A sea snake antimicrobial peptide Hydrostatin-AMP3 and its encoding gene and application

The antimicrobial peptide Hydrostatin-AMP3 from the sea snake Hydrostatin-AMP3 and its encoding gene have solved the problem of treating drug-resistant Klebsiella pneumoniae, providing a new generation of antimicrobial drugs with strong antibacterial effects and not easy to develop drug resistance, which is suitable for the preparation of anti-infective drugs.

CN116041468BActive Publication Date: 2025-09-30SHANGHAI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310072588.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-07
Publication Date
2025-09-30
Estimated Expiration
2043-02-07

AI Technical Summary

Technical Problem

With the widespread use of antibiotics, pan-drug-resistant Klebsiella pneumoniae has increased, the resistance rate of existing antibiotics such as meropenem has increased, there is a lack of new generation antibiotic alternatives, traditional antibiotics are prone to drug resistance, and new antibacterial drugs are urgently needed.

Method used

The present invention provides the antimicrobial peptide Hydrostatin-AMP3 from the sea snake Hymenoptera cyanobacteria and its encoding gene, which were obtained through genome sequencing and gene annotation. Hydrostatin-AMP3 is a small molecular weight, basic amino acid-rich antimicrobial peptide with strong bactericidal effects, effective against drug-resistant bacteria, simple structure, and easy preparation.

Benefits of technology

Hydrostatin-AMP3 effectively inhibits bacterial proliferation in vitro, especially drug-resistant Klebsiella pneumoniae. It has broad-spectrum antibacterial activity, is not prone to drug resistance on cell membranes, has low toxicity, and is suitable for the preparation of anti-infective drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004065153860000051
    Figure BDA0004065153860000051
  • Figure BDA0004065153860000061
    Figure BDA0004065153860000061
  • Figure BDA0004065153860000111
    Figure BDA0004065153860000111
Patent Text Reader

Abstract

The present invention relates to the field of biomedicine, and specifically provides a sea snake antimicrobial peptide Hydrostatin-AMP3, its encoding gene, and application. The sea snake antimicrobial peptide Hydrostatin-AMP3 is a protein having an amino acid sequence as shown in SEQ ID No: 1; or, a protein derived from SEQ ID NO: 1, in which the amino acid sequence of SEQ ID NO: 1 is substituted, deleted, and / or one or more amino acid residues are added, and is related to the sea snake antimicrobial peptide Hydrostatin-AMP3. The present invention studies the activity of the sea snake antimicrobial peptide Hydrostatin-AMP3 and finds that it can effectively inhibit bacterial proliferation in vitro, especially for clinically isolated drug-resistant Klebsiella pneumoniae strains. The inhibitory effect is better than meropenem, and it has great clinical application prospects in the field of anti-infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, in particular to an antimicrobial peptide Hydrostatin-AMP3 from a sea snake, its encoding gene and application. Background Art

[0002] Klebsiella pneumoniae is a clinically important opportunistic pathogen that can cause a variety of infections, including pneumonia, meningitis, endophthalmitis, liver abscesses, and sepsis. With the widespread and extensive use of antibiotics in clinical practice, the incidence of pan-drug-resistant Klebsiella pneumoniae is increasing, increasing the risk of drug failure. The carbapenem drug meropenem is the last line of defense in the fight against infection, but the rate of resistance to meropenem in Klebsiella pneumoniae has been steadily increasing over the past decade. Furthermore, the lack of new antibiotics worldwide in many years and the impending extinction of available drugs necessitate a new generation of alternatives.

[0003] Antimicrobial peptides are considered the most promising alternative to antibiotics. Antimicrobial peptides are a class of naturally occurring polypeptides that exert antimicrobial activity within the innate immune system. They typically have a molecular weight less than 10,000 daltons and are rich in basic amino acid residues. They adhere to negatively charged bacterial cell membranes through electrostatic interactions. When these peptides reach a certain concentration, they form pores, leading to bacterial death. Traditional antibiotics typically target the expression of a specific intracellular protein or enzyme in a metabolic pathway. Mutations in these bacterial proteins render the antibiotic ineffective, leading to antibiotic-resistant bacteria. Antimicrobial peptides, however, adhere directly to bacterial cell membranes through electrostatic interactions. Because this property is difficult to alter, bacteria are less likely to develop resistance. Cathelicidins, a family of antimicrobial peptides found only in vertebrates, exhibit broad antibacterial activity against Gram-negative and Gram-positive bacteria, as well as fungi. Furthermore, cathelicidins possess immunomodulatory activity, acting as immune regulators in vivo, making them a hot topic of international research. Currently, several antimicrobial peptide drugs are in clinical trials in China. Cathelicidins-BF, an antimicrobial peptide effervescent tablet derived from the Bungarus bungarus, can be used to treat bacterial vaginosis and has entered Phase I clinical trials. PL-5 spray, which has shown significant efficacy for diabetic foot, has entered Phase III clinical trials and is expected to become China's first antimicrobial peptide drug.

[0004] The present inventors obtained an antimicrobial peptide Hydrostatin-AMP3 from the cathelicidins family by sequencing the genome and annotating the genes of the sea snake Elaphe cyanobacteria. Summary of the Invention

[0005] The present invention aims to provide an antimicrobial peptide Hydrostatin-AMP3 from Sea Snake and its encoding gene, as well as the use of the antimicrobial peptide Hydrostatin-AMP3 from Sea Snake in the preparation of anti-infective drugs.

[0006] The Hydrostatin-AMP3 of the present invention has a small molecular weight, a strong bactericidal effect, strong salt stability and heat resistance, and good activity against drug-resistant bacteria, and is expected to become a new generation of anti-infection drugs.

[0007] The present invention studies the activity of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake Aeolus cyanobacteria and discovers the inhibitory activity of Hydrostatin-AMP3 against bacteria. The antimicrobial peptide can effectively inhibit bacterial proliferation in vitro, and its inhibitory effect on clinically isolated drug-resistant Klebsiella pneumoniae strains is better than meropenem, showing great clinical application prospects in the field of anti-infection.

[0008] The first aspect of the present invention provides a hydrostatin-AMP3 antimicrobial peptide from the sea snake. The hydrostatin-AMP3 antimicrobial peptide from the sea snake has the following protein (a) or (b) or (c) or (d):

[0009] (a) a protein consisting of the amino acid sequence shown in SEQ ID No: 1;

[0010] (b) a sequence derived from the amino acid sequence of SEQ ID NO: 1 by substitution, deletion and / or addition of one or more amino acid residues, which has the same activity as SEQ ID NO: 1;

[0011] (c) Sequences derived from the amino acid sequence in SEQ ID NO: 1 by adding 1-10 amino acid residues to the N-terminus or C-terminus, which have the same activity as SEQ ID NO: 1;

[0012] (d) Modifying the amino acid sequence in SEQ ID NO: 1 by connecting polyethylene glycol at the N-terminus or C-terminus to produce a sequence having the same activity as SEQ ID NO: 1.

[0013] The second aspect of the present invention provides a gene encoding the antimicrobial peptide Hydrostatin-AMP3 from the sea snake, which is a DNA molecule of the following (i) or (ii):

[0014] (i) a DNA molecule as shown in SEQ ID NO: 2;

[0015] (ii) A DNA molecule that hybridizes with the DNA sequence defined in (i) under stringent conditions and encodes the antimicrobial peptide Hydrostatin-AMP3.

[0016] Furthermore, the antimicrobial peptide Hydrostatin-AMP3 of the sea snake has an amino acid sequence as shown in SEQ ID NO: 1, is a linear straight-chain polypeptide, has a molecular weight of 3249.21 Daltons, and an isoelectric point of 12.48.

[0017] The third aspect of the present invention provides the use of the above-mentioned sea snake antimicrobial peptide Hydrostatin-AMP3 or its encoding gene in the preparation of antimicrobial infection drugs.

[0018] Furthermore, the antimicrobial infection drug has an inhibitory or killing effect on various microorganisms such as Escherichia coli, Staphylococcus aureus, Propionibacterium acnes, and Klebsiella pneumoniae.

[0019] The present invention also provides an antimicrobial infection drug, which uses the antimicrobial peptide Hydrostatin-AMP3 from the sea snake as the only active ingredient, or is a pharmaceutical composition containing the antimicrobial peptide Hydrostatin-AMP3 from the sea snake.

[0020] Furthermore, the drug is prepared into a pharmaceutical preparation with conventional pharmaceutical excipients in pharmacy.

[0021] Furthermore, the pharmaceutical preparation is in the form of tablets, granules, dispersants, capsules, pills, injections, powder injections or aerosols.

[0022] The present invention uses the AlphaFold server to perform structural and property analysis on the antimicrobial peptide Hydrostatin-AMP3 of the sea snake, and finds that it has amphipathic and α-helical structures, which are similar to the mature peptide structures of the cathelicidin antimicrobial peptide family; at the same time, the DBAASP server is used to predict the antimicrobial spectrum of the sea snake antimicrobial peptide Hydrostatin-AMP3, and the results show that it has inhibitory activity against both Gram-negative and Gram-positive bacteria. The minimum inhibitory concentration (MIC) of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake (Hydrostatin-AMP3) against common bacterial strains was determined by broth microdilution, demonstrating its strong antimicrobial activity. Crystal violet staining was used to analyze its biofilm-clearing and inhibitory effects, demonstrating that Hydrostatin-AMP3 not only inhibits biofilm formation but also significantly eradicates established mature biofilms. Scanning electron microscopy was then used to analyze the surface morphology of Klebsiella pneumoniae before and after treatment with Hydrostatin-AMP3, suggesting that its effect may be through affecting the bacterial cell membrane. Furthermore, co-incubation of mouse fibroblast L929 cells with Hydrostatin-AMP3 revealed minimal cytotoxicity. Therefore, Hydrostatin-AMP3 could be used as an active ingredient in the development of antimicrobial drugs.

[0023] The present invention uses bioinformatics analysis tools to obtain the amino acid sequence encoding the antimicrobial peptide Hydrostatin-AMP3 from the sea snake. The peptide is synthesized using a peptide synthesizer, resulting in a simple structure and ease of preparation. Hydrostatin-AMP3 has a small molecular weight, low toxicity, and broad-spectrum antimicrobial activity.

[0024] Hydrostatin-AMP3 has a significant inhibitory effect on Klebsiella pneumoniae, which is better than meropenem, and has the potential to be used as an anti-infection drug candidate. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the predicted structure of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake.

[0026] Figure 2 This is the chromatographic analysis result of Hydrostatin-AMP3;

[0027] Figure 3 This is the mass spectrometry analysis result of Hydrostatin-AMP3;

[0028] Figure 4is the biofilm inhibitory effect of different concentrations of Hydrostatin-AMP3 on drug-resistant Klebsiella pneumoniae 48;

[0029] Figure 5 is the biofilm clearance effect of different concentrations of Hydrostatin-AMP3 on drug-resistant Klebsiella pneumoniae 48; Figure 6 Scanning electron microscopy shows the surface changes of drug-resistant Klebsiella pneumoniae 48 before and after treatment with Hydrostatin-AMP3;

[0030] Figure 7 The minimum inhibitory concentration of Hydrostatin-AMP3 against Escherichia coli changes under different concentrations of sodium chloride;

[0031] Figure 8 The minimum inhibitory concentration of Hydrostatin-AMP3 against Escherichia coli changes under different temperature conditions;

[0032] Figure 9 is the effect of different concentrations of Hydrostatin-AMP3 on the survival rate of L929 cells;

[0033] Figure 10 is the hemolysis rate of different concentrations of Hydrostatin-AMP3. DETAILED DESCRIPTION

[0034] The present invention will be described in detail below with reference to specific embodiments. The following examples will help those skilled in the art further understand the present invention, but the following examples should not be construed as limiting the present invention. It should be noted that those skilled in the art may make various adjustments and improvements without departing from the scope of the present invention. These modifications and improvements fall within the scope of protection of the present invention.

[0035] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0036] The experiments of Examples 4 to 10 were carried out using the Hydrostatin-AMP3 prepared in Example 3. The Hydrostatin-AMP3 used in the following examples was synthesized by Beijing Zhongke Yaguang Biotechnology Co., Ltd. and its purity was ≥95% as determined by HPLC.

[0037] Example 1: Structure of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake

[0038] The 3D structure of Hydrostatin-AMP3 was simulated using the AlphaFold server, as shown in Figure 1As shown, Hydrostatin-AMP3 is mainly composed of an α-helical structure with a random coil segment at one end. Analysis of its constituent amino acids shows that the antimicrobial peptide is amphiphilic, which is consistent with the basic properties and structure of known cationic antimicrobial peptides and is speculated to have antimicrobial activity.

[0039] Example 2: Prediction of the antimicrobial spectrum of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake

[0040] The antimicrobial spectrum of hydrostatin-AMP3 was predicted using the DBAASP online server. A positive number indicates activity, while a negative number indicates inactivity. A "positive" number against human red blood cells indicates no hemolytic activity. As shown in Table 1, the antimicrobial spectrum of hydrostatin-AMP3 includes activity against both Gram-positive and Gram-negative bacteria, specifically Escherichia coli, Staphylococcus aureus, and Klebsiella pneumoniae, while it is inactive against human red blood cells and fungi. These results suggest that hydrostatin-AMP3 may have inhibitory activity against both Gram-positive and Gram-negative bacteria and is non-hemolytic.

[0041] Table 1

[0042]

[0043] Example 3: Synthesis of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake

[0044] The antimicrobial peptide Hydrostatin-AMP3 from sea snake was synthesized by Fmoc solid phase method and analyzed by Varian ProStar 218 high performance liquid chromatography ( Figure 2 ) and Voyager-DE STR mass spectrometry ( Figure 3 ) was analyzed for purity and molecular weight. The results showed that the purity was >95% and the molecular weight was 3249.21 g / mol.

[0045] The amino acid sequence of the antimicrobial peptide Hydrostatin-AMP3 of the present invention is shown in SEQ ID No: 1. The gene sequence is shown in SEQ ID No: 2.

[0046] Hydrostatin-AMP3:RITRHRWKRAVRKVGRFVRRYGPLIA(SEQ ID NO:1)

[0047] Gene sequence:

[0048] CGGATCACCAGACATCGCTGGAAAAGAGCTGTGAGGAAAGTAGGCCGTTTCGTGAGGCGATATGGGCCGCTCATCGCC (SEQ ID NO: 2)

[0049] Example 4: Minimal Inhibitory Concentration (MIC) of Hydrostatin-AMP3

[0050] The test strains, Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes, were purchased from Shanghai Fuxiang Biotechnology. A clinical isolate of Klebsiella pneumoniae was kindly provided by Shanghai Tenth People's Hospital. Minimum inhibitory concentrations (MICs) were determined using the two-fold broth microdilution method.

[0051] The specific experimental steps were as follows: the test strain was inoculated into MH broth medium (purchased from Qingdao Haibo Biological), cultured at 37°C with shaking until the logarithmic growth phase, and then the bacterial culture solution cultured to the logarithmic growth phase was diluted to 1×10 6 cfu / ml for later use. Hydrostatin-AMP3 solution, ampicillin solution, and meropenem solution were prepared using MH broth at concentrations of 1 μg / ml, 2 μg / ml, 4 μg / ml, 8 μg / ml, 16 μg / ml, 32 μg / ml, 64 μg / ml, and 128 μg / ml, respectively. 100 μl of hydrostatin-AMP3 solution, ampicillin solution, or meropenem solution was added to each well of a sterile 96-well plate, followed by 100 μl of the reserved bacterial dilution solution. The plates were incubated at 37°C for 16-20 hours. The absorbance of the solution at a wavelength of 600 nm was measured using an enzyme-linked immunosorbent assay (ELISA). As shown in Table 2, hydrostatin-AMP3 exhibited antibacterial activity against both gram-positive and gram-negative bacteria, and the inhibitory concentration of hydrostatin-AMP3 against K. pneumoniae was lower than that of ampicillin and meropenem. The above results indicate that Hydrostatin-AMP3 has significant antibacterial effect.

[0052] Table 2

[0053]

[0054] Example 5: Biofilm Inhibitory Activity of Hydrostatin-AMP3 from Sea Snake against Drug-Resistant Klebsiella Pneumoniae 48

[0055] The test strain was inoculated into MH broth medium and cultured at 37℃ with shaking until the logarithmic growth phase. It was then diluted to 1×10 6cfu / ml for later use. Serial dilutions of hydrostatin-AMP3 were prepared using MH broth at concentrations of 0.5-fold, 1-fold, 2-fold, 4-fold, and 8-fold the minimum inhibitory concentration (MIC). 100 μl of the hydrostatin-AMP3 solution was added to each well of a 96-well plate, along with 100 μl of the bacterial dilution. A blank control was added with 100 μl of the bacterial dilution and 100 μl of MH broth. The plates were incubated at 37°C for 24 hours. The plates were rinsed three times with sterile PBS to remove floating bacteria. The plates were fixed with methanol for 20 minutes. The methanol was removed and the plates were air-dried aseptically. 100 μl of a 1% crystal violet solution in PBS was added and stained for 30 minutes. The crystal violet was removed and the plates were rinsed three times with sterile deionized water. The biofilm formed on the bottom of the wells was dissolved by adding 100 μl of anhydrous ethanol. The absorbance of the solution at 600 nm was measured using an enzyme-linked immunosorbent assay (ELISA) to semi-quantitatively estimate the amount of biofilm formed.

[0056] See the results Figure 4 After the interaction of Hydrostatin-AMP3 with bacteria, the amount of biofilm formed was significantly lower than that in the blank control group, and the inhibitory effect was concentration-dependent. These results indicate that Hydrostatin-AMP3 can significantly inhibit the formation of biofilms of drug-resistant Klebsiella pneumoniae.

[0057] Example 6: Biofilm Clearing Activity of Hydrostatin-AMP3, an Antimicrobial Peptide from Sea Snake

[0058] The test strain was inoculated into MH broth medium and cultured at 37℃ with shaking until the logarithmic growth phase. It was then diluted to 1×10 6 cfu / ml. Add 100 μl of bacterial dilution to each well of a 96-well plate and incubate at 37°C for 24 hours. Rinse three times with sterile PBS and add 100 μl of serial dilutions of hydrostatin-AMP3 in MH broth at concentrations of 0.5, 1, 2, 4, and 8 times the minimum inhibitory concentration (MIC). Add an equal volume of MH broth to the blank control wells. Incubate at 37°C for 24 hours and rinse three times with sterile PBS. Fix with methanol for 20 minutes. Remove the methanol and air-dry aseptically. Add 100 μl of 1% crystal violet solution prepared in PBS and stain for 30 minutes. Remove the crystal violet and rinse three times with sterile deionized water. Add 100 μl of anhydrous ethanol and use an enzyme-linked immunosorbent assay (ELISA) to detect the absorbance of the solution at a wavelength of 600 nm to semi-quantitatively estimate the remaining amount of biofilm.

[0059] See the results Figure 5Hydrostatin-AMP3 significantly reduced the amount of mature biofilm remaining, which was significantly different from the blank control group. These results indicate that Hydrostatin-AMP3 can significantly eradicate mature biofilms of drug-resistant Klebsiella pneumoniae.

[0060] Example 7: Changes in bacterial surface morphology before and after the action of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake

[0061] The test strain was inoculated into MH broth medium and cultured at 37℃ with shaking until the logarithmic growth phase. The culture volume was adjusted to 1×10 8 cfu / ml, set aside. Use sterile PBS to prepare a Hydrostatin-AMP3 solution with a concentration of 4 times the minimum inhibitory concentration value, set aside. Add 1ml of bacterial dilution to a 1.5ml centrifuge tube, centrifuge at 3000rpm for 5 minutes, aspirate and discard the supernatant, wash once with sterile PBS, add 500μl of the above-prepared Hydrostatin-AMP3 solution, and add an equal amount of PBS to the control group. Incubate at 37°C for 30 minutes, centrifuge at 3000rpm for 5 minutes, aspirate and discard the supernatant, slowly add pre-cooled fixative 2.5% (v / v) glutaraldehyde along the wall of the tube, and fix at 4°C for 24 hours. Aspirate and discard the glutaraldehyde, rinse the sample 3 times with 0.1M, pH7.0 phosphate buffer, each time for 15 minutes. Fix the sample with 1% osmium hydroxide solution for 2 hours. Carefully remove the osmium hydroxide solution and rinse the sample three times with 0.1M phosphate buffer (pH 7.0) for 15 minutes each. Dehydrate with a gradient of ethanol (30%, 50%, 70%, 80%, 90%, and 100%) for 15 minutes each, and finally dehydrate with 100% ethanol twice for 20 minutes each. Discard the ethanol and treat with a mixture of ethanol and isoamyl acetate (v / v = 1 / 1) for 30 minutes, followed by treatment with pure isoamyl acetate for 1 hour. Critically dry, plate, and load for observation.

[0062] Depend on Figure 6 Klebsiella pneumoniae normally exhibits a typical club-like shape and an intact surface. However, after treatment with Hydrostatin-AMP3, the bacterial morphology undergoes significant changes. The cells become distorted and blister, losing their integrity. The plasma membrane is damaged, and the contents leak out. These results suggest that Hydrostatin-AMP3 may exert its effects by affecting the integrity of bacterial cell membranes, making it less likely to induce widespread drug resistance than traditional antibiotics.

[0063] Example 8: In vitro stability of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake

[0064] (1) Stability of Hydrostatin-AMP3 in salt solutions of different concentrations

[0065] The test strain was inoculated into MH broth medium and cultured at 37°C with shaking until the logarithmic growth phase. The final concentrations of MH broth medium with 0mM, 50mM, 100mM, 150mM, and 200mM sodium chloride were adjusted to 1×10 6 cfu / ml for later use. Dilute hydrostatin-AMP3 to a concentration series using MH broth containing the corresponding sodium chloride concentrations: 1 μg / ml, 2 μg / ml, 4 μg / ml, 8 μg / ml, 16 μg / ml, 32 μg / ml, 64 μg / ml, and 128 μg / ml. Add 100 μl of the hydrostatin-AMP3 solution to a 96-well plate, followed by 100 μl of the above bacterial dilutions. Incubate at 37°C for 18 hours. Detect the absorbance of the solution at 600 nm using an enzyme-linked immunosorbent assay (ELISA). Changes in the minimum inhibitory concentration (MIC) demonstrate the salt stability of hydrostatin-AMP3.

[0066] The results are as follows Figure 7 As shown, Hydrostatin-AMP3 is not salt-dependent. When the NaCl concentration is less than or equal to 200 mM, the minimum inhibitory concentration of Hydrostatin-AMP3 remains essentially unchanged. These results indicate that sodium ions in the salt solution have little effect on the antibacterial activity of Hydrostatin-AMP3.

[0067] (2) Heat resistance of Hydrostatin-AMP3

[0068] The test strain was inoculated into MH broth medium and cultured at 37℃ with shaking until the logarithmic growth phase. The culture temperature was adjusted to 10 6 cfu / ml, set aside. Hydrostatin-AMP3 was diluted with physiological saline to 1μg / ml, 2μg / ml, 4μg / ml, 8μg / ml, 16μg / ml, 32μg / ml, 64μg / ml, and 128μg / ml. Incubate for 1 hour at different temperatures (4°C, 37°C, 80°C, and 100°C). 100μl of Hydrostatin-AMP3 solution and 100μl of the above bacterial dilution were added to each well of a 96-well plate, and incubated at 37°C for 16-20 hours. The absorbance of the solution at a wavelength of 600nm was detected using an enzyme-linked immunosorbent assay (ELISA) and the heat resistance of Hydrostatin-AMP3 was demonstrated by the change in the minimum inhibitory concentration.

[0069] The results are as follows Figure 8As shown in the figure, the minimum inhibitory concentration of Hydrostatin-AMP3 only slightly increased after being treated under different conditions. These results indicate that Hydrostatin-AMP3 has strong heat resistance and stability, and its activity is not easily affected by external temperature conditions.

[0070] Example 9: Cytotoxicity of Hydrostatin-AMP3, an antimicrobial peptide from the sea snake

[0071] Mouse fibroblast L929 cells (purchased from Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences) were cultured in RPMI-1640 medium (purchased from Hyclone) containing 10% fetal bovine serum (purchased from Gibco) and 1‰ cyanine chain double antibody (purchased from Source Biotechnology).

[0072] The specific experimental steps were as follows: L929 cells were digested with trypsin and resuspended in culture medium containing double antibody and serum, and the cell density was adjusted to 2×10 4 Cells were inoculated with 100 μl of culture medium in a 96-well cell culture plate and cultured overnight in a CO2 incubator. The culture medium was replaced with 100 μl of culture medium containing a series of final concentrations of Hydrostatin-AMP3, and the cells were cultured in a CO2 incubator for 24 hours. 10 μl of Cell Counting Kit-8 reagent was added to each well, gently pipetted to mix, and the cells were cultured in the incubator for 15-30 minutes. The absorbance at a wavelength of 480 nm was detected using an enzyme-linked immunosorbent assay (ELISA). The formula was: cell viability = (absorbance) 对照组 -Absorbance value 实验组 ) / absorbance value 对照组 *100%, calculate the effect of different concentrations of Hydrostatin-AMP3 on the survival rate of L929 cells,

[0073] The results are as follows Figure 9 As shown, when the concentration of Hydrostatin-AMP3 was 300 μg / ml, the cell viability was 93.24%. The above results indicate that Hydrostatin-AMP3 has almost no toxicity to L929 cells within the active range.

[0074] Example 10: Hemolytic activity of the antimicrobial peptide Hydrostatin-AMP3 from sea snakes on human red blood cells

[0075] Hydrostatin-AMP3 was diluted with physiological saline to concentrations of 7.86 μg / ml, 15.63 μg / ml, 31.25 μg / ml, 62.5 μg / ml, 125 μg / ml, and 250 μg / ml. Physiological saline was used as a negative control, and 1% Triton X-100 solution was used as a positive control.

[0076] The specific experimental steps are as follows: 200 μl of normal saline, 1% Triton X-100 solution, or a series of concentrations of Hydrostatin-AMP3 were added to a 1.5 ml centrifuge tube. 50 μl of fresh 2% human blood cell suspension was added to each tube, mixed thoroughly, and incubated in a CO2 incubator for 30 minutes. The tubes were centrifuged at 2000 rpm for 5 minutes at 25°C. 180 μl of the supernatant was transferred to a 96-well cell culture plate. The absorbance at 540 nm was measured using an enzyme-linked immunosorbent assay (ELISA) and the hemolysis rate was calculated.

[0077] The results are as follows Figure 10 As shown in Figure 3, when the concentration of Hydrostatin-AMP3 was as high as 250 μg / ml, the hemolysis rate was about 6%. The above results indicate that Hydrostatin-AMP3 has excellent safety.

[0078] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art may make various equivalent modifications or substitutions without departing from the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

[0079]

Claims

1. A sea snake antimicrobial peptide Hydrostatin-AMP3, characterized in that: The amino acid sequence of the antimicrobial peptide Hydrostatin-AMP3 from the sea snake is shown in SEQ ID No:

1.

2. A gene encoding the antimicrobial peptide Hydrostatin-AMP3 from Sea Snake as claimed in claim 1, characterized in that: The coding gene is a DNA molecule as shown in SEQ ID NO:

2.

3. Use of the antimicrobial peptide Hydrostatin-AMP3 from Sea Snake as claimed in claim 1 in the preparation of an antimicrobial infection drug, wherein the microorganism is one or more of Escherichia coli, Staphylococcus aureus, Propionibacterium acnes or Klebsiella pneumoniae.

4. The use according to claim 3, characterized in that: The antimicrobial infection drug has an inhibitory or killing effect on Escherichia coli, Staphylococcus aureus, Propionibacterium acnes or Klebsiella pneumoniae.

5. Use of the gene encoding the antimicrobial peptide Hydrostatin-AMP3 from Sea Snake as claimed in claim 2 in the preparation of an antimicrobial infection drug, wherein the microorganism is one or more of Escherichia coli, Staphylococcus aureus, Propionibacterium acnes or Klebsiella pneumoniae.

6. The use according to claim 5, characterized in that: The antimicrobial infection drug has an inhibitory or killing effect on Escherichia coli, Staphylococcus aureus, Propionibacterium acnes or Klebsiella pneumoniae.

7. An antimicrobial infection drug, characterized in that: The drug contains the antimicrobial peptide Hydrostatin-AMP3 of the sea snake described in claim 1 as the sole active ingredient, or is a pharmaceutical composition containing the antimicrobial peptide Hydrostatin-AMP3 of the sea snake described in claim 1.

8. The antimicrobial infection drug according to claim 7, characterized in that: The drug is prepared into a pharmaceutical preparation with conventional pharmaceutical excipients in pharmacy.

9. The antimicrobial infection drug according to claim 8, characterized in that: The pharmaceutical preparation is in the form of tablets, granules, capsules, pills, injections, powder injections or aerosols.