Application of si-PTBP1 in preparation of a drug for improving chemotherapy sensitivity of cancer cells, and a drug preparation and detection method

By designing si-PTBP1 sequences to interfere with PTBP1 expression, and combining them with chemotherapy drugs RSL3 or cisplatin, the problem of chemotherapy resistance in gastric cancer can be solved, significantly enhancing the sensitivity of gastric cancer cells to chemotherapy drugs and achieving remarkable therapeutic effects.

CN115998756BActive Publication Date: 2026-03-27CHONGQING MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-21
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Drug resistance in gastric cancer chemotherapy drugs limits the effectiveness of chemotherapy, and current technologies are insufficient to effectively improve the sensitivity of gastric cancer cells to chemotherapy drugs.

Method used

The si-PTBP1 sequence was designed to inhibit PTBP1 expression. The RNA level of PTBP1 was interfered with by siRNA technology. Combined with ferroptosis inducers RSL3 or cisplatin, the sensitivity of gastric cancer cells to chemotherapy drugs was enhanced.

Benefits of technology

It significantly inhibits the proliferation of gastric cancer cells, enhances sensitivity to ferroptosis inducers RSL3 and cisplatin, and improves the efficacy of chemotherapy. Both in vivo and in vitro experiments showed significant therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115998756B_ABST
    Figure CN115998756B_ABST
Patent Text Reader

Abstract

The application relates to the field of biological medicine, in particular to application of si-PTBP1 in preparation of a medicine for improving chemotherapy sensitivity of cancer cells, and a medicine preparation and a detection method. The siRNA has a high transfection efficiency (more than 80%), can reduce the expression level of the PTBP1 gene in the gastric cancer cells, and further enhances the sensitivity of the gastric cancer cells to related chemotherapy drugs, so that the purpose of treating the gastric cancer is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of biological medicine, in particular to application of si-PTBP1 in preparation of a drug for improving chemotherapy sensitivity of cancer cells, and a drug preparation and a detection method. BACKGROUND

[0002] Gastric cancer is the most common digestive system tumor in China, and ranks fifth in the world in terms of incidence rate and fourth in mortality rate. According to statistics in 2020, there are 1.09 million new cases of gastric cancer worldwide, and 770,000 deaths, which is only less than lung cancer, colon cancer and liver cancer in terms of the number of deaths. Due to the lack of obvious and specific symptoms in the early stage of the disease, most gastric cancer patients are diagnosed in the late stage of the disease, and the prognosis is poor. At present, chemotherapy is the main treatment for patients with advanced gastric cancer and postoperative recurrence, however, the effect of chemotherapy is limited due to the drug resistance of gastric cancer cells.

[0003] RNA binding protein (RBPs) is a kind of protein existing in the nucleus and cytoplasm, which is involved in the regulation of RNA molecules such as capping, tailing, splicing, degradation, RNA editing, nuclear export, cell localization and stability in the post-transcriptional and translation process. At present, more than 1500 RBPs have been screened and identified, accounting for about 7.5% of all protein coding genes in the human genome. RBPs can interact with various types of RNA (including mRNAs, ncRNAs, tRNAs, snRNAs, snoRNAs) and proteins to form RBPs complexes, and then regulate the functions and metabolism of various RNAs.

[0004] PTBP1 is an RNA-binding protein (RBP) that can shuttle freely between the nucleus and cytoplasm, and is one of the important members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. Its gene is located on chromosome 19p13.3 in humans and is expressed in most tissue cells. PTBP1 is abnormally highly expressed in the development of various tumors such as breast cancer, renal clear cell carcinoma, and bladder cancer. Through the study of PTBP1, it is found that PTBP1 regulates various aspects of tumor development, including tumor proliferation, apoptosis, invasion and metastasis, and glycolysis. The main mechanisms by which PTBP1 regulates tumor development include: (1) PTBP1 regulates alternative splicing (PKMs); (2) PTBP1 regulates mRNA stability (CD154, HIF-1, AXL, MCL1); (3) PTBP1 regulates mRNA translation process (NR2F1, P27); (4) PTBP1 regulates mRNA nuclear-cytoplasmic distribution (CD40L); (5) PTBP1 binds to non-coding RNA to regulate the stability of downstream target mRNA (miR-133b / PTBP1 / PKM2, lnc00462717 / PTBP1 / miR-186-5P / occludin).

[0005] Reactive oxygen species (ROS) are a class of highly reactive oxygen-containing substances mainly produced by the body's oxidation-reduction reactions. ROS in human cells usually refers to H2O2. During different stages of cancer formation, the level of ROS has a dual regulatory effect on the growth and death of tumor cells. On the one hand, ROS can reversibly oxidize cysteine residues in proteins, thereby regulating signaling pathways related to tumor cell survival, proliferation, metabolism, invasion and metastasis, and promoting the occurrence and development of cancer. On the other hand, ROS accumulation can exert an anti-tumor effect by increasing oxidative stress and inducing various forms of tumor cell death, making it a promising anti-cancer treatment strategy. At present, anti-tumor drugs based on ROS regulation have made certain progress in preclinical studies, and some have entered the clinical trial stage. According to the different targets, anti-tumor drugs based on ROS can be divided into: (1) drugs targeting the mitochondrial electron transport chain, such as elesclomol (in the clinical trial stage), rotenone, DT-010. (2) drugs targeting NADPH oxidase (NOXs), such as GKT137831 (in the clinical trial stage), Morusin. (3) drugs targeting the glutathione system, such as APR-246 (in the clinical trial stage), buthionine sulfoximine (in the clinical trial stage), RSL3. (4) drugs targeting thioredoxin reductase, such as Auranofin (in the clinical trial stage), Ethacrynic acid. (5) drugs targeting Nrf2, such as ML385, IM3829, Brusatol.

[0006] At present, the commonly used first-line chemotherapy drugs in the treatment of gastric cancer include 5-FU, cisplatin, capecitabine, oxaliplatin and the like, and the clinical use drugs based on active oxygen regulation mainly include cisplatin, adriamycin, 5-FU, paclitaxel and the like. However, the effective rate of the gastric cancer chemotherapy scheme is about 50%, about 1 / 2 of the patients are not sensitive to the initial chemotherapy scheme (primary drug resistance), and a part of the patients will appear secondary drug resistance. How to improve the chemotherapy effect of gastric cancer and reduce the invalid chemotherapy is an urgent problem to be solved in clinic. The higher ROS level in the drug-resistant cancer cells makes the antioxidant enzyme level also at a higher level, therefore, further increasing the ROS level or inhibiting the antioxidant enzyme can improve the treatment sensitivity of the drug-resistant cancer cells. Studies have shown that miR-522 secreted by tumor-associated fibroblasts (CAFs) can inhibit the lipid ROS production of gastric cancer cells and reduce the sensitivity of the gastric cancer cells to cisplatin, and by inhibiting the miR-522 of the CAFs, the ROS level of the gastric cancer cells can be increased and the chemotherapy sensitivity of the gastric cancer cells can be improved. Similarly, by inhibiting the GCN2-eIF2alpha-ATF4-xCT pathway, the ROS level of the gastric cancer cells can be increased and the cisplatin treatment sensitivity can be improved. The antioxidant enzyme Peroxiredoxin 2 (PRDX2) significantly makes AGS and SNU-1 cells sensitive to cisplatin by regulating the ROS level. At the same time, RSL3 can induce the ROS production of the gastric cancer cells and improve the cisplatin treatment sensitivity of the drug-resistant gastric cancer cells. Therefore, the ROS level of the gastric cancer cells is closely related to the tumor occurrence and development and the chemotherapy drug resistance, and the regulation of the ROS level of the gastric cancer cells can be one of the strategies for effectively solving the problem of gastric cancer drug resistance. SUMMARY

[0007] The application discloses application of si-PTBP1 in preparation of a drug for improving chemotherapy sensitivity of cancer cells.

[0008] Sense strand: CCCUCAUUGACCUGCACAATT (SEQ ID NO: 1)

[0009] Antisense strand: UUGUGCAGGUCAAUGAGGGTT (SEQ ID NO: 2).

[0010] The application detects the RNA level expression of PTBP1 by designing a primer of PTBP1, and the PTBP1 quantitative detection primer provided by the application is composed of the following nucleotides.

[0011] Forward primer: CATTGTCCCAGATATAGCCGTTG (SEQ ID NO: 3)

[0012] Reverse primer: CTTCTTGCTGTCATTTCCGTTT (SEQ ID NO: 4)

[0013] The PCR product size is 130BP. The results of the fluorescence quantitative PCR detection of the transfection efficiency of si-PTBP1 show that in AGS cells, si-PTBP1 can significantly inhibit the expression of PTBP1, and the transfection efficiency reaches 90%. In HGC27 cells, si-PTBP1 can also significantly inhibit the expression of PTBP1, and the transfection efficiency reaches 80%.

[0014] According to the application, the cancer cells include gastric cancer cells.

[0015] The siRNA has a high transfection efficiency (more than 80%) and can reduce the expression level of the PTBP1 gene in the gastric cancer cells, thereby enhancing the sensitivity of the gastric cancer cells to the related chemotherapeutic drugs and achieving the purpose of treating gastric cancer.

[0016] The present application finds that, after transfecting AGS cells and HGC27 cells with si-PTBP1, the cell viability of the interference group is significantly lower than that of the control group in the CCK8 proliferation experiment. Meanwhile, the present application finds that, after transfecting AGS cells and HGC27 cells with si-PTBP1, the number of clone spheres of the interference group is significantly less than that of the control group, and the size of the clone spheres of the interference group is significantly smaller than that of the control group. The above results show that si-PTBP1 has a significant effect of inhibiting the proliferation ability of AGS cells and HGC27 in vitro.

[0017] According to the application, the si-PTBP1 can be applied to the preparation of a drug for enhancing the sensitivity of gastric cancer cells to an iron death inducer.

[0018] The present application finds that, after transfecting AGS cells and HGC27 cells with si-PTBP1 and combining with the iron death inducer RSL3, the iron death inducer RSL3 can significantly inhibit the formation of clone spheres of the gastric cancer cells in the clone formation experiment, and the combination of si-PTBP1 and RSL3 makes the inhibitory effect of RSL3 on the formation of clone spheres of the gastric cancer cells more significant. It is shown that si-PTBP1 can enhance the sensitivity of the gastric cancer cells to the iron death inducer in vitro.

[0019] The present application finds that, after injecting the cholesterol-modified PTBP1 siRNA and the iron death inducer RSL3 into the subcutaneous tumors of the gastric cancer tumor-bearing mice, the subcutaneous tumor proliferation speed and tumor volume of the NC group mice are greater than those of the NC+R group, which shows that RSL3 can play a tumor treatment role. When RSL3 and si-PTBP1 are combined, the tumor proliferation speed and tumor volume of the SIPT+R group are significantly smaller than those of the other groups, which shows that si-PTBP1 can enhance the sensitivity of the gastric cancer cells to RSL3 in vivo.

[0020] According to the application, the si-PTBP1 can be applied to the preparation of a drug for enhancing the sensitivity of gastric cancer cells to cisplatin.

[0021] The present application combines cisplatin after transfecting si-PTBP1 into AGS cells, detects the viability of gastric cancer cells by CCK8 experiment, finds that the cell viability of the interference group is significantly lower than that of the control group, which indicates that si-PTBP1 can enhance the sensitivity of AGS gastric cancer cells to cisplatin.

[0022] The present application also provides a drug preparation for improving the chemotherapy sensitivity of cancer cells, which comprises the sequence of si-PTBP1.

[0023] The drug preparation provided by the present application can be used to enhance the sensitivity of gastric cancer cells to ferroptosis inducers, and can also be used to enhance the sensitivity of gastric cancer cells to cisplatin.

[0024] The present application also provides a detection method for detecting the improvement of the chemotherapy sensitivity of cancer cells by using the drug preparation.

[0025] According to the detection method, the following steps are mainly included:

[0026] 1) si-PTBP1 cell transfection experiment;

[0027] 2) verification of si-PTBP1 transfection efficiency;

[0028] 3) TRIZOL method for extracting RNA;

[0029] 4) RNA quality and concentration identification;

[0030] 5) RNA reverse transcription;

[0031] 6) cell total protein extraction;

[0032] 7) cell viability detection;

[0033] 8) cancer cell proliferation detection.

[0034] In order to make the above and other objects, features and advantages of the present application more obvious and easy to understand, the following preferred embodiments are specifically described with reference to the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figures 1A-1B : Fluorescent quantitative PCR detection of PTBP1 expression of AGS cells and HGC27 cells transfected with si-PTBP1, and Western Blot experiment for detecting PTBP1 expression of AGS cells and HGC27 cells transfected with si-PTBP1.

[0036] Figures 2A-2B: CCK8 proliferation experiment was used to detect the proliferation ability of gastric cancer cells after AGS cells and HGC27 cells were transfected with si-PTBP1, and clone formation experiment was used to detect the proliferation ability of gastric cancer cells after AGS cells and HGC27 cells were transfected with si-PTBP1.

[0037] Figures 3A-3B : Clone formation experiment was used to detect the proliferation ability of gastric cancer cells after AGS cells and HGC27 cells were transfected with si-PTBP1 combined with RSL3, an inducer of ferroptosis, and si-PTBP1 combined with RSL3 proved that si-PTBP1 increased the sensitivity of gastric cancer cells to RSL3, an inducer of ferroptosis.

[0038] Figure 4 : CCK8 activity assay was used to prove that si-PTBP1 increased the sensitivity of gastric cancer cells to cisplatin after si-PTBP1 was transfected in AGS cells. DETAILED DESCRIPTION

[0039] In order to make the technical problems, technical solutions and advantages of the present application clearer, specific embodiments will be described in detail below with reference to the accompanying drawings.

[0040] Table 1

[0041]

[0042]

[0043] Example 1: Establishment of si-PTBP1 interference efficiency detection method

[0044] 1. Cell transfection experiment:

[0045] 1) Plating:

[0046] The well AGS cells were plated at 4.3x10^5 cells per well (6-well plate) (HGC27 cells 2.3x10^5 cells / well)

[0047] 2) siRNA transfection (siRNA was synthesized by Genchem): After 24h of adherent culture, the transfection reagent was mixed according to the following system: A: 200μL opti-MEM+5μL Lipo 2000; B: 200μL opti-MEM+7.5μL siRNA, A system was mixed and stood for 5min; B system was added to A system, mixed and stood for 15min

[0048] 3) Discard the culture medium in the 6-well plate, add 1.6 mL of opti-MEM medium to each well; add 400 μL of the above mixed liquid to each well, mix the culture solution, and then place the 6-well plate in a 37°C, 5% CO2 cell incubator for sterile culture.

[0049] 4) Verify the si-PTBP1 transfection efficiency at the RNA level: 24 h later, extract the RNA of the cells by the TrizoL method, perform reverse transcription and fluorescent quantitative PCR, and detect the si-PTBP1 transfection efficiency.

[0050] 5) Verify the si-PTBP1 transfection efficiency at the protein level: 48 h later, extract the total protein of the cells, and perform a WESTERN BLOT experiment to detect the si-PTBP1 transfection efficiency.

[0051] 2, TRIZOL method for extracting RNA:

[0052] 1) Centrifuge the collected cells, collect the cell precipitate, and add 500 μL of Trizol liquid.

[0053] 2) Add 100 μL of chloroform and mix well. Let stand at room temperature for 5 min. Observe that the solution is layered, which is normal; otherwise, add more chloroform to adjust the condition.

[0054] 3) Centrifuge at 4°C, 12000 rpm for 15 min, and collect the supernatant (note that the gun head should not be inserted into the red liquid phase, and the red liquid should not be sucked in). According to the volume of the collected supernatant, add isopropanol at a ratio of 1:1, mix gently to avoid RNA breakage, and let stand for 10 min.

[0055] 4) Centrifuge at 4°C, 12000 rpm for 15 min. Discard the supernatant (observe the position of the precipitate, and note that the gun head should not suck up the precipitate). Add 1 mL of 75% DEPC ethanol, mix gently. Centrifuge at 4°C, 12000 rpm for 10 min, and discard the supernatant (observe the position of the precipitate, and note that the gun head should not suck up the precipitate). Centrifuge the EP tube with the supernatant for 1 min, replace the small range pipette to suck out the residual waste liquid, and then place it in a fume hood to evaporate the alcohol.

[0056] 5) Put the enzyme-free water into a 65°C metal bath, add the preheated water to the precipitate, dissolve the precipitate RNA to form an RNA solution, and then detect the RNA concentration.

[0057] 3, RNA quality and concentration identification:

[0058] 1) Turn on the NanoDrop One instrument, and after the machine self-check is completed, click RNA.

[0059] 2) After blank test with RNase-free water, 2 μL of each sample was measured. The RNA concentration and A260 / 280, A260 / 230 ratio were observed and recorded.

[0060] 3) After measurement, the instrument was cleaned with RNase-free water, and the measurement interface was exited and the instrument was turned off.

[0061] 4, RNA reverse transcription

[0062] 1) Reaction system: 10 μL system, 5x PrimeScript buffer 2 μL, Oligo dT Primer (50 μM) 0.5 μL, Random 6mers (100 μM) 2 μL, Enzyme 0.5 μL, RNA 1 μg, ddH2O up to 10 μL.

[0063] 2) Reaction conditions:

[0064] 37℃, 15min;

[0065] 85℃, 5s;

[0066] 4℃ preservation.

[0067] 5, Fluorescent quantitative PCR detection of PTBP1 gene expression:

[0068] 40 μL of RNase-free water was added to the reverse transcription product for dilution. The expression of PTBP1 gene and β-ACTIN was quantitatively detected according to the following system: 10 μL system, SYBR 5.0 μL, Forward primer (5 μM) 0.2 μL, Reverse primer (5 μM) 0.2 μL, ddH2O 3.6 μL, cDNAs 1.0 μL.

[0069] Reaction conditions:

[0070] 95℃, 30s;

[0071] 95℃, 10s (40 cycles);

[0072] 61.9℃ (PTBP1 gene) or 58℃ (β-ACTIN gene), 10s;

[0073] 72℃, 10s, fluorescence was collected at 72℃.

[0074] Dissolution curve was collected, and each cycle was increased by 0.5℃ from 60℃ to 95℃, for a total of 71 cycles.

[0075] 6, Cell total protein extraction:

[0076] 1) The residual medium of the adherent cells in the six-well plate is washed with pre-cooled PBS, and an appropriate amount of prepared protein lysis solution is added (the amount of lysis solution is increased or decreased according to the amount of cells). The lysed cells are scraped with a cell scraper and transferred to a 1.5ml EP tube. The supernatant is centrifuged and the cells are combined in the EP tube for lysis.

[0077] 2) The 1.5 EP tube with the added lysis solution is placed on ice and lysed for 30 min on ice, with vortexing every 5 min for 10 s.

[0078] 3) The cell lysate is centrifuged in a high-speed centrifuge at 12000 rpm for 15 min.

[0079] 4) Collect the supernatant, and make sure that the precipitate is not sucked into the gun head. (Note the volume of the collected protein supernatant)

[0080] 5) Measure the protein concentration by BCA method (nucleic acid detector or enzyme label instrument).

[0081] 6) According to the volume of the collected supernatant, calculate the volume of 5x loading and prepare 1x loading cell lysate.

[0082] 7) Turn on the metal bath instrument in advance and set it to 100℃. Place the cell lysate in the 100℃ metal bath for 10 min for denaturation.

[0083] 8) Use or store the denatured protein at -20℃ or in an ultra-low temperature freezer to prevent protein degradation.

[0084] 7. Western blot experiment:

[0085] 1) Load the protein sample into the SDS-PAGE gel. If the loading amount is significantly different, add 1x loading buffer diluent to adjust the loading amount to 20μg of total protein concentration.

[0086] 2) Perform SDS-PAGE electrophoresis with a voltage of 120V.

[0087] 3) After electrophoresis, transfer the gel to a PVDF membrane at 250mA for 1.5h.

[0088] 4) After transferring the membrane, block the PVDF membrane in 5% skim milk for 1h, then incubate the primary antibody at 4℃ overnight.

[0089] 5) The next day, wash the strip in PBST liquid for 5-10 min each time, wash three times, and incubate the secondary antibody at room temperature for 1h. After washing three times, develop using a chemiluminescence instrument.

[0090] Results: According to Figure 1AIt can be seen that the si-PTBP1 knockdown PTBP1 efficiency in AGS cells can reach 90%, and the si-PTBP1 knockdown PTBP1 efficiency in HGC27 cells can reach 80%, which has a significant interference efficiency. Figure 1B It can be seen that after si-PTBP1 interferes AGS cells and HGC27 cells, the expression of PTBP1 protein in the cells is significantly down-regulated, and si-PTBP1 has a significant interference efficiency.

[0091] Example 2 si-PTBP1 can inhibit the proliferation ability of gastric cancer cells in vitro

[0092] 1. Cell transfection experiment:

[0093] 1) Plating:

[0094] The well state AGS cells were plated at 4.3x10^5 cells per well (6-well plate) (HGC27 cells 2.3x10^5 cells / well)

[0095] 2) siRNA transfection (siRNA is synthesized by Genchem): after adherent culture for 24h, the transfection reagent is mixed according to the following system: A: 200μL opti-MEM+5μL Lipo 2000; B: 200μL opti-MEM+7.5μL siRNA, A system is mixed and stand for 5min; B system is added to A system, mixed and stand for 15min

[0096] 3) Discard the culture medium in the 6-well plate, add 1.6mL of opti-MEM medium per well; add 400μL of the above mixed liquid per well, mix the culture solution, and then place the 6-well plate in a 37℃, 5% CO2 cell incubator for sterile culture.

[0097] 2. CCK8 proliferation experiment:

[0098] 1) After transfection for 24h, the well state AGS cells (or HGC27 cells) were plated at 2000 cells per well (96-well plate), and three identical replicates were plated for each biological repeat, each well containing 100μL of serum-containing medium. Repeat plating five 96-well plates according to the same operation.

[0099] 2) Place the well plate in an incubator overnight, and after the cells adhere, take one 96-well plate to add CCK8-containing serum-containing medium for cell viability measurement. The next day, take another well plate to do the same operation, and so on, to detect the proliferation ability of AGS cells.

[0100] 3) CCK8 detection of cell viability (avoid light treatment): configure the cck8 detection liquid according to the medium: cck8 = 10: 1. The medium in the 96-well plate is sucked out, and 100 μL of the prepared cck8 detection liquid is added. After incubation at 37°C for 2h, the absorbance value of each well at 450nm is measured using an enzyme marker.

[0101] 3. Colony formation experiment:

[0102] 1) After transfection for 24 hours, well-conditioned AGS was digested with trypsin, then resuspended into a cell suspension with complete medium and counted.

[0103] 2) The control group and the interference group cells were inoculated in a 6-well plate, 2000 cells per well.

[0104] 3) Cultured continuously for 10 days or until the number of cells in most single clones was greater than 50, and the medium was changed every 3 days and the cell state was observed.

[0105] 4) After the completion of the clone, the medium in the plate was sucked off, washed once with PBS, and 1 mL of 4% paraformaldehyde was added to each well for 10 min.

[0106] 5) Add 1ml of crystal violet staining solution to each well, and stain for 10min.

[0107] 6) Wash the cells several times with PBS, dry and take pictures.

[0108] Results: Figure 2A The CCK8 proliferation experiment results can prove that after transfection of si-PTBP1, the proliferation ability of gastric cancer cells is significantly inhibited. By Figure 2B The colony formation experiment can prove that after transfection of si-PTBP1, the number and size of gastric cancer cell colonies are significantly inhibited. The above experimental results show that si-PTBP1 can significantly inhibit the proliferation of gastric cancer cells and can play a role in the treatment of gastric cancer.

[0109] Example 3 si-PTBP1 can enhance the sensitivity of gastric cancer cells to iron death inducer RSL3 in vivo and in vitro

[0110] 1. Cell transfection experiment:

[0111] 1) Plating: well-conditioned AGS cells were plated at 4.3x10^5 cells per well (6-well plate) (HGC27 cells 2.3x10^5 cells / well).

[0112] 2) siRNA transfection (siRNA is synthesized by GenScript): after 24h of adherent culture, the transfection reagent is mixed according to the following system: A: 200 μL opti-MEM + 5 μL Lipo 2000; B: 200 μL opti-MEM + 7.5 μL siRNA, the A system is mixed and allowed to stand for 5 min; the B system is added to the A system, mixed and allowed to stand for 15 min;

[0113] 3) Discard the culture medium in the 6-well plate, add 1.6 mL of opti-MEM medium to each well; add 400 μL of the above mixed liquid to each well.

[0114] 4) After mixing the culture solution, place the 6-well plate in a 37°C, 5% CO2 cell incubator for sterile culture.

[0115] 2, si-PTBP1 combined with RSL3 clonal formation experiment:

[0116] 1) After 24h of transfection, well-conditioned AGS cells (HGC27 cells) are digested with trypsin, resuspended in a cell suspension with complete culture medium, and counted.

[0117] 2) First, add complete culture medium containing 4 μM RSL3 and complete culture medium containing DMSO to the six-well plate, respectively, then inoculate the control group and the interference group cells into the 6-well plate at 2000 cells per well. After 17 hours of treatment, replace the original culture medium with ordinary complete culture medium.

[0118] 3) Continue to culture for 10 days or until the number of cells in most single clones is greater than 50, replace the medium every 3 days and observe the cell state.

[0119] 4) After the completion of the clone, the culture medium in the plate is aspirated, washed once with PBS, and 1 mL of 4% paraformaldehyde is added to each well for 10 min of fixation.

[0120] 5) Add 1 ml of crystal violet staining solution to each well, stain for 10 min. 6) Wash the cells several times with PBS, air dry, and take a photo.

[0121] 3, si-PTBP1 combined with RSL3 tumor-bearing experiment:

[0122] 1) Inject 1 × 10 6 Wild-type HGC27 cells, one animal is injected unilaterally.

[0123] 2) When the tumor volume reaches 150 mm 3 , the nude mice are randomly divided into four groups, namely the control group, the interference group, the control drug group and the interference drug group.

[0124] 3) After grouping, the length and width of the subcutaneous tumor of the nude mice were measured and recorded every day. The tumor volume was calculated: Formula: Volume (mm 3 ) = (width 2 × length) / 2.

[0125] 4) Knockdown of PTBP1 expression of HGC27 cells in nude mice: the control group and the control plus drug group were injected with normal saline, and the interference group and the interference plus drug group were injected with cholesterol-modified PTBP1 siRNA (100 μM, 50 μL) intratumorally. From the beginning of recording tumor growth, to the end of the experiment, injection was performed twice a day.

[0126] 5) Configuration of RSL3 intraperitoneal injection solution for nude mice (200 μL / each): RSL stock solution (100 mg / kg): DMSO: PEG300: TWEEN80: ddH2O = 5 μL: 5 μL: 80 μL: 10 μL: 100 μL. From the beginning of recording tumor growth, to the end of the experiment, injection was performed twice a day.

[0127] 6) After the experiment was terminated, the tumor was taken for volume measurement and photo processing.

[0128] Results: Figure 3A The results of the colony formation experiment proved that si-PTBP1 could inhibit the colony formation ability of AGS cells and HGC27 cells, and also proved that interfering with PTBP1 could enhance the sensitivity of AGS cells to RSL3. Figure 3B The tumor volume growth trend graph of nude mice was shown. The tumor proliferation ability of the interference group was significantly lower than that of the control group. At the same time, RSL3 could inhibit the proliferation of the tumor, si-PTBP1 could enhance the sensitivity of gastric cancer cells to RSL3, and improve the treatment effect of RSL3 on gastric cancer cells. Based on the above experimental results, it was proved that si-PTBP1 could play a significant role in the treatment of gastric cancer by enhancing the sensitivity of gastric cancer cells to RSL3 chemotherapy drugs.

[0129] Example 4: si-PTBP1 can enhance the sensitivity of gastric cancer cells to cisplatin treatment

[0130] 1. Cell transfection experiment:

[0131] 1) Plating: well-conditioned AGS cells were plated at 4.3 × 10^5 cells per well (6-well plate) (HGC27 cells 2.3 × 10^5 cells / well).

[0132] 2) siRNA transfection (siRNA is synthesized by Genesil): after 24h of adherent culture, the transfection reagent is mixed according to the following system: A: 200uL opti-MEM+5uL Lipo 2000; B: 200uL opti-MEM+7.5uL siRNA, the A system is mixed and allowed to stand for 5min; the B system is added to the A system, mixed and allowed to stand for 15min;

[0133] 3) Discard the culture medium in the 6-well plate, add 1.6mL of opti-MEM medium to each well; add 400uL of the above mixed liquid to each well.

[0134] 4) After mixing the culture solution, place the 6-well plate in a 37℃, 5% CO2 cell incubator for sterile culture.

[0135] 2, detect the sensitivity of gastric cancer cells to cisplatin:

[0136] 1) After 24h of transfection, well AGS cells are plated at 10000 cells per well (96-well plate) in 100uL serum-containing medium per well. Twenty wells are plated for each biological repeat.

[0137] 2) Place the well plate in an incubator overnight, and after the cells adhere, replace the culture medium in the 96-well plate with complete medium containing cisplatin, set the cisplatin concentration to 0, 20, 30, 40, 50 for each biological repeat, and each concentration has four technical repeats.

[0138] 3) After 18h of cisplatin treatment, cell viability is determined. CCK8 detects cell viability (avoid light treatment): configure cck8 detection liquid according to medium:cck8=10:1. Remove the culture medium from the 96-well plate and add 100uL of the prepared cck8 detection liquid. After incubation at 37℃ for 2h, use the enzyme marker to measure the absorbance value of each well at 450nm.

[0139] Results: Figure 4 The results show that si-PTBP1 makes the sensitivity of gastric cancer cells to cisplatin change at different cisplatin concentrations, and the sensitivity of the interference group to cisplatin is significantly higher than that of the control group, indicating that si-PTBP1 can improve the sensitivity of gastric cancer to cisplatin chemotherapy, thereby exerting a significant therapeutic effect on gastric cancer.

[0140] The above is a preferred embodiment of the present application, it should be noted that for ordinary skilled in the art, without departing from the principles of the present application, can make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. Application of si-PTBP1 in preparation of a drug for inhibiting proliferation of gastric cancer cells, wherein the sequence of the si-PTBP1 is as shown in SEQ ID NO: 1-2.

2. Use according to claim 1, wherein The drug further comprises cisplatin or an iron death inducer RSL3.

3. A pharmaceutical preparation for inhibiting proliferation of gastric cancer cells, comprising the sequence of si-PTBP1 as shown in SEQ ID NO: 1-2.