A miRNA, a method for detecting and regulating the secondary growth rate of mangrove plants, a detection kit and its application

By identifying and using novel-Rst-miR26 miRNA, combined with transcriptome sequencing technology and detection kits, the problem of secondary growth regulation of mangrove plants is solved, the verification and regulation of the growth rate of mangrove plants is realized, and the ecological restoration of mangrove forests is promoted.

CN116004627BActive Publication Date: 2025-08-12GUANGDONG OCEAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211695953.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-28
Publication Date
2025-08-12
Estimated Expiration
2042-12-28

AI Technical Summary

Technical Problem

The lack of miRNA regulation means for the secondary growth of mangrove plants in the prior art, which makes it difficult to effectively solve the problem of mangrove area and habitat degradation.

Method used

By identifying and using novel-Rst-miR26 miRNA, methods and detection kits are developed to detect and regulate the secondary growth of mangrove plants, combined with second-generation and third-generation transcriptome sequencing technologies, the detection and regulation of novel-Rst-miR26 expression is achieved, which in turn affects the secondary growth rate of mangrove plants.

Benefits of technology

It provides a simple and fast method to verify and regulate the secondary growth rate of mangrove plants, improve the growth rate of mangrove plants, and promote the recovery of coastal wetland ecosystems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116004627B_ABST
    Figure CN116004627B_ABST
Patent Text Reader

Abstract

The present invention provides a miRNA, a method for detecting the secondary growth rate of a mangrove plant, a detection kit and its application, and a method for regulating the secondary growth rate of a mangrove plant. The mangrove plant is R. mangrove, the miRNA is novel-Rst-miR26, the nucleotide sequence of its precursor structure is shown in SEQ ID NO.1, and the mature region sequence is bases 71-91 of the precursor sequence. The present invention utilizes a fast-slow plant growth model of R. mangrove, combined with second- and third-generation transcriptome sequencing technologies and miRNA-mRNA combined analysis, to identify novel-Rst-miR26, a miRNA that affects the secondary growth of mangrove plants. Based on novel-Rst-miR26, a kit is developed that can rapidly detect its expression level in secondary xylem, thereby determining the speed of secondary growth of mangrove plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular genetics, and in particular relates to a miRNA, a method for detecting and regulating the secondary growth rate of mangrove plants, a detection kit and applications thereof. Background Art

[0002] Mangroves, the only woody plant species in today's coastal wetland ecosystems, play a vital role in purifying seawater, preventing wind and waves, and controlling coastal erosion. However, mangroves continue to be directly and indirectly damaged by human activities, resulting in a sharp decline in their area. Although positive progress has been made in mangrove conservation and restoration in recent years, problems such as a relatively small overall area and habitat degradation remain prominent. Tree growth and development involve primary growth (longitudinal extension) and secondary growth (radial thickening). Secondary growth is the process of continuous formation and expansion of secondary xylem cells. Elucidating the molecular genetic mechanisms of secondary growth in mangroves and increasing the supply of mangrove germplasm resources through the further breeding of new fast-growing mangrove varieties are of great practical significance for the restoration of mangrove wetland ecosystems.

[0003] miRNAs are a class of endogenous, small, non-coding RNA molecules approximately 21 nt in length that negatively regulate gene expression by binding to target mRNA molecules through complementary base pairing. Studies have shown that miRNAs play important regulatory roles in various biological processes, including individual growth and development, cell division and differentiation, and stress responses. In particular, related studies have confirmed that miRNAs are also crucial regulators of secondary growth in trees. For example, overexpression of Ptr-miR397a in poplar trees downregulates the expression of its target laccase gene, leading to impaired lignin synthesis. With the recent advancement of genome sequencing technology, RNA sequencing has been widely used to identify and characterize key miRNAs associated with important traits. In particular, the advent of third-generation sequencing technology has provided an effective means for identifying and exploring the functions of genes important for growth processes in species with incomplete genomic information. Rhizophora mangrove, a member of the Rhizophora family, is an evergreen shrub or small tree, growing 7 to 8 meters tall. It grows in tropical and subtropical coastal wetlands, primarily in Guangxi, Hong Kong, Guangdong, and Hainan. It is a promising species for coastal mangrove restoration. However, research on the miRNAs that regulate the secondary growth of Rhizophora mangrove has been limited. Summary of the Invention

[0004] In response to the above-mentioned technical problems, the present invention provides a miRNA, a method for detecting the secondary growth rate of mangrove plants, a detection kit and its application, and a method for regulating the secondary growth rate of mangrove plants. It was found that novel-Rst-miR26 shown in SEQ ID NO.1 is related to the secondary growth rate of mangrove plants. It can be used to develop auxiliary selection markers for secondary growth or to increase the secondary growth rate of mangrove plants. It can also be used to prepare a detection kit for verifying the speed of secondary growth of mangrove plants.

[0005] On the one hand, the present invention provides a miRNA related to the secondary growth of a mangrove plant, wherein the mangrove plant is Rhizophora mangrove, and the miRNA is novel-Rst-miR26. The nucleotide sequence of its precursor structure is shown in SEQ ID NO.1, and the mature region sequence is bases 71-91 of the precursor sequence.

[0006] On the other hand, the present invention provides a method for detecting the secondary growth rate of mangrove plants, which method includes detecting the expression level of the miRNA shown in SEQ ID NO.1 in the secondary xylem of the mangrove plant, and the expression level of the miRNA shown in SEQ ID NO.1 is negatively correlated with the secondary growth rate of the mangrove plant, so as to verify the speed of the secondary growth rate of the mangrove plant.

[0007] Furthermore, the expression level of the miRNA shown in SEQ ID NO. 1 in the secondary xylem of the mangrove plant was detected by Stem-loop real-time fluorescence quantitative PCR.

[0008] In another aspect, the present invention provides a detection kit, comprising a detection reagent for detecting the expression level of novel-Rst-miR26 as shown in SEQ ID NO.1.

[0009] Furthermore, the detection kit includes the novel-Rst-miR26 stem-loop reverse transcription primer as shown in SEQ ID NO.2, reverse transcription amplification buffer, PrimeScript RT Enzyme Mix I, and reverse transcription PCR amplification reagent consisting of RNAase-free water.

[0010] Furthermore, the detection kit also includes a novel-Rst-miR26 forward amplification primer as shown in SEQ ID NO.3, a universal reverse primer as shown in SEQ ID NO.4, a real-time fluorescence quantitative PCR amplification primer for the internal reference U6 as shown in SEQ ID NO.5 and SEQ ID NO.6, and a template cDNA, SYBR Premix Ex Taq II (Tli RNaseHPlus) (2×) and double-distilled water.

[0011] In another aspect, the present invention provides use of the above-mentioned detection kit in verifying the growth rate of mangrove plants.

[0012] Furthermore, mangrove plant RNA was extracted and the expression level of the miRNA shown in SEQ ID NO.1 was detected using a detection kit. The reaction program of real-time fluorescence quantitative PCR was set as: pre-denaturation at 95°C for 30s; 95°C / 5s→60°C / 30s, for a total of 40 cycles.

[0013] In another aspect, the present invention provides a method for regulating the secondary growth rate of mangrove plants, comprising increasing or decreasing the expression level of novel-Rst-miR26 in the mangrove plants.

[0014] Based on the fast-slow plant growth model of R. mangrove, this study combined second-generation RNA and third-generation full-length transcriptome sequencing technologies with related bioinformatics tools to identify, for the first time, a miRNA that influences secondary growth in mangrove plants, namely novel-Rst-miR26. This miRNA can be used to study miRNA-mediated regulation of secondary growth in mangrove plants and develop auxiliary selection markers for secondary growth traits in mangrove plants. Furthermore, a simple and rapid detection kit based on this miRNA was developed to determine the expression level of novel-Rst-miR26 in the secondary xylem of mangrove plants, thereby verifying the speed of their secondary growth. The present invention can also utilize the regulation of novel-Rst-miR26 expression to control the speed of secondary growth in mangrove plants, thereby increasing their growth rate in actual coastal wetland ecological development. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0016] Figure 1 The results of RNA-seq and qRT-PCR validation of novel-Rst-miR26 expression levels in fast-growing and slow-growing red mangroves. DETAILED DESCRIPTION

[0017] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the accompanying drawings. Obviously, the description is only a part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0018] One embodiment of the present invention provides a miRNA related to the secondary growth of a mangrove plant, wherein the mangrove plant is Rhizophora mangrove, and the miRNA is novel-Rst-miR26. The nucleotide sequence of its precursor structure is shown in SEQ ID NO.1, and the mature region sequence is bases 71-91 of the precursor sequence.

[0019] Specifically, the sequence SEQ ID NO.1 is as follows:

[0020] acucauaucu cuaguuuguu cguggaucug accccaucac accguucaug ucacuaccau

[0021] ccaauggcgu uagauucacg cacaaacucg cgaucuguc

[0022] Another embodiment of the present invention provides a method for detecting the secondary growth rate of mangrove plants, which method includes detecting the expression level of the miRNA shown in SEQ ID NO.1 in the secondary xylem of the mangrove plant. The expression level of the miRNA shown in SEQ ID NO.1 is negatively correlated with the secondary growth rate of the mangrove plant, so as to verify the speed of the secondary growth rate of the mangrove plant.

[0023] In some embodiments, the expression level of the miRNA shown in SEQ ID NO. 1 in the secondary xylem of mangrove plants is detected by Stem-loop real-time fluorescence quantitative PCR.

[0024] Another embodiment of the present invention provides a detection kit, which includes a detection reagent for detecting the expression level of novel-Rst-miR26 as shown in SEQ ID NO.1.

[0025] In some embodiments, the detection kit includes a novel-Rst-miR26 stem-loop reverse transcription primer as shown in SEQ ID NO.2, a reverse transcription amplification buffer, PrimeScript RT Enzyme Mix I, and a reverse transcription PCR amplification reagent consisting of RNAase-free water.

[0026] In some embodiments, the detection kit further comprises a novel-Rst-miR26 forward amplification primer as shown in SEQ ID NO.3, a universal reverse primer as shown in SEQ ID NO.4, a real-time fluorescence quantitative PCR amplification primer for the internal reference U6 as shown in SEQ ID NO.5 and SEQ ID NO.6, and a template cDNA, SYBR Premix Ex Taq II (TliRNaseH Plus) (2×) and double-distilled water.

[0027] Specifically, the sequences SEQ ID NO.2-SEQ ID NO.6 are shown below:

[0028]

[0029]

[0030] Another embodiment of the present invention provides the use of the above-mentioned detection kit in verifying the growth rate of mangrove plants.

[0031] In some embodiments, mangrove plant RNA is extracted, and the expression level of the miRNA shown in SEQ ID NO.1 is detected using a detection kit, and the reaction program of real-time fluorescence quantitative PCR is set to: pre-denaturation at 95°C for 30s; 95°C / 5s→60°C / 30s, for a total of 40 cycles.

[0032] Another embodiment of the present invention provides a method for regulating the secondary growth rate of a mangrove plant, the method comprising increasing or decreasing the expression level of novel-Rst-miR26 in the mangrove plant.

[0033] Based on the fast-slow plant growth model of R. mangrove, this study combined second-generation RNA and third-generation full-length transcriptome sequencing technologies with related bioinformatics tools to identify, for the first time, a miRNA that influences secondary growth in mangrove plants, namely novel-Rst-miR26. This miRNA can be used to study miRNA-mediated regulation of secondary growth in mangrove plants and develop auxiliary selection markers for secondary growth traits in mangrove plants. Furthermore, a simple and rapid detection kit based on this miRNA was developed to determine the expression level of novel-Rst-miR26 in the secondary xylem of mangrove plants, thereby verifying the speed of their secondary growth. The present invention can also utilize the regulation of novel-Rst-miR26 expression to control the speed of secondary growth in mangrove plants, thereby increasing their growth rate in actual coastal wetland ecological development.

[0034] The present invention will be further described below by means of specific examples:

[0035] 1. Sample Collection and Sequencing

[0036] Sequencing samples were collected from the Techeng Island Mangrove Nature Reserve in Zhanjiang City, Guangdong Province. Mature R. mangrove hypocotyls were collected and inserted into seedling bags filled with nutrient soil. Three years later, three plants each of the fast-growing and slow-growing R. mangroves with consistent growth were selected. Secondary xylem tissue was collected and snap-frozen in liquid nitrogen. RNA was extracted and, after quality inspection, a third-generation PacBio sequencing library and a sRNA sequencing library were constructed, sequenced, and analyzed. The sRNA analysis used a full-length transcriptome gene set from R. mangroves obtained using PacBio single-molecule real-time sequencing technology (SMRT). Sequencing was performed by Shenzhen BGI Genomics Co., Ltd. The relevant traits measured for the collected individuals are shown in Table 1.

[0037] Table 1 Growth indicators of fast and slow Rhizophora mangrove plants

[0038]

[0039] 2. Screening of differentially expressed miRNAs and prediction of target genes

[0040] After quality control of the sRNA results, the miRNA expression data of the fast and slow plant groups were compared. Differentially expressed miRNAs were screened using the criteria of |log2FC| ≥ 3, significance level P < 0.001, and Q < 0.01. A total of 17 differentially expressed miRNAs were obtained, including 10 conserved miRNAs and 7 newly discovered miRNAs. The psRNATarget method was further used to predict the target genes of the differentially expressed miRNAs. KEGG metabolic pathway enrichment analysis of the obtained miRNA target genes showed that among the top 20 most significantly enriched metabolic pathways, the novel-Rst-miR26 target gene was located in multiple important pathways. The specific enriched pathways are shown in Table 2:

[0041] Table 2 Pathways with significant enrichment of novel-Rst-miR26 target genes

[0042]

[0043] 3. Construction of differential miRNA and target gene regulatory network

[0044] Using Cytoscape software, a regulatory network was constructed for the differentially expressed miRNAs and their target genes, revealing that four miRNAs, including novel-Rst-miR26, were at the core of the network. Further analysis using the Cytohubba plug-in within Cytoscape and the Matthews correlation coefficient (MCC) method identified hub genes within the target genes. Fifteen of the top 20 hub genes were found to be regulated by novel-Rst-miR26.

[0045] Table 3 15 key target genes of novel-Rst-miR26

[0046]

[0047]

[0048] 4. qRT-PCR Verification of Novel-Rst-miR26 Expression Level

[0049] Total RNA was extracted from the secondary xylem tissues of fast and slow red mangrove plants. Stem-loop real-time fluorescence quantitative PCR kit was used to obtain cDNA through reverse transcription amplification. The expression level of novel-Rst-miR26 was determined according to the conventional reaction system and amplification procedure.

[0050] The kit consists of a reverse transcription PCR amplification reagent consisting of a stem-loop reverse transcription primer (stem-loop RTprimer) of novel-Rst-miR26, a reverse transcription amplification buffer (5× PrimeScript Buffer), PrimeScript RT Enzyme Mix I and RNAase-free water, and a forward amplification primer consisting of novel-Rst-miR26, a primer pair of internal reference U6, a template cDNA, SYBR Real-time fluorescence quantitative PCR amplification reagent consisting of Premix Ex Taq II (Tli RNaseH Plus) (2×), universal reverse primer and double distilled water. The stem-loop reverse transcription primer of novel-Rst-miR26 and the forward amplification primer of novel-Rst-miR26 were designed based on the nucleotide sequence SEQ ID NO.1 of novel-Rst-miR26 obtained by sRNA analysis by Shenzhen BGI Gene Technology Co., Ltd., and their base sequence is shown in SEQ ID NO.2 and SEQ ID NO.3 (Table 4). The base sequence of the reverse universal primer for the quantitative PCR reaction of novel-Rst-miR26 is SEQ ID NO.4. The base sequences of the quantitative primers of the internal reference U6 are SEQ ID NO.5 and SEQ ID NO.6 (Table 4). 5× PrimeScript Buffer, PrimeScript RT Enzyme Mix I, SYBR Premix Ex Taq II (Tli RNaseH Plus) (2×), universal reverse primer, and RNAase-free water were all from the reverse transcription kit and real-time fluorescence quantitative PCR kit of Anolun (Beijing) Biotechnology Co., Ltd.

[0051] SEQ ID NO.1

[0052] acucauaucu cuaguuuguu cguggaucug accccaucac accguucaugucacuaccauccaauggcgu uagauucacg cacaaacucg cgaucuguc

[0053] Table 4 Primer sequences

[0054]

[0055] Fluorescence quantitative reaction system is 20μl: SYBR Premix Ex Taq II (Tli RNaseH Plus) (2×) 10.0 μl; specific primer 0.4 μl; universal reverse primer 0.4 μl; template cDNA 2.0 μl; ddH2O 7.2 μl. The real-time fluorescence quantitative PCR reaction program was as follows: initial denaturation at 94°C for 3 min; 94°C for 20 s → 60°C for 40 s, for a total of 40 cycles; melting curves were drawn between 60°C and 95°C.

[0056] Using U6 as internal reference, using 2 -ΔΔCTMethods The relative expression levels of novel-Rst-miR26 in the secondary xylem tissues of fast-growing and slow-growing individuals of Rhizophora mangrove were analyzed. Figure 1 As shown in Figure 2, the expression level of novel-Rst-miR26 in slow-type red mangrove plants is about 6 times that of fast-type individuals. The expression levels obtained by qRT-PCR were compared with the sRNA sequencing results, showing that the expression differences of novel-Rst-miR26 obtained by the two methods were consistent, and the expression correlation coefficient R 2 =0.86(P<0.01).

[0057] The above is a further detailed description of the present invention in conjunction with specific preferred embodiments, and the specific implementation of the present invention should not be considered to be limited to these descriptions. For those skilled in the art of the present invention, without departing from the concept of the present invention, several simple deductions or substitutions can be made, which should be considered to fall within the scope of protection of the present invention.

Claims

1. The use of a detection kit in verifying the growth rate of a mangrove plant, characterized in that: The detection kit includes a detection reagent for detecting the expression amount of novel-Rst-miR26 as shown in SEQ ID NO.1, and the mangrove plant is Rhizophora mangrovea.

2. The use according to claim 1, characterized in that: The detection kit includes a novel-Rst-miR26 stem-loop reverse transcription primer as shown in SEQ ID NO.2, a reverse transcription amplification buffer, PrimeScriptRT Enzyme MixI, and a reverse transcription PCR amplification reagent consisting of RNAase-free water.

3. The use according to claim 2, characterized in that: The detection kit also includes a novel-Rst-miR26 forward amplification primer as shown in SEQ ID NO.3, a reverse universal primer as shown in SEQ ID NO.4, real-time fluorescence quantitative PCR amplification primers for the internal reference U6 as shown in SEQ ID NO.5 and SEQ ID NO.6, as well as template cDNA, SYBR Premix Ex Taq II (Tli RNaseH Plus) (2×) and double-distilled water.

4. The use according to claim 1, characterized in that: RNA was extracted from mangrove plants, and the expression level of miRNA shown in SEQ ID NO.1 was detected using a detection kit. The reaction program of real-time fluorescence quantitative PCR was set as follows: pre-denaturation at 95°C for 30 s; 95°C / 5 s→60°C / 30 s, for a total of 40 cycles.