141] B) all or part of the nucleotide sequence encoding human NKP46 protein, preferably comprising all or part of the nucleotide sequence encoding the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of human NKP46 protein, further preferably comprising all or part of the nucleotide sequence encoding the extracellular region and / or signal peptide of human NKP46 protein, more preferably comprising a nucleotide sequence encoding at least 100 consecutive amino acids of the extracellular region of human NKP46 protein and / or a nucleotide sequence of at least 10 consecutive amino acids of the signal peptide, further preferably comprising a nucleotide sequence encoding amino acids shown at positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; or, comprising a nucleotide sequence encoding the amino acids shown at positions 1-21, 2-21, 22-253, 1-253 or 2-253 of SEQ ID NO: 2; a nucleotide sequence that is at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, 1-253, or 2-253; or a nucleotide sequence that encodes an amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, 1-253, or 2-253 that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or a nucleotide sequence that encodes an amino acid sequence as set forth in SEQ ID NO:2 at positions 1-21, 2-21, 22-253, 1-253, or 2-253, comprising a substitution, deletion, and / or insertion of one or more amino acid residues;

[0142] C) a nucleotide sequence encoding a human or humanized NKP46 protein; or

[0143] D) Nucleotide sequence of human or humanized NKP46 gene.

[0144] Preferably, the targeting vector comprises the nucleotide sequence shown in SEQ ID NO: 10 and / or SEQ ID NO: 11.

[0145] Preferably, the targeting vector further comprises a 5' arm (5' homology arm) and / or a 3' arm (3' homology arm).

[0146] The 5' arm is a DNA fragment homologous to the 5' end of the switch region to be altered, and is selected from a 100-10,000 nucleotide sequence of genomic DNA of a non-human animal NKP46 gene. Preferably, the 5' arm is at least 90% homologous to NCBI accession number NC_000073.7; further preferably, the 5' arm is 90% homologous to SEQ ID NO: 3 or 5, or comprises the nucleotide sequence set forth in SEQ ID NO: 3 or 5.

[0147] The 3' arm is a DNA fragment homologous to the 3' end of the switch region to be altered, and is selected from genomic DNA of the NKP46 gene of a non-human animal and has a length of 100-10,000 nucleotides. Preferably, the 3' arm is at least 90% homologous to NCBI accession number NC_000073.7; further preferably, the 3' arm is 90% homologous to SEQ ID NO: 4 or 6, or comprises the nucleotide sequence set forth in SEQ ID NO: 4 or 6.

[0148] Preferably, the switch region to be altered of the targeting vector is located on the non-human animal NKP46 gene locus, and further preferably, is located on exons 1 to 7 of the non-human animal NKP46 gene.

[0149] Preferably, the targeting vector further comprises a marker gene. Further preferably, the marker gene is a gene encoding a negative selection marker. Even more preferably, the gene encoding the negative selection marker is a gene encoding the diphtheria toxin A subunit (DTA).

[0150] In a specific embodiment of the present invention, the targeting vector further comprises a resistance gene for positive clone screening. Further preferably, the resistance gene for positive clone screening is a neomycin phosphotransferase coding sequence Neo.

[0151] In a specific embodiment of the present invention, the targeting vector further comprises a specific recombination system. Further preferably, the specific recombination system is an Frt recombination site (a conventional LoxP recombination system may also be selected). The specific recombination system comprises two Frt recombination sites, one of which is connected to each side of the resistance gene.

[0152] Preferably, the non-human animal can be selected from any non-human animal that can be gene-edited to produce humanized genes, such as rodents, pigs, rabbits, monkeys, etc.

[0153] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0154] Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferably, the immunodeficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit, or an immunodeficient monkey. Even more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Most preferably, the immunodeficient mouse is a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg- / - (NRG) mice, Rag 2 - / - -IL2rg - / - (RG) mice, NOD / SCID mice, or nude mice.

[0155] In a fourth aspect, the present invention provides an sgRNA, wherein the sgRNA targets the NKP46 gene of a non-human animal, and the target site is located on exons 1 to 7 of the NKP46 gene.

[0156] Preferably, the target site of the sgRNA is located on the exon 1 and / or exon 7 sequence of the NKP46 gene.

[0157] In a specific embodiment of the present invention, the target sequence of the sgRNA on the NKP46 gene is shown in SEQ ID NO: 14 and / or 15.

[0158] In a fifth aspect, the present invention provides a DNA molecule encoding the above-mentioned sgRNA.

[0159] Preferably, the double-stranded DNA molecule is the upstream and downstream sequences of the sgRNA, or the forward oligonucleotide sequence or reverse oligonucleotide sequence after adding the restriction enzyme cleavage site.

[0160] In a specific embodiment of the present invention, the double-stranded DNA molecules of the sgRNA are shown as SEQ ID NOs: 16 and 18, or SEQ ID NOs: 17 and 19, or SEQ ID NOs: 20 and 22, or SEQ ID NOs: 21 and 23.

[0161] In a sixth aspect, the present invention provides a vector comprising the above-mentioned sgRNA.

[0162] In a seventh aspect, the present invention provides a cell comprising the above-mentioned targeting vector, sgRNA, the above-mentioned DNA molecule encoding sgRNA, and a vector comprising sgRNA.

[0163] In an eighth aspect, the present invention provides a use of the aforementioned targeting vector, sgRNA, DNA molecule encoding sgRNA, vector, or cell in NKP46 gene editing. Preferably, the use includes, but is not limited to, knockout, insertion, or replacement.

[0164] In a ninth aspect, the present invention provides a humanized NKP46 protein, wherein the humanized NKP46 protein comprises all or part of a human NKP46 protein.

[0165] Preferably, the humanized NKP46 protein comprises all or part of the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of the human NKP46 protein.

[0166] Preferably, the humanized NKP46 protein comprises all or part of the extracellular region of the human NKP46 protein, further preferably comprises at least 100 to at least 237 (e.g., 100, 150, 200, 210, 220, 230, 232, 233, 234, 235, 236, 237) consecutive amino acid sequences of the extracellular region of the human NKP46 protein, and further preferably comprises the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2; The amino acid sequence shown at positions 22-253 of NO:2 differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or, comprises an amino acid sequence shown at positions 22-253 of SEQ ID NO:2, including substitution, deletion and / or insertion of one or more amino acid residues.

[0167] Preferably, the humanized NKP46 protein comprises all or part of the signal peptide of the human NKP46 protein, further preferably comprises at least 10 (e.g., 10, 15, 16, 17, 18, 19, 20, 21) consecutive amino acid sequences of the signal peptide of the human NKP46 protein, and further preferably comprises the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid difference from the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid difference from the amino acid sequence as shown in positions 1-21 or 2-21 of SEQ ID NO: 2; NO: 2 The amino acid sequence shown in positions 1-21 or 2-21, including substitution, deletion and / or insertion of one or more amino acid residues.

[0168] In one embodiment of the present invention, the humanized NKP46 protein comprises all or part of the extracellular region and / or signal peptide of the human NKP46 protein. The amino acid sequence of the humanized NKP46 protein comprises any one of the following groups:

[0169] A) all or part of the amino acid sequence set forth in positions 2-253 or 1-253 of SEQ ID NO: 2;

[0170] B) at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in positions 2-253 or 1-253 of SEQ ID NO: 2;

[0171] C) differs from the amino acid sequence as set forth in positions 2-253 or 1-253 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0172] D) an amino acid sequence comprising substitutions, deletions and / or insertions of one or more amino acid residues as shown in positions 2-253 or 1-253 of SEQ ID NO: 2.

[0173] Preferably, the humanized NKP46 protein further comprises a portion of a non-human NKP46 protein, preferably a cytoplasmic region and / or a transmembrane region of a non-human NKP46 protein, and further preferably comprises a partial amino acid sequence of an extracellular region and / or a signal peptide of a non-human NKP46 protein. In a specific embodiment of the present invention, the humanized NKP46 protein comprises all or part of the amino acids set forth at positions 1 and / or 254-325 of SEQ ID NO: 1, or comprises at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity to the amino acid sequence set forth at positions 1 and / or 254-325 of SEQ ID NO: 1.

[0174] In a specific embodiment of the present invention, the humanized NKP46 protein comprises a human NKP46 protein signal peptide, a non-human animal NKP46 transmembrane region, a non-human animal NKP46 cytoplasmic region and a human NKP46 extracellular region, and preferably further comprises a portion of the non-human animal NKP46 extracellular region and / or signal peptide.

[0175] Preferably, the humanized NKP46 protein comprises the amino acid sequence encoded in whole or in part by the human NKP46 gene, more preferably comprises the amino acid sequence encoded in whole or in part by exons 1 to 7 of the human NKP46 gene, further preferably comprises the amino acid sequence encoded in one, two or more than three exons of exons 1 to 7 of the human NKP46 gene, and even more preferably comprises the amino acid sequence encoded in part by exon 1, all by exons 2 to 6, and part by exon 7 of the human NKP46 gene. The portion of exon 1 comprises a nucleotide sequence of at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 70, or 74 bp), preferably comprises at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, or 5) amino acids of the signal peptide in exon 1. The portion of exon 7 comprises a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380, or 384 bp).

[0176] In a specific embodiment of the present invention, the humanized NKP46 protein comprises the amino acid sequence encoded by SEQ ID NO: 7; or, comprises an amino acid sequence encoded by nucleotides that are at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence of SEQ ID NO: 7; or, comprises an amino acid sequence encoded by a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 7 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotides; or, comprises an amino acid sequence encoded by a nucleotide sequence having a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence of SEQ ID NO: 7.

[0177] Preferably, the humanized NKP46 protein comprises an amino acid sequence encoded by a non-human animal NKP46 gene, and further preferably comprises an amino acid sequence encoded in whole or in part by exon 1 and / or exon 7 of a non-human animal.

[0178] In a specific embodiment of the present invention, the amino acid sequence of the humanized NKP46 protein comprises any one of the following groups:

[0179] (A) all or part of the amino acid sequence shown in SEQ ID NO: 9;

[0180] (B) is at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence of SEQ ID NO: 9;

[0181] (C) differs from the amino acid sequence of SEQ ID NO: 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0182] (D) An amino acid sequence as shown in SEQ ID NO: 9, comprising a substitution, deletion and / or insertion of one or more amino acid residues.

[0183] Preferably, the non-human animal can be selected from any non-human animal that can be gene-edited to produce humanized genes, such as rodents, pigs, rabbits, monkeys, etc.

[0184] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0185] Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferably, the immunodeficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit, or an immunodeficient monkey. Even more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Most preferably, the immunodeficient mouse is a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - (NRG) mice, Rag 2 - / - -IL2rg - / - (RG) mice, NOD / SCID mice, or nude mice.

[0186] The tenth aspect of the present invention provides a nucleic acid encoding the above-mentioned humanized NKP46 protein.

[0187] In an eleventh aspect, the present invention provides a humanized NKP46 gene, wherein the humanized NKP46 gene comprises a portion of a human NKP46 gene.

[0188] Preferably, the humanized NKP46 gene comprises all or part of the nucleotide sequence encoding the human NKP46 protein, preferably comprises all or part of the nucleotide sequence encoding the signal peptide, extracellular region, cytoplasmic region and / or transmembrane region of the human NKP46 protein.

[0189] Preferably, the humanized NKP46 gene comprises all or part of a nucleotide sequence encoding the extracellular region of the human NKP46 protein, further preferably comprises a nucleotide sequence encoding the amino acids as set forth at positions 22-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that are at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth at positions 22-253 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that differ from the amino acid sequence as set forth at positions 22-253 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or, comprises a nucleotide sequence encoding one or more amino acid residues as set forth at positions 22-253 of SEQ ID NO: 2, including substitutions, deletions, and / or insertions.

[0190] Preferably, the humanized NKP46 gene comprises all or part of a nucleotide sequence encoding a signal peptide of a human NKP46 protein, further preferably comprises a nucleotide sequence encoding the amino acids as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that are at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the amino acid sequence as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding amino acids that differ from the amino acid sequence as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2 in no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid residue; or, comprises a nucleotide sequence encoding one or more amino acid residues as set forth in positions 1-21 or 2-21 of SEQ ID NO: 2, including substitutions, deletions, and / or insertions.

[0191] In a specific embodiment of the present invention, the humanized NKP46 gene comprises all or part of the nucleotide sequence encoding the extracellular region and / or signal peptide of human NKP46 protein, preferably comprising a nucleotide sequence encoding amino acids 2-253 or 1-253 of SEQ ID NO: 2.

[0192] In a specific embodiment of the present invention, the humanized NKP46 gene comprises a nucleotide sequence encoding the above-mentioned humanized NKP46 protein.

[0193] Preferably, the humanized NKP46 gene comprises all or part of exons 1 to 7 of the human NKP46 gene, further preferably comprises one, two or more exons from exons 1 to 7 of the human NKP46 gene, and further preferably comprises part of exon 1, all of exons 2 to 6 and part of exon 7 of the human NKP46 gene, wherein the part of exon 1 comprises at least 20 to at least 74 bp (e.g., 20, 30, 31, 40, 50, 60, 70 or 74 bp), preferably comprising at least the nucleotide sequence encoding the N-terminal 1-5 (e.g., 1, 2, 3, 4, 5) amino acids of the signal peptide in exon 1, and the portion of exon 7 comprising a nucleotide sequence of at least 10 to at least 384 bp (e.g., 10, 20, 26, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 360, 370, 380 or 384 bp), further preferably comprising SEQ ID NO:7; or, comprising a nucleotide sequence that is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence set forth in SEQ ID NO:7; or, comprising no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide difference from the nucleotide sequence set forth in SEQ ID NO:7; or, comprising a nucleotide sequence as set forth in the nucleotide sequence set forth in SEQ ID NO:7, including substitutions, deletions, and / or insertions of one or more nucleotides.

[0194] Preferably, the humanized NKP46 gene further comprises a portion of a non-human animal NKP46 gene, preferably comprises all or part of exon 1 and / or exon 7 of a non-human animal NKP46 gene.

[0195] Preferably, the humanized NKP46 gene comprises the nucleotide sequence shown in SEQ ID NO: 10 and / or SEQ ID NO: 11.

[0196] In a specific embodiment of the present invention, the mRNA transcribed from the humanized NKP46 gene comprises any one of the following groups:

[0197] (a) all or part of the nucleotide sequence shown in SEQ ID NO: 8;

[0198] (b) is at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identical to the nucleotide sequence of SEQ ID NO: 8;

[0199] (c) differs from the nucleotide sequence of SEQ ID NO: 8 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide; or

[0200] (d) A nucleotide sequence comprising a substitution, deletion and / or insertion of one or more nucleotides compared to the nucleotide sequence shown in SEQ ID NO: 8.

[0201] Preferably, the humanized NKP46 gene further comprises a specific inducer or repressor. Further preferably, the specific inducer or repressor can be a conventional inducing or repressing substance.

[0202] In a specific embodiment of the present invention, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0203] Preferably, the non-human animal can be selected from any non-human animal that can be gene-edited to produce humanized genes, such as rodents, pigs, rabbits, monkeys, etc.

[0204] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0205] Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferably, the immunodeficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit, or an immunodeficient monkey. Even more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Most preferably, the immunodeficient mouse is a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - (NRG) mice, Rag 2 - / - -IL2rg - / - (RG) mice, NOD / SCID mice, or nude mice.

[0206] The twelfth aspect of the present invention provides a cell with humanized NKP46 gene, wherein the cell expresses the humanized NKP46 protein, or the genome of the cell contains a portion of the human NKP46 gene.

[0207] Preferably, the genome of the cell comprises all or part of exons 1 to 7 of the human NKP46 gene, and further preferably comprises the above-mentioned humanized NKP46 gene.

[0208] Preferably, the cells further comprise other gene modifications, and the other genes are selected from at least one of NKG2D, EGFR, HER2, B7H3, BCMA, FAP, CXCR4, CSF2, TNFR2, IL-2, IL-15, IL-15RA, IL-10, PD-1, PD-L1, TIGIT, CD16A, CD2 or CD38.

[0209] In a thirteenth aspect, the present invention provides a cell lacking the NKP46 gene, wherein the cell lacks all or part of the NKP46 gene. Preferably, the cell lacks all or part of exons 1 to 7 of the NKP46 gene. Preferably, the cell lacks all or part of the nucleotide sequence encoding the extracellular region and / or signal peptide of the NKP46 gene.

[0210] A fourteenth aspect of the present invention provides a non-human animal with a NKP46 gene deletion, wherein the expression of endogenous NKP46 protein in the non-human animal is reduced or deleted.

[0211] Preferably, the genome of the non-human animal is completely or partially deleted from the NKP46 gene. More preferably, all or part of exons 1 to 7 of the NKP46 gene are deleted. Even more preferably, all or part of the nucleotide sequence encoding the extracellular region and / or signal peptide of the NKP46 gene is deleted.

[0212] In a fifteenth aspect, the present invention provides a method for constructing the above-mentioned NKP46 gene-deficient cells or non-human animals, wherein the construction method comprises using the above-mentioned targeting vector and / or sgRNA for construction.

[0213] A sixteenth aspect of the present invention provides a method for constructing a multi-gene modified non-human animal, comprising:

[0214] 1) Providing the above-mentioned non-human animal or the non-human animal obtained by the above-mentioned construction method;

[0215] II) mating the non-human animal provided in step I) with other genetically modified non-human animals, fertilizing them in vitro, or directly performing gene editing, and screening to obtain multi-gene modified non-human animals.

[0216] Preferably, the other genetically modified non-human animals include non-human animals modified with genes NKG2D, EGFR, HER2, B7H3, BCMA, FAP, CXCR4, CSF2, TNFR2, IL-2, IL-15, IL-15RA, IL-10, PD-1, PD-L1, TIGIT, CD16A, CD2 or CD38.

[0217] Preferably, the multi-gene modified non-human animal is a two-gene humanized non-human animal, a three-gene humanized non-human animal, a four-gene humanized non-human animal, a five-gene humanized non-human animal, a six-gene humanized non-human animal, a seven-gene humanized non-human animal, an eight-gene humanized non-human animal or a nine-gene humanized non-human animal.

[0218] Preferably, each of the multiple modified genes in the genome of the multi-gene modified non-human animal can be homozygous or heterozygous.

[0219] The seventeenth aspect of the present invention provides a non-human animal or a multi-gene modified non-human animal or its offspring obtained by the above-mentioned construction method.

[0220] In an eighteenth aspect, the present invention provides an animal model, wherein the animal model is derived from the non-human animal described above, or a non-human animal obtained by the above-mentioned construction method. Preferably, the animal model is a tumor-bearing or inflammation animal model.

[0221] A nineteenth aspect of the present invention provides a method for constructing an animal model, wherein the method is performed using the aforementioned non-human animal or a non-human animal obtained by the aforementioned method. Preferably, the animal model is a tumor-bearing or inflammatory animal model, and further preferably, the method further comprises the step of implanting tumor cells.

[0222] The twentieth aspect of the present invention provides a use of the above-mentioned non-human animal, the non-human animal obtained by the above-mentioned construction method, or its offspring in preparing an animal model.

[0223] In the twenty-first aspect of the present invention, a cell, tissue or organ is provided, wherein the cell, tissue or organ expresses the above-mentioned humanized NKP46 protein, or the genome of the cell, tissue or organ contains the above-mentioned humanized NKP46 gene, or the cell, tissue or organ is derived from the above-mentioned non-human animal, or from the non-human animal obtained by the above-mentioned construction method, or from the above-mentioned animal model.

[0224] In the twenty-second aspect of the present invention, a tumor tissue is provided, wherein the tumor tissue expresses the above-mentioned humanized NKP46 protein, or the genome of the tumor tissue contains the above-mentioned humanized NKP46 gene, or the tumor tissue is derived from the above-mentioned non-human animal, or from the non-human animal obtained by the above-mentioned construction method, or from the above-mentioned animal model.

[0225] The twenty-third aspect of the present invention provides a genome of a non-human animal with humanized NKP46 gene.

[0226] Preferably, the genome comprises all or part of a human or humanized NKP46 gene, and / or comprises all or part of a nucleotide sequence encoding a human or humanized NKP46 protein.

[0227] Preferably, the humanized NKP46 gene is the above-mentioned humanized NKP46 gene.

[0228] Preferably, the humanized NKP46 protein is the above-mentioned humanized NKP46 protein.

[0229] Preferably, the genome comprises a genomic fragment of a human NKP46 gene (preferably encoding all or part of the sequence of the extracellular region and / or signal peptide of human NKP46) at the endogenous NKP46 locus of a non-human animal, and / or a genomic fragment of a non-human animal NKP46 gene is introduced into the genomic fragment of a non-human animal NKP46 gene to form a modified NKP46 gene.

[0230] Preferably, the genome comprises a genomic fragment of a non-human animal NKP46 gene introduced into the non-human animal endogenous NKP46 locus using a humanized NKP46 gene to form a modified NKP46 gene.

[0231] The modified NKP46 gene encodes a humanized NKP46 protein.

[0232] Preferably, the introduction is insertion or replacement.

[0233] Preferably, the introduction of the non-human animal NKP46 locus is to replace the corresponding region of the non-human animal. Further preferably, all or part of exons 1 to 7 of the non-human animal NKP46 gene are replaced. More preferably, part of exon 1, all of exons 2 to 6 and part of exon 7 of the non-human animal NKP46 gene are replaced.

[0234] Preferably, the expression of the modified NKP46 gene is controlled by endogenous regulatory elements of the non-human animal.

[0235] Preferably, the non-human animal can be selected from any non-human animal that can be gene-edited to produce humanized genes, such as rodents, zebrafish, pigs, chickens, rabbits, monkeys, etc.

[0236] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0237] The twenty-fourth aspect of the present invention provides cells, tissues or organs comprising the genome of the non-human animal with humanized NKP46 gene.

[0238] Preferably, any of the above cells, tissues or organs or tumor tissues after tumor-bearing includes cells, tissues or organs or tumor tissues after tumor-bearing that can develop into animal individuals or cannot develop into animal individuals.

[0239] In a twenty-fifth aspect, the present invention provides a use of the humanized NKP46 protein, the humanized NKP46 gene, the non-human animal, the cell, the animal model, the tumor tissue, the cell, tissue or organ, or the non-human animal obtained by the construction method, the use comprising:

[0240] A) application in the development of products related to NKP46-associated immune processes in human cells; the products are preferably antibodies;

[0241] B) Application as a model system for NKP46-related research in pharmacology, immunology, microbiology and medicine;

[0242] C) applications involving the production and use of animal experimental disease models for the study of NKP46-related etiology and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies;

[0243] D) screening, validating, evaluating or studying the function of NKP46 pathway; preferably the signaling mechanism of human NKP46 pathway; or,

[0244] E) Application in screening and evaluating human drugs and drug efficacy research. The drugs are preferably antibodies and immune-related drugs.

[0245] Preferably, the application includes a method for treating and / or diagnosing a disease, or a method for diagnosing and treating a non-disease.

[0246] In the twenty-sixth aspect of the present invention, a method for screening human NKP46-specific regulators is provided, the screening method comprising applying a regulator to an individual implanted with tumor cells and detecting tumor inhibitory activity; wherein the individual is selected from the above-mentioned non-human animals, the non-human animals obtained by the above-mentioned construction method, the above-mentioned non-human animals or their offspring, or the above-mentioned animal models.

[0247] Preferably, the regulator is selected from CAR-T and a drug. Further preferably, the drug is an antibody.

[0248] Preferably, the regulator is a monoclonal antibody or a bispecific antibody or a combination of two or more drugs.

[0249] Preferably, said detecting comprises measuring the size and / or proliferation rate of tumor cells.

[0250] Preferably, the detection method includes vernier caliper measurement, flow cytometry and / or in vivo animal imaging detection.

[0251] Preferably, the testing comprises assessing an individual's body weight, fat mass, activated pathways, neuroprotective activity, or metabolic changes, including changes in food consumption or water consumption.

[0252] Preferably, the tumor cells are derived from humans or non-human animals.

[0253] Preferably, the method for screening human NKP46-specific regulators includes therapeutic and non-therapeutic methods.

[0254] In one embodiment, the method is used to screen or evaluate drugs, detect and compare the efficacy of candidate drugs to determine which candidate drugs can be used as drugs and which cannot be used as drugs, or to compare the sensitivity of different drugs to the efficacy, that is, the therapeutic effect is not inevitable, but only a possibility.

[0255] The twenty-seventh aspect of the present invention provides an evaluation method for an intervention regimen, which comprises implanting tumor cells into an individual, applying the intervention regimen to the individual implanted with tumor cells, and detecting and evaluating the tumor inhibition effect on the individual after application of the intervention regimen; wherein the individual is selected from the above-mentioned non-human animals, the non-human animals obtained by the above-mentioned construction method, the above-mentioned non-human animals or their offspring, or the above-mentioned animal models.

[0256] Preferably, the intervention regimen is selected from CAR-T and drug therapy. Further preferably, the drug is an antigen binding protein. The antibody binding protein is an antibody.

[0257] Preferably, the tumor cells are derived from humans or non-human animals.

[0258] Preferably, the evaluation method of the intervention program includes treatment and non-treatment methods.

[0259] In a specific embodiment, the evaluation method detects and evaluates the effect of the intervention program to determine whether the intervention program has a therapeutic effect, that is, the therapeutic effect is not inevitable, but only a possibility.

[0260] The twenty-eighth aspect of the present invention provides a use of the above-mentioned non-human animal, the non-human animal obtained by the above-mentioned construction method, the above-mentioned non-human animal or its offspring, or the above-mentioned tumor-bearing or inflammation model in preparing a human NKP46-specific regulator.

[0261] The twenty-ninth aspect of the present invention provides a use of the non-human animal derived from the above-mentioned non-human animal, the non-human animal obtained by the above-mentioned construction method, the above-mentioned non-human animal or its offspring, and the above-mentioned animal model in the preparation of drugs for treating tumors, inflammation or immune-related diseases.

[0262] The "immune-related diseases" mentioned in the present invention include but are not limited to allergies, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain or neurological disorders, etc.

[0263] The "tumor" described in the present invention includes but is not limited to lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, brain glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. Wherein, described leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia and chronic myeloid leukemia; described lymphoma is selected from Hodgkin lymphoma and non-Hodgkin lymphoma, including B cell lymphoma, diffuse large B cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B cell lymphoma, T cell lymphoma and Waldenstrom macroglobulinemia; described sarcoma is selected from osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma and chondrosarcoma. In a specific embodiment of the present invention, described tumor is non-small cell lung cancer, metastatic colorectal cancer, cervical cancer, ovarian cancer, nasopharyngeal carcinoma, gastric cancer, brain glioma.

[0264] The term "inflammation" as used herein includes both acute and chronic inflammation. Specifically, it includes, but is not limited to, degenerative inflammation, exudative inflammation (serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, and catarrhal inflammation), proliferative inflammation, and specific inflammation (tuberculosis, syphilis, leprosy, lymphogranuloma, etc.).

[0265] The "cells" described in the present invention can be fertilized egg cells or other somatic cells, such as NK cells or tumor cells, etc. Therefore, depending on the source of the cells, some of the cells described in this application can develop into animal individuals, while some cannot.

[0266] The "tissues" or "organs" described in the present invention cannot develop into individuals.

[0267] The "NKP46 protein" described in the present invention, such as "human NKP46 protein", "non-human animal NKP46 protein" or "humanized NKP46 protein", all contain a signal peptide, an extracellular region, an intracellular region and / or a transmembrane region.

[0268] The “all or part” mentioned in the present invention, “all” refers to the whole, and “part” refers to a part of the whole, or an individual that makes up the whole.

[0269] The "humanized NKP46 protein" of the present invention comprises a portion derived from a human NKP46 protein. The "humanized NKP46 protein" comprises a continuous or intermittent 5-304 amino acid sequence identical to the amino acid sequence of the human NKP46 protein, preferably a continuous or intermittent 10-253 or 10-252 amino acid sequence, more preferably a continuous 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 252, 253, 260, 270, 280, 290, 300 or 304 amino acid sequence identical to the amino acid sequence of the human NKP46 protein.

[0270] The "humanized NKP46 gene" of the present invention comprises a portion derived from a human NKP46 gene. The "humanized NKP46 gene" comprises a continuous or intermittent 20 bp to 32149 bp nucleotide sequence that is consistent with the nucleotide sequence of the human NKP46 gene, preferably a continuous or intermittent 20-6525 bp, 20-756 bp, specifically 20, 50, 100, 200, 300, 400, 500, 600, 700, 750, 756, 800, 900, 1000, 1100, 1200, The nucleotide sequences of 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, 4000, 4500, 5000, 5500, 6000, 6500, 6525, 7000, 7500, 8000, 8500, 9000, 9500, 10000, 20000, and 30000 bp are consistent with the nucleotide sequence of human NKP46 gene.

[0271] The "exons xx to xxx" or "all of exons xx to xxx" mentioned in the present invention include the nucleotide sequences of exons and introns therebetween. For example, the "exons 1 to 7" mentioned herein include the entire nucleotide sequences of exon 1, introns 1-2, exon 2, introns 2-3, exon 3, introns 3-4, exon 4, introns 4-5, exon 5, introns 5-6, exon 6, introns 6-7, and exon 7.

[0272] The "intron x-xx" of the present invention refers to the intron between exon x and exon xx. For example, "intron 2-3" refers to the intron between exon 2 and exon 3.

[0273] As used herein, a "locus" broadly refers to the location of a gene on a chromosome, and more narrowly refers to a DNA segment within a gene, which can be either a gene or a portion of a gene. For example, the "NKP46 locus" refers to any DNA segment within exons 1 to 7 of the NKP46 gene.

[0274] The "nucleotide sequence" of the present invention includes natural or modified ribonucleotide sequences and deoxyribonucleotide sequences, preferably DNA, cDNA, pre-mRNA, mRNA, rRNA, hnRNA, miRNAs, scRNA, snRNA, siRNA, sgRNA, and tRNA.

[0275] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-associated signs, symptoms, conditions, or disorders.

[0276] The term "and / or" as used herein includes all combinations of the items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A," "A and B," and "B." For another example, "A, B, and / or C" includes "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."

[0277] The terms “comprising” or “including” described in the present invention are open-ended. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described in the present invention. In addition, it is clear to those skilled in the art that the methionine encoded by the start codon at the N-terminus of the polypeptide may be retained in certain practical situations (for example, when expressed in a specific expression system), but it does not substantially affect the function of the polypeptide. Therefore, when describing a specific polypeptide amino acid sequence in the specification and claims of this application, although it may not contain a methionine encoded by a start codon at the N-terminus, a sequence containing the methionine is also covered, and accordingly, its encoding nucleotide sequence may also contain a start codon; and vice versa.

[0278] The "homology" mentioned in the present invention means that in terms of using amino acid sequences or nucleotide sequences, those skilled in the art can adjust the sequences according to actual work needs, while ensuring that the structures or functions are similar to those of known sequences, so that the sequences used have (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36% compared with the sequences obtained in the prior art. , 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% identity.

[0279] One skilled in the art is able to identify and compare sequence elements or degrees of identity to distinguish between additional mouse and human sequences.

[0280] In one aspect, the non-human animal is a mammal. In one aspect, the non-human animal is a small mammal, such as the family Jerboas. In one embodiment, the genetically humanized non-human animal is a rodent. In one embodiment, the rodent is selected from mice, rats, and hamsters. In one embodiment, the rodent is selected from the family Muridae. In one embodiment, the genetically modified animal is from a family selected from the family Cricetidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muroidea (true mice and rats, gerbils, spiny mice, crested rats), Malmyridae (climbing mice, rock mice, tailed rats, Madagascar rats, and mice), Spiny Dormouse (e.g., spiny dormouse), and Muridae (e.g., mole rats, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from true mice or rats (Muroidea), gerbils, spiny mice, and crested rats. In one embodiment, the genetically modified mouse is from a member of the family Muridae. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from the group consisting of a mouse and a rat. In one embodiment, the non-human animal is a mouse.

[0281] In a specific embodiment, the non-human animal is a rodent selected from the group consisting of BALB / c, A, A / He, A / J, A / WySN, AKR, AKR / A, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr and C57BL / Ola, C57BL, C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, CBA / H strains.

[0282] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are explained in detail in the following literature. For example: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (DNGlovered., 1985); Oligonucleotide Synthesis (MJGaited., 1984); Mullisetal. US Pat. No. 4, 683, 195; Nucleic Acid Hybridization (BDHames&S.J.Higginseds.1984); Transcription And Translation (BDHames&S.J.Higginseds.1984); Culture Of Animal Cells (RIFreshney, AlanR.Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B.Perbal, A Practical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J.Abelsonand M.Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols.154and 155 (Wuetal.eds.) and Vol.185, "Gene Expression Technology" (D.Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (JHMiller and M.P. Caloseds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods InCell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes V (DMWeir and CCBlackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). .

[0283] The above merely summarizes some aspects of the present invention and is not and should not be considered to limit the present invention in any aspect.

[0284] All patents and publications mentioned in this specification are incorporated herein by reference as a whole. Those skilled in the art will recognize that certain changes can be made to the present invention without departing from the concept or scope of the present invention.

[0285] The following examples further illustrate the present invention and are not to be construed as limiting the scope of the invention or the specific methods described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0286] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, in which:

[0287] Figure 1 : Schematic comparison of the mouse NKP46 gene and the human NKP46 locus (not to scale);

[0288] Figure 2 : Schematic diagram of the humanized transformation of the mouse NKP46 gene (not to scale);

[0289] Figure 3 : Schematic diagram of NKP46 gene targeting strategy and targeting vector design (not to scale);

[0290] Figure 4 : Schematic diagram of the FRT recombination process of NKP46 gene humanized mice (not to scale);

[0291] Figure 5 : Schematic diagram of NKP46 gene targeting strategy and targeting vector design (not to scale);

[0292] Figure 6 : PCR identification results of the tail of F1 generation of humanized mice expressing NKP46 gene, where WT is the wild-type control, H2O is the water control, and M is the marker;

[0293] Figure 7: Schematic diagram of Southern Blot detection results, where WT is the wild-type control;

[0294] Figure 8 : Flow cytometry results of leukocyte subsets (A) and T cell subsets in the spleen (B), where + / + represents wild-type C57BL / 6 mice, and H / H represents NKP46 gene humanized homozygous mice;

[0295] Figure 9 : Flow cytometry results of the proportions of leukocyte subsets (A) and T cell subsets in the blood (B), where + / + represents wild-type C57BL / 6 mice, and H / H represents NKP46 gene humanized homozygous mice;

[0296] Figure 10 : Flow cytometry results of leukocyte subsets (A) and T cell subsets in lymph nodes (B), where + / + represents wild-type C57BL / 6 mice, and H / H represents NKP46 gene humanized homozygous mice;

[0297] Figure 11 : Schematic diagram of the weight of mice after anti-tumor efficacy testing after MC38 mouse colon cancer cells were implanted into humanized NKP46 mice;

[0298] Figure 12 : Schematic diagram of the tumor volume results after the anti-tumor efficacy test of mouse colon cancer cell MC38 implanted into humanized NKP46 mice;

[0299] Figure 13 : Schematic diagram of the weight changes of mice after the anti-tumor efficacy test was conducted after mouse colon cancer cells MC38 were implanted into humanized NKP46 mice. DETAILED DESCRIPTION

[0300] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0301] In each of the following examples, equipment and materials were obtained from the following companies:

[0302] C57BL / 6 mice were purchased from the National Rodent Laboratory Animal Center of the China Food and Drug Administration;

[0303] BALB / c mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.;

[0304] BspHI, StuI, BbsI, EcoRI, and BamHI enzymes were purchased from NEB with catalog numbers: R0517S, R0187S, R0539L, R0101M, and R0136M, respectively;

[0305] Brilliant Violet 510 TM Anti-mouse CD45 Antibody was purchased from Biolegend, catalog number: 103138;

[0306] PerCP / Cyanine5.5 anti-mouse TCRβchain Antibody was purchased from Biolegend, catalog number: 109228;

[0307] PE anti-human CD335 (NKp46) Antibody was purchased from Biolegend, catalog number: 331907;

[0308] APC anti-mouse CD335 (NKp46) Antibody was purchased from Biolegend, catalog number: 137607;

[0309] Zombie NIR TM Fixable Viability Kit was purchased from Biolegend, catalog number: 423106;

[0310] Purified anti-mouse CD16 / 32 Antibody was purchased from Biolegend, catalog number: 101302;

[0311] PrimeScript TM RT reagent Kit with gDNA Eraser was purchased from TakaRa, catalog number 6110A;

[0312] APC Rat IgG2a, λIsotype Ctrl Antibody was purchased from Biolegend, catalog number: 402306;

[0313] PE Mouse IgG1, κIsotype Ctrl Antibody was purchased from Biolegend, catalog number: 400112;

[0314] PerCP anti-mouse Ly-6G / Ly-6C (Gr-1) Antibody was purchased from Biolegend, catalog number: 108426;

[0315] Brilliant Violet 421 TM Anti-mouse CD4 Antibody was purchased from Biolegend, catalog number: 100438;

[0316] FITC anti-mouse F4 / 80 Antibody was purchased from Biolegend, catalog number: 123108;

[0317] PE anti-mouse CD8a Antibody was purchased from Biolegend, catalog number: 100708;

[0318] Brilliant Violet 605 TM Anti-mouse CD19 Antibody was purchased from Biolegend, catalog number: 115540;

[0319] Brilliant Violet 605 TM Anti-mouse CD11c Antibody was purchased from Biolegend, catalog number: 117334;

[0320] PE anti-mouse / human CD11b Antibody was purchased from Biolegend, catalog number: 101208;

[0321] PE / Cy TM 7. Mouse anti-mouse NK1.1 was purchased from Biolegend, catalog number: 552878;

[0322] FITC Rat Anti-Mouse CD3 Molecular Complex was purchased from BD Pharmingen, catalog number: 561798;

[0323] APC Hamster Anti-Mouse TCRβChain was purchased from BD Pharmingen, catalog number: 553174;

[0324] APC anti-mouse / rat Foxp3 was purchased from eBioscience TM , item number: 17-5773-82.

[0325] Example 1 NKP46 gene humanized mice

[0326] A schematic diagram of the comparison of the mouse NKP46 gene (NCBI Gene ID: 17086, Primary source: MGI: 1336212, UniProt ID: Q8C567, located at positions 4340714 to 4348183 of chromosome 7 NC_000073.7, based on transcript NM_010746.3 and its encoded protein NP_034876.2 (SEQ ID NO: 1)) and the human NKP46 gene (NCBI Gene ID: 9437, Primary source: HGNC: 6731, UniProt ID: O76036, located at positions 54906063 to 54938211 of chromosome 19 NC_000019.10, based on transcript NM_004829.7 and its encoded protein NP_004820.2 (SEQ ID NO: 2)) is shown in FIG. Figure 1 shown.

[0327] To achieve the purpose of the present invention, a nucleotide sequence encoding a human NKP46 protein can be introduced into the mouse endogenous NKP46 locus, so that the mouse expresses a human or humanized NKP46 protein. Specifically, using gene editing technology, under the control of the mouse NKP46 gene regulatory element, a partial sequence of exon 1 to a partial sequence of exon 7 of about 6.5 kb of the human NKP46 gene is used to replace a partial sequence of exon 1 to a partial sequence of exon 7 of about 6.7 kb of the mouse, to obtain a humanized NKP46 locus schematic diagram as shown below: Figure 2 As shown, the humanized transformation of the mouse NKP46 gene was achieved.

[0328] Design as Figure 3 The targeting strategy shown in the figure shows the targeting vector containing upstream and downstream homology arm sequences of the mouse NKP46 gene and segment A containing a human NKP46 DNA fragment. The upstream 5' homology arm sequence (SEQ ID NO: 3) is identical to nucleotides 4336716 to 4340750 of NCBI Accession No. NC_000073.7, and the downstream 3' homology arm sequence (SEQ ID NO: 4) is identical to nucleotides 4348522 to 4352569 of NCBI Accession No. NC_000073.7. The nucleotide sequence of the human NKP46 DNA fragment in segment A (SEQ ID NO: 7) is approximately 99% identical to nucleotides 54906191 to 54912715 of NCBI Accession No. NC_000019.10, with a mutation at position 54906696 from "C" to "A."

[0329] The targeting vector also contains a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system FRT recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The connection between the 5' end of the Neo cassette and the mouse gene is designed as: 5'-CTCCTCCACCCTTCA CTTTCTTCTCTTCAAACAC TCCCGGTA CCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCGAAGTTCCTATTC-3' (SEQ ID NO: 10), wherein the sequence " TCCC The last "C" in the sequence is the last nucleotide of the mouse. GGTA The first "G" is the first nucleotide of the Neo box; the connection between the 3' end of the Neo box and the mouse gene is designed as: 5'-TATAGGAACTTCATCAGTCAGGTACATA ATGGTGG ATCCATAT ACCCCTCTTACTCTCTTTCAAATTCATGGCCTCTAGTT-3' (SEQ ID NO: 11), wherein the sequence " ATCC The last "C" in the sequence is the last nucleotide of the Neo box. ATAT The first one in " A ” is the first nucleotide of the mouse. In addition, a gene encoding a negative selection marker (the gene encoding the diphtheria toxin A subunit (DTA)) was constructed downstream of the 3' homology arm of the targeting vector. The mRNA sequence of the modified humanized mouse NKP46 is shown in SEQ ID NO: 8, and the expressed protein sequence is shown in SEQ ID NO: 9.

[0330] Given that human NKP46 has multiple isoforms or transcripts, the methods described herein can be applied to other isoforms or transcripts.

[0331] Targeting vector construction can be carried out by conventional methods, such as enzyme digestion and ligation. After the constructed targeting vector is initially verified by enzyme digestion, it is sent to a sequencing company for sequencing verification. The targeting vector verified to be correct by sequencing is electroporated and transfected into embryonic stem cells of C57BL / 6 mice. The resulting cells are screened using positive clone screening marker genes, and PCR and Southern Blot techniques are used to detect and confirm the integration of the exogenous gene, and the correct positive clone cells are screened. After PCR identification (primers are shown in Table 1), the clones that are positive are then subjected to Southern Blot detection to confirm that there are no random insertions, and the correct clones are further sequenced to verify that they are correct for the next experiment.

[0332] Table 1 PCR primer names and specific sequences

[0333]

[0334] The correct positive clone cells (black mice) screened out are introduced into the separated blastocysts (white mice) according to the techniques known in the art. The obtained chimeric blastocysts are transferred to the culture medium for a short culture and then transplanted into the oviduct of the recipient mother mouse (white mouse). F0 generation chimeric mice (black and white) can be produced. F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice, and then the F1 generation heterozygous mice are mated with each other to obtain F2 generation homozygous mice. Positive mice can also be mated with Flp tool mice to remove the positive clone screening marker gene (see the schematic diagram of this process). Figure 4 ) and then NKP46 gene humanized homozygous mice can be obtained by mating with each other.

[0335] In addition, CRISPR / Cas system can be introduced for gene editing, such as Figure 5 The targeting strategy shown in the figure shows the targeting vector containing upstream and downstream homology arm sequences of the mouse NKP46 gene and the sequence of a human NKP46 DNA fragment. Among them, the upstream homology arm sequence (5' homology arm, SEQ ID NO: 5) is identical to the nucleotide sequence of 4339331 to 4340750 of NCBI Accession No. NC_000073.7, the downstream homology arm sequence (3' homology arm, SEQ ID NO: 6) is approximately 99% identical to the nucleotide sequence of 4347485 to 4348999 of NCBI Accession No. NC_000073.7, and the nucleotide sequence of the human NKP46 DNA fragment (SEQ ID NO: 7) is approximately 99% identical to the nucleotide sequence of 54906191 to 54912715 of NCBI Accession No. NC_000019.10, with position 54906696 mutated from "C" to "A". The mRNA sequence of the modified humanized mouse NKP46 is shown in SEQ ID NO: 8, and the expressed protein sequence is shown in SEQ ID NO: 9.

[0336] Targeting vector construction can be performed using conventional methods, such as enzyme digestion, ligation, and direct synthesis. After initial verification of the constructed targeting vector through enzyme digestion, it is sent to a sequencing company for sequencing verification. Targeting vectors that have been verified to be correct by sequencing are used in subsequent experiments.

[0337] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cut the target gene. Therefore, efficient and specific target sequence selection and design are prerequisites for constructing sgRNA expression vectors. Design and synthesize the sgRNA sequence that recognizes the target site. The target sequence of the exemplary sgRNA on the NKP46 gene is as follows:

[0338] sgRNA1 target site (SEQ ID NO: 14): 5′-TTGAATCAAGAGCAGATTGGGGG-3′;

[0339] sgRNA2 target site (SEQ ID NO: 15): 5′-GAATCTCATTCGAATTGGTCTGG-3′;

[0340] The activity of sgRNA was detected using a UCA kit. After confirming that it could mediate efficient cleavage, enzyme cleavage sites were added to its 5' end and complementary chain to obtain forward oligonucleotide and reverse oligonucleotide sequences (see Table 2). After annealing, the annealed products were ligated to the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) to obtain expression vectors pT7-NKP46-1 and pT7-NKP46-2.

[0341] Table 2 Sequence list of sgRNA1 and sgRNA2

[0342]

[0343]

[0344] The pT7-sgRNA vector was synthesized by a plasmid synthesis company. The fragment DNA containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 24) was then ligated to a backbone vector (source: Takara, Cat. No. 3299) using enzyme digestion (EcoRI and BamHI). Sequencing verification by a professional sequencing company confirmed the acquisition of the target plasmid. Pronuclear fertilized eggs of mice, such as C57BL / 6 or BALB / c mice, were taken. In vitro transcription products of the pT7-NKP46-1 and pT7-NKP46-2 plasmids (transcribed using the Ambion in vitro transcription kit according to the instructions), the targeting vector, and Cas9 mRNA were premixed and injected into the cytoplasm or nucleus of the mouse fertilized eggs using a microinjector. Microinjection of fertilized eggs was performed according to the method in the "Mouse Embryo Manipulation Experiment Manual (3rd Edition)" (Andras Nagy, Chemical Industry Press, 2006). The injected fertilized eggs were transferred to culture medium for a short period of culture and then transplanted into the oviduct of the recipient mother mouse for development. The obtained mice (F0 generation) were expanded through hybridization and self-pollination to establish a stable NKP46 gene humanized mouse strain.

[0345] The genotype of F1 generation mouse somatic cells can be identified by PCR (primers are shown in Table 1). The identification results of exemplary F1 generation mice are shown in Figure 6 Among them, mice numbered F1-01, F1-02 and F1-03 are positive heterozygous mice.

[0346] Southern blot analysis was performed on F1 generation mice that were PCR positive to confirm the presence of random insertions. Genomic DNA was extracted from the tails of the mice and digested with BspHI or StuI enzymes, transferred to a membrane, and hybridized. Specific probe and target fragment lengths are shown in Table 3. Example F1 generation test results are shown in Table 3. Figure 7 As shown: F1-01, F1-02, and F1-03 are all positive heterozygous mice. This indicates that this method has successfully constructed NKP46 gene humanized mice that can be stably propagated and have no random insertions.

[0347] Table 3 Length of specific probes and target fragments

[0348] Restriction enzymes probe Wild-type fragment size Recombinant sequence fragment size BspHI A Probe -- 8.6kb StuI 3'Probe 18.1kb 14.6kb

[0349] The probe synthesis primers are as follows:

[0350] A Probe-F (SEQ ID NO: 25): 5'-GCAGTGTTTGTGTCCCTGGGTACTT-3',

[0351] A Probe-R (SEQ ID NO: 26): 5'-TACCCAACAGCTCATTGAGAACGGG-3';

[0352] 3'Probe-F (SEQ ID NO: 27): 5'-TCTACCGCCATGACCATAGCACCTA-3',

[0353] 3'Probe-R (SEQ ID NO: 28): 5'-TCTGCTCTCTTCCATGTTGGTTCCT-3';

[0354] The expression of human or humanized NKP46 protein in positive mice can be confirmed by conventional detection methods, such as flow cytometry. Specifically, 1 6-week-old female C57BL / 6 wild-type mouse and 1 hNKP46 humanized heterozygous mouse were taken, euthanized by cervical dislocation, and peripheral blood and spleen cells of the mice were collected. The cells were then stained with anti-mouse CD45 antibody Brilliant Violet 510 and anti-mouse CD45 antibody Brilliant Violet 510. TM anti-mouse CD45 Antibody (mCD45), anti-mouse TCRβ antibody PerCP / Cyanine5.5anti-mouse TCRβchain Antibody (mTCRβ), anti-mouse NK1.1 antibody PE / Cy TM7Mouseanti-mouse NK1.1(mNK1.1), anti-human NKP46 antibody PE anti-human CD335(NKp46)Antibody(hNKP46), anti-mouse NKP46 antibody APC anti-mouse CD335(NKp46)Antibody(mNKP46), ZombieNIR TM Flow cytometry was performed after staining with Fixable Viability Kit and Purified anti-mouse CD16 / 32 Antibody. The results are shown in Table 4.

[0355] Table 4 Flow cytometry results of humanized NKP46 gene heterozygous mice

[0356]

[0357] As can be seen from Table 4, only mouse NKP46 protein was detected in wild-type C57BL / 6 mice, and no human or humanized NKP46 protein was detected; humanized NKP46 protein could only be detected in NKP46 humanized heterozygous mice.

[0358] Similarly, flow cytometry was used to examine the expression of humanized NKP46 protein in mice homozygous for the humanized NKP46 gene. Specifically, one 5-week-old female C57BL / 6 wild-type mouse and one 5-6-week-old female NKP46 homozygous mouse were euthanized by cervical dislocation. Spleens and peripheral blood were obtained and analyzed by flow cytometry using the same reagents as described above, along with staining with APCRat IgG2a, λIsotype Ctrl Antibody and PE Mouse IgG1, κIsotype Ctrl Antibody. The results are shown in Table 5.

[0359] Table 5 Flow cytometry results of humanized NKP46 homozygous mice

[0360]

[0361] As can be seen from Table 5, only mouse NKP46 protein was detected in wild-type C57BL / 6 mice, and no human or humanized NKP46 protein was detected; in NKP46 humanized homozygous mice, only humanized NKP46 protein was detected, and no mouse NKP46 protein was detected, indicating that humanized NKP46 protein can be normally expressed in NKP46 humanized homozygous mice.

[0362] Furthermore, flow cytometry was used to perform immunophenotyping on the spleen, lymph nodes, and blood of C57BL / 6 wild-type mice (+ / +) and NKP46 gene humanized homozygous mice (H / H). Specifically, three 6-week-old female C57BL / 6 wild-type mice and three NKP46 gene humanized homozygous mice were taken, euthanized by cervical dislocation, and the spleen, lymph nodes, and blood were obtained. Purified anti-mouse CD16 / 32 Antibody, Zombie NIR TM Fixable Viability Kit, Brilliant Violet510 TM anti-mouse CD45 Antibody, PerCP anti-mouse Ly-6G / Ly-6C(Gr-1)Antibody, Brilliant Violet421 TM anti-mouse CD4 Antibody, FITC anti-mouse F4 / 80Antibody, PE anti-mouse CD8a Antibody, PE / Cy TM 7Mouse anti-mouse NK1.1, FITC RatAnti-Mouse CD3 Molecular Complex, APC Hamster Anti-Mouse TCRβChain, APC anti-mouse / rat Foxp3, Brilliant Violet 605 TM anti-mouse CD19 Antibody, BrilliantViolet 605 TM Antibodies such as anti-mouse CD11c Antibody and PE anti-mouse / human CD11bAntibody were used for immunophenotyping. The results of leukocyte and T cell subtype detection in spleen and blood were as follows: Figure 8 and Figure 9 As shown in the figure, it can be seen that the B cells (B Cells), T cells (Tcells), NK cells (NK cells), CD4 + T cells (CD4 + T cells), CD8 + T cells (CD8 +The leukocyte subtypes, including T cells, granulocytes, macrophages, and monocytes, were similar to those of C57BL / 6 wild-type mice ( Figure 8 (A) and Figure 9 (A)), CD4 + T cells (CD4 + T cells), CD8 + T (CD8 + The percentages of T cell subtypes, such as T cells and Tregs, were similar to those in C57BL / 6 wild-type mice ( Figure 8 (B) and Figure 9 (B)).

[0363] The results of leukocyte subtype and T cell subtype detection in lymph nodes are as follows: Figure 10 (A) and Figure 10 As shown in (B), it can be seen from the figure that B cells (B cells), T cells (T cells), NK cells (NK cells), CD4 + T cells (CD4 + T cells), CD8 + T (CD8 + The leukocyte subtypes such as T cells and CD4 T cells were similar to those of C57BL / 6 wild-type mice. + T cells, CD8 + The percentages of T cell subtypes, including T cells and Tregs, were similar to those in C57BL / 6 wild-type mice, indicating that humanization of the NKP46 gene did not affect the differentiation, development, and distribution of white blood cells and T cells in the spleen, lymph nodes, and blood of the mice.

[0364] Example 2: Efficacy Verification

[0365] The NKP46 gene humanized mice prepared by this method can be used to evaluate the efficacy of antibodies targeting human NKP46. For example, NKP46 gene humanized homozygous mice were subcutaneously inoculated with colon cancer cells MC38, and the tumor volume grew to about 100 mm. 3 Afterwards, mice were divided into a control group or a treatment group based on tumor volume. The treatment group was injected with an antibody targeting human NKP46, while the control group was injected with an equal volume of PBS. Tumor volume was measured and mice were weighed regularly. Comparing changes in mouse weight and tumor volume effectively assessed the safety and efficacy of the antibody in humanized NKP46 mice.

[0366] Specifically, 7-8 week-old NKP46 gene humanized homozygous mice were subcutaneously inoculated with colon cancer cells MC38 (5×10 5 ), wait until the tumor volume grows to about 100 mm 3 Afterwards, the mice were divided into control or treatment groups (n=7 / group). Treatment groups G2 and G3 were injected with IgG1 antibody drugs Ab1 and Ab2 targeting human NKP46, and treatment group G4 was injected with Ab2-LALA (Ab2 with LALA mutation). The control group was injected with an equal volume of PBS. The administration frequency was twice a week for a total of 6 doses. The tumor volume was measured twice a week and the mice were weighed until the end of the experiment on day 20 (day 20 after grouping). After inoculation, the tumor volume of a single mouse reached 3000mm. 3 The specific groups, administration, dosage and frequency are shown in Table 6. The weight, tumor volume and weight changes of mice during the experiment are shown in Table 6. Figure 11 、 Figure 12 and Figure 13 .

[0367] Table 6 Specific groups, administration, dosage and frequency

[0368]

[0369]

[0370] The results showed that the animals in each group were in good health during the experiment. At the end of the experiment (20 days after grouping), the weight of mice in all treatment and control groups increased, and there was no significant difference in the weight and weight changes of mice during the entire experimental period ( Figure 11 、 13 ); but from the results of tumor volume measurement ( Figure 12 ). Tumors in the control group continued to grow throughout the experimental period. Compared with the control group, tumor growth in G2 and G3 mice in the treatment groups showed varying degrees of inhibition and / or reduction. This suggests that anti-human NKP46 antibodies have varying tumor-suppressing effects in mice, while isoform-modified antibody drugs have no tumor-suppressing effect.

[0371] Table 7 Tumor volume and survival of mice in each group

[0372]

[0373] Table 7 lists the main data and analysis results of each experiment, including tumor volume at the time of grouping, 11 days after grouping, and at the end of the experiment (20 days after grouping), mouse survival, the status of tumor-free mice, and tumor (volume) inhibition rate (Tumor Growth Inhibition Value, TGI TV) and statistical differences (P values) in mouse body weight and tumor volume between the treatment group and the control group.

[0374] As shown in Table 7, at the end of the experiment, the average tumor volume of the control group G1 was 1470±260mm 3 , while the average tumor volumes of treatment groups G2, G3, and G4 were 685±70mm 3 、639±170mm 3 and 1624±369mm 3 The tumor volumes of mice in the G2 and G3 groups were significantly smaller than those in the control group, and there was a significant difference in tumor volume compared with the control group (p < 0.05). TV The results were 58.1% and 61.4%, respectively. This demonstrates that Ab1 and Ab2 have good tumor treatment and tumor growth inhibition capabilities in NKP46 homozygous humanized mice, while the isoform-modified Ab2-LALA has no tumor inhibitory effect. In summary, the humanized NKP46 animal model can be used as a living model for in vivo efficacy studies, for the screening, evaluation, and treatment of NKP46 signaling pathway modulators, and for the in vivo evaluation of the effectiveness of antibodies targeting human NKP46 and the evaluation of the therapeutic effects of NKP46-targeted therapies.

[0375] Example 3 Preparation of Double Humanized or Multiply Double Humanized Mice

[0376] The NKP46 mice produced by the present method can also be used to prepare dual-humanized or multi-humanized mouse models. For example, in Example 1 above, the embryonic stem cells used for blastocyst microinjection can be derived from mice modified with genes encoding NKG2D, EGFR, HER2, B7H3, BCMA, FAP, CXCR4, CSF2, TNFR2, IL-2, IL-15, IL-15RA, IL-10, PD-1, PD-L1, TIGIT, CD16A, CD2, CD38, and the like. Alternatively, based on humanized NKP46 mice, mouse ES embryonic stem cells can be isolated and gene-targeted to obtain dual- or multi-gene modified mouse models expressing NKP46 and other genes. The homozygous or heterozygous NKP46 mice obtained by this method can also be mated with homozygous or heterozygous mice with other genetic modifications, and their offspring can be screened. According to Mendel's law of inheritance, there is a certain probability of obtaining heterozygous mice with humanized NKP46 and other genetic modifications, double-gene or multi-gene modifications. The heterozygotes can then be mated with each other to obtain homozygous mice with double-gene or multi-gene modifications. These double-gene or multi-gene modified mice can be used to conduct in vivo efficacy verification of drugs targeting human NKP46 and other gene regulators.

[0377] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0378] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0379] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for constructing a non-human animal with humanized NKP46 gene, characterized in that: The non-human animal expresses a humanized NKP46 protein, or the genome of the non-human animal contains a humanized NKP46 gene, the humanized NKP46 protein contains a portion of a human NKP46 protein and a portion of a non-human animal NKP46 protein, the portion of the human NKP46 protein is all or part of a signal peptide and a portion of an extracellular region of the human NKP46 protein, the portion of the extracellular region of the human NKP46 protein is the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2, the portion of the human NKP46 protein is the amino acid sequence shown at positions 2-253 or 1-253 of SEQ ID NO: 2, the humanized NKP46 gene contains a portion of a human NKP46 gene, the portion of the human NKP46 gene encodes a portion of the human NKP46 protein, the expression of endogenous NKP46 protein in the non-human animal is reduced or absent, the portion of the non-human animal NKP46 protein contains the cytoplasmic region and transmembrane region of the non-human animal NKP46 protein, and the non-human animal is a mouse.

2. The construction method according to claim 1, characterized in that All or part of the human NKP46 protein signal peptide is the amino acid sequence shown in positions 2-21 or 1-21 of SEQ ID NO:

2.

3. The construction method according to claim 1, characterized in that The portion of the non-human animal NKP46 protein further comprises a partial amino acid sequence of the extracellular region and / or signal peptide of the non-human animal NKP46 protein.

4. The construction method according to claim 1, wherein The amino acid sequence of the humanized NKP46 protein is the amino acid sequence shown in SEQ ID NO:

9.

5. The construction method according to claim 1, characterized in that The portion of the human NKP46 gene includes a portion of exon 1, all of exons 2 to 6, and a portion of exon 7 of the human NKP46 gene, wherein the portion of exon 1 includes a nucleotide sequence of at least 20bp, and the portion of exon 7 includes a nucleotide sequence of at least 10bp.

6. The construction method according to claim 5, characterized in that: The part of the human NKP46 gene is the nucleotide sequence shown in SEQ ID NO:

7.

7. The construction method according to claim 6, characterized in that: The humanized NKP46 gene also includes a portion of a non-human animal NKP46 gene.

8. The construction method according to claim 7, characterized in that: The portion of the non-human animal NKP46 gene includes all or part of exon 1 and / or exon 7 of the non-human animal NKP46 gene.

9. The construction method according to claim 1, characterized in that: The mRNA transcribed from the humanized NKP46 gene has a nucleotide sequence shown in SEQ ID NO:

8.

10. The construction method according to any one of claims 1 to 9, characterized in that: The construction method comprises introducing a donor nucleotide sequence into the NKP46 locus of a non-human animal, wherein the donor nucleotide sequence comprises one of the following groups: A) Part of the human NKP46 gene; B) a nucleotide sequence encoding a portion of the human NKP46 protein; C) a nucleotide sequence encoding a humanized NKP46 protein; or D) Nucleotide sequence of the humanized NKP46 gene.

11. The construction method according to claim 10, characterized in that: The portion of the human NKP46 gene or the humanized NKP46 gene can be operably linked to an endogenous regulatory element.

12. The construction method according to claim 10, characterized in that: The said import is insertion or replacement.

13. The construction method according to claim 12, characterized in that: The introduction of the NKP46 gene locus into the non-human animal is to replace the corresponding region of the non-human animal.

14. The construction method according to claim 13, characterized in that: The replacement is to replace all or part of exons 1 to 7 of the non-human animal NKP46 gene.

15. The construction method according to any one of claims 10 to 14, characterized in that: The construction method includes using a targeting vector to construct a non-human animal, and the targeting vector contains the donor nucleotide sequence.

16. The construction method according to claim 15, characterized in that: The targeting vector further comprises a 5' arm and a 3' arm; The 5' arm is the nucleotide sequence shown in SEQ ID NO: 3 or 5; The 3' arm is the nucleotide sequence shown in SEQ ID NO: 4 or 6.

17. The construction method according to any one of claims 1-9, 11-14, and 16, characterized in that: The construction method further includes mating, in vitro fertilization or direct gene editing of non-human animals with humanized NKP46 genes with other genetically modified non-human animals, and screening to obtain multi-gene modified non-human animals.

18. The construction method according to claim 17, characterized in that: The other genes are selected from at least one of NKG2D, EGFR, HER2, B7H3, BCMA, FAP, CXCR4, CSF2, TNFR2, IL-2, IL-15, IL-15RA, IL-10, PD-1, PD-L1, TIGIT, CD16A, CD2 or CD38.

19. The construction method according to any one of claims 17-18, characterized in that: The human or humanized NKP46 gene and / or other genes are homozygous or heterozygous for the endogenous modified locus.

20. A humanized NKP46 protein, characterized in that The humanized NKP46 protein comprises a portion of a human NKP46 protein and a portion of a non-human animal NKP46 protein, wherein the portion of the human NKP46 protein comprises all or part of the signal peptide and a portion of the extracellular region of the human NKP46 protein, wherein the portion of the extracellular region of the human NKP46 protein is the amino acid sequence shown at positions 22-253 of SEQ ID NO: 2, and the portion of the human NKP46 protein is the amino acid sequence shown at positions 2-253 or 1-253 of SEQ ID NO: 2, wherein the portion of the non-human animal NKP46 protein comprises the cytoplasmic region and transmembrane region of the non-human animal NKP46 protein, and the non-human animal is a mouse.

21. The humanized NKP46 protein according to claim 20, characterized in that All or part of the human NKP46 protein signal peptide is the amino acid sequence shown in positions 1-21 or 2-21 of SEQ ID NO:

2.

22. The humanized NKP46 protein according to claim 20, characterized in that The portion of the non-human animal NKP46 protein further comprises a signal peptide and / or a partial amino acid sequence of the extracellular region of the non-human animal NKP46 protein.

23. The humanized NKP46 protein according to any one of claims 20 to 22, characterized in that: The amino acid sequence of the humanized NKP46 protein is the amino acid sequence shown in SEQ ID NO:

9.

24. A humanized NKP46 gene, characterized in that: The humanized NKP46 gene comprises a portion of the human NKP46 gene, and the humanized NKP46 gene comprises a nucleotide sequence encoding the humanized NKP46 protein according to any one of claims 20-23.

25. The humanized NKP46 gene according to claim 24, characterized in that The portion of the human NKP46 gene includes a portion of exon 1, all of exons 2 to 6, and a portion of exon 7 of the human NKP46 gene, wherein the portion of exon 1 includes a nucleotide sequence of at least 20bp, and the portion of exon 7 includes a nucleotide sequence of at least 10bp.

26. The humanized NKP46 gene according to claim 25, characterized in that The portion of the human NKP46 gene is the nucleotide sequence shown in SEQ ID NO:

7.

27. The humanized NKP46 gene according to claim 26, characterized in that The humanized NKP46 gene also includes a portion of a non-human animal NKP46 gene.

28. The humanized NKP46 gene according to claim 27, characterized in that The portion of the non-human animal NKP46 gene includes all or part of exon 1 and / or exon 7 of the non-human animal NKP46 gene.

29. The humanized NKP46 gene according to claim 24, characterized in that The mRNA transcribed from the humanized NKP46 gene has a nucleotide sequence shown in SEQ ID NO:

8.

30. The humanized NKP46 gene according to any one of claims 27 to 29, characterized in that: The non-human animal is a mouse.

31. A cell, tissue or organ, characterized in that: The cell, tissue or organ expresses the humanized NKP46 protein according to any one of claims 20-23, or the genome of the cell, tissue or organ contains the humanized NKP46 gene according to any one of claims 24-30, or is derived from a non-human animal obtained by the construction method according to any one of claims 1-19, and the cell, tissue or organ cannot develop into an animal individual.

32. The cell, tissue or organ according to claim 31, wherein The tissue includes tumor tissue after tumor-bearing.

33. A use of the humanized NKP46 protein according to any one of claims 20-23, the humanized NKP46 gene according to any one of claims 24-30, the non-human animal obtained by the construction method according to any one of claims 1-19, or the cell, tissue or organ according to any one of claims 31-32, characterized in that: The applications include: A) Applications in the development of products involving NKP46-related immune processes in human cells; B) Application as a model system for NKP46-related research in pharmacology, immunology, microbiology, and medicine; C) Applications involving the production and use of animal experimental disease models for the study of NKP46-related etiologies and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies; D) Screen, validate, evaluate or study the function of NKP46 pathway; or E) Applications in screening and evaluation of human drugs and drug efficacy studies, The application is a method for treating and / or diagnosing a non-disease.

Images