High-sensitivity glycocholic acid single-chain antibody, screening method and application thereof

By screening highly sensitive single-chain antibodies against glycocholic acid using phage display technology, the problems of batch variation and complex preparation of existing antibodies in glycocholic acid detection have been solved, achieving rapid and highly sensitive detection results.

CN116041501BActive Publication Date: 2026-04-21SHENZHEN XIANGGAN SCIENCE & TECHNOLOGY ACHIEVEMENTS TRANSFORMATION CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHENZHEN XIANGGAN SCIENCE & TECHNOLOGY ACHIEVEMENTS TRANSFORMATION CO LTD
Filing Date
2022-08-29
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing polyclonal and monoclonal antibodies suffer from batch-to-batch variability, complex preparation, and high cost in the detection of glycocholic acid, making it difficult to achieve rapid detection with high sensitivity.

Method used

Highly sensitive glycocholic acid single-chain antibodies were screened using phage display technology. Through the preparation of heterologous coated antigens, animal immunization, construction of antibody libraries, panning of specific single-chain antibodies, and expression and purification, highly sensitive glycocholic acid single-chain antibodies with amino acid sequences as shown in SEQ ID NO.1 were obtained.

Benefits of technology

It reduces interference from non-target antibodies, rapidly screens out highly sensitive single-chain antibodies, and is suitable for rapid immunoassay of glycocholic acid, demonstrating good application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116041501B_ABST
    Figure CN116041501B_ABST
Patent Text Reader

Abstract

This invention discloses a highly sensitive glycocholic acid single-chain antibody, its screening method, and its application. The aim is to provide a highly sensitive glycocholic acid single-chain antibody that can be used for rapid immunodetection of glycocholic acid and has good application value. Its amino acid sequence is shown in SEQ ID NO. 1. The single-chain antibody is obtained by immunizing animals with a glycocholic acid immunogen and screening using a heterologous coated antigen. This invention relates to the field of biotechnology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering, antibody engineering technology and immunological detection, and relates to a method for screening highly sensitive glycocholic acid single-chain antibodies using heterologous coated antigens. Background Technology

[0002] Glycocholic acid (GCA), a secondary bile acid, is a derivative of steroid acids. It is a conjugated bile acid formed by the combination of bile acids and glycine in the liver and is one of the main components of bile acids. GCA promotes lipid emulsification and accelerates the digestion and absorption of lipids. The concentration of glycocholic acid in blood and urine is correlated with the severity of hepatocellular damage and bile acid metabolism disorders. Therefore, establishing a method for detecting glycocholic acid and effectively monitoring it can provide important evidence for the identification, diagnosis, treatment, and prognosis of various liver diseases.

[0003] Currently, the main detection methods for GCA include high-performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC-MS), and immunological analysis. Immunoassays, based on the specific binding between antibodies and antigens, have advantages such as high sensitivity, strong specificity, simplicity, speed, and low cost, making them particularly suitable for screening large batches of samples.

[0004] Antibodies are a crucial factor affecting the specificity and sensitivity of immunoassay methods. Traditional antibodies include polyclonal antibodies (pAbs) and monoclonal antibodies (mAbs); however, both types of antibodies have certain drawbacks, such as batch-to-batch variability in polyclonal antibody preparation and time-consuming, costly, and complex preparation processes for monoclonal antibodies. Phage display technology allows for the selection of recombinant antibodies with high affinity from antibody libraries, and sequencing can be used to obtain the antibody's coding sequence. Single-chain variable fragments (scFvs) are among the most common recombinant antibodies. They are the smallest units capable of effectively binding to antigens, recombinant proteins expressed by splicing the variable regions of light and heavy chains of antibodies together with a gene encoding a linker peptide. scFvs offer advantages such as ease of prokaryotic expression and genetic engineering, and are currently widely used in medical diagnostics, disease treatment, environmental monitoring, and food safety analysis. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art. The first objective of this invention is to provide a highly sensitive single-chain antibody for the rapid immunoassay of glycocholic acid.

[0006] The second objective of this invention is a method for screening highly sensitive glycocholic acid single-chain antibodies using heterologous coated antigens.

[0007] Therefore, the first technical solution provided by this invention is as follows:

[0008] A highly sensitive glycocholic acid single-chain antibody, the amino acid sequence of which is shown in SEQ ID NO.1.

[0009] Furthermore, the nucleotide sequence of the aforementioned highly sensitive glycocholic acid single-chain antibody is shown in SEQ ID NO. 2.

[0010] Furthermore, in the aforementioned highly sensitive glycocholic acid single-chain antibody, the amino acid sequence is composed of a heavy chain variable region as shown in SEQ ID NO. 3, a linker peptide as shown in SEQ ID NO. 4, and a light chain variable region as shown in SEQ ID NO. 5, wherein the linker peptide is located between the heavy chain variable region and the light chain variable region.

[0011] The second technical solution provided by this invention is as follows:

[0012] The first technical solution provides a method for screening highly sensitive glycocholic acid single-chain antibodies, which includes the following steps in sequence:

[0013] 1) Synthesize immune antigens

[0014] First, prepare the hapten by dissolving it in a solution, adding dicyclohexylcarbodiimide and NHS, and stirring at room temperature. Finally, centrifuge and add the supernatant to bovine serum albumin, stirring at room temperature, and then dialyze in PBS to obtain the heterocoated antigen.

[0015] 2) Animal immunization

[0016] The glycocholic acid immunogen was diluted to 1 mg / mL with phosphate buffer, emulsified with an equal volume of Freund's adjuvant, and then used to immunize Leigh chickens 5 times.

[0017] 3) Construction of antibody library

[0018] Lymphocytes from the spleen of immunized Leghorn chickens were isolated, total RNA was extracted and reverse transcribed to synthesize cDNA, the heavy chain variable region VH and light chain variable region VL genes were amplified, and scFv was assembled by overlap PCR, ligated with pCom3X plasmid, click-transformed into Ecoli ER2738 competent cells, the original antibody library was constructed, and helper phage VCSM13 was added to obtain the phage antibody library;

[0019] 4) Screening of specific single-chain antibodies

[0020] Using the heterologous coated antigen prepared in step 1), the ELISA plate was coated, a phage antibody library was added, and the plate was incubated at room temperature for 1 hour. Unbound phages were washed with PBST, and then glycocholic acid was added to elute bound phages. The above operation was repeated 4 times to screen out phages with high sensitivity.

[0021] 5) Expression of specific single-chain antibodies

[0022] Positive phage particles were extracted, heat-transformed into E. coli TOP10F´ expression host bacteria, IPTG was added to induce expression, the bacterial cells were collected by centrifugation, sonicated and purified using a nickel affinity chromatography column to obtain a highly sensitive anti-glycocholic acid single-chain antibody.

[0023] Preferably, the above-mentioned screening method for highly sensitive glycocholic acid single-chain antibodies involves dissolving 2g of glycocholic acid in 10mL of methanol, adding 0.3mL of concentrated sulfuric acid, heating to reflux at 100°C for esterification, and extracting with ethyl acetate to obtain methyl glycocholate; then, dissolving 0.1g of methyl glycocholate in 100mL of chloroform, and reacting it with 0.2g of succinic anhydride under the catalysis of 0.1mL of triethylamine to obtain a hapten.

[0024] Preferably, in the above-mentioned screening method for highly sensitive glycocholic acid single-chain antibodies, the immunoantigen is prepared by the following method: 0.11 mmol of glycocholic acid is dissolved in 1 mL of LDMF, 0.22 mmol of DCC and 0.22 mmol of NHS are added, the mixture is stirred at room temperature, the supernatant is centrifuged and 5.5 μmol of ovalbumin is added, the mixture is stirred at room temperature, and the coated antigen is obtained by dialysis in PBS.

[0025] Preferably, in the above-described method for screening highly sensitive glycocholic acid single-chain antibodies, the method for amplifying the heavy chain variable region VH and light chain variable region VL genes uses the upstream primer CSCVHo-F (nucleotide sequence shown in SEQ ID NO. 6) and the downstream primer CSCG-B (nucleotide sequence shown in SEQ ID NO. 7) to amplify the antibody heavy chain variable region gene; and uses the upstream primer CSCVK (nucleotide sequence shown in SEQ ID NO. 8) and the downstream primer CKJo-B (nucleotide sequence shown in SEQ ID NO. 9) to amplify the antibody light chain variable region gene VL.

[0026] Preferably, in the above-mentioned method for screening highly sensitive glycocholic acid single-chain antibodies, the system for the heavy chain variable region VH and light chain variable region VL genes is as follows:

[0027] 10×PCR buffer 1μL,

[0028] 10mMdNTP mix 1μL,

[0029] 1 μL of 10 µM upstream primer

[0030] 1 μL of 10 µM downstream primer

[0031] 500 ng of cDNA;

[0032] 1 μL of Taq DNA enzyme

[0033] Sterilized water: 50 μL;

[0034] Amplification conditions:

[0035] Pre-denaturation at 98℃ for 120 seconds;

[0036] Denaturation at 98℃ for 30 seconds;

[0037] Annealing at 56℃ for 15 seconds;

[0038] Extended at 72℃ for 90 seconds;

[0039] Repeat the denaturation, annealing, and extension process 25 times;

[0040] Finally, extend the heat to 72℃ for 10 minutes.

[0041] Cool to 4℃+∞.

[0042] Preferably, in the above-mentioned screening method for highly sensitive glycocholic acid single-chain antibodies, the method for assembling scF via overlap PCR is as follows:

[0043] 1) Add 20 μL of 10×Buffer M, 10 μg of pComb3X plasmid orscFv gene fragment, and 18 μL of SfiI restriction enzyme to a PCR tube, then add 200 μL of Rasefree ddH2O and 0.5 μL of 0.5 μL. Incubate overnight at 50°C, then cut the gel and recover the enzyme digestion product.

[0044] 2) Ligation of vector pComb3X and single-stranded gene fragments

[0045] Add 600 ng of SfiI-digested pComb3X vector, 1320 ng of SfiI-digested scFv fragment, 20 μL of 10× Ligase buffer, 10 μL of T4 DNA ligase, and RNase-free dH2O to a PCR tube. 200 μL of PCR product was placed in a PCR instrument and reacted overnight at 16°C. T4 DNA ligase was heat-inactivated at 65°C for 10 minutes and stored at -20°C. 3 μL of the ligation product was added to E. coli ER2738 electrotransformed competent cells and incubated on ice for 30 minutes. The cells were then transferred to a cooled electroporation cuvette for electroporation transformation. 1 mL of preheated 37°C SB medium was added, and the transformed cells were resuspended. The transformed cells were placed in a shaker and incubated at 37°C and 250 rpm for 1 hour to allow the expression of the resistance gene in E. coli. 200 μL of 50 μg / mL carbenicillin and 200 μL of 20 μg / mL tetracycline were added, and the cells were cultured for another 2 hours.

[0046] The application of the high-sensitivity glycocholic acid single-chain antibody provided by this invention in the detection of glycocholic acid.

[0047] Compared with existing methods, this invention reduces interference from non-target antibodies during the screening process, enables rapid screening of highly sensitive single-chain antibodies, and is suitable for rapid immunoassay of glycocholic acid, thus having good application value. Attached Figure Description

[0048] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0049] Figure 1 Using cDNA from spleen mononuclear cells of immunized hens as a template, the antibody heavy chain variable region gene and light chain variable region gene were amplified by PCR. Overlap PCR was performed on the heavy chain variable region gene and light chain variable region gene using a flexible linker peptide gene to obtain the full-length single-chain antibody gene.

[0050] In the diagram: M, nucleic acid standard; VL, antibody light chain variable region gene; VH, antibody heavy chain variable region gene; VL-VH, full-length gene of anti-glycocholic acid single-chain antibody.

[0051] Figure 2 The expression of single-chain antibodies in the periplasmic cavity of E. coli was validated using SDS-PAGE.

[0052] In the figure: M, protein standard; 1 and 2, crude extracts after bacterial disruption; 3, 4, 5 and 6, purified single-chain antibodies.

[0053] Figure 3 This is the competitive inhibition curve of single-chain antibody against glycocholic acid. Detailed Implementation

[0054] The present invention will be further described below with reference to specific embodiments. However, those skilled in the art should understand that modifications or substitutions to the details and form of the technical solution of the present invention without departing from the technical solution of the present invention shall all fall within the protection scope of the present invention.

[0055] Example 1: Synthesis of Immunogens

[0056] 1) Dissolve 2g of glycocholic acid in 10mL of methanol, add 0.3mL of concentrated sulfuric acid, heat under reflux for esterification, and extract with ethyl acetate to obtain methyl glycocholate; then, dissolve 0.1g of methyl glycocholate in 100mL of chloroform, and react with 0.2g of succinic anhydride under the catalysis of 0.1mL of triethylamine to obtain a hapten;

[0057] 2) Weigh 0.11 mmol of the hapten prepared in step 1) and dissolve it in 1 mL of LDMF. Add 0.22 mmol of DCC (dicyclohexylcarbodiimide) and 0.22 mmol of NHS and stir at room temperature. Finally, centrifuge and take the supernatant, add it to 5.5 μmol of bovine serum albumin and stir at room temperature. Dialyze the mixture in PBS to obtain the immunogenic antigen.

[0058] Example 2 Synthesis of Coated Antigen

[0059] Dissolve 0.11 mmol glycocholic acid in 1 mL LDM, add 0.22 mmol DCC and 0.22 mmol NHS, stir at room temperature, centrifuge, take the supernatant, add 5.5 μmol ovalbumin, stir at room temperature, and dialyze in PBS to obtain the heterocoated antigen.

[0060] Example 3 Animal Immunization

[0061] Two Leghorn hens, 6 months old and weighing 1.5–2.0 kg, were selected. 1 mL of immunogen was emulsified with an equal volume of Freund's adjuvant and administered submuscularly. Booster immunizations were given every two weeks. The initial immunization used complete Freund's adjuvant, while booster immunizations used incomplete Freund's adjuvant. The dose for each immunization was 0.5 mg per hen. The immunization schedule is shown in Table 1.

[0062] Table 1

[0063] Number of immunizations Interval (days) Immunization dose (μg) Adjuvant type Immune sites First exemption, second exemption, third exemption, fourth exemption, fifth exemption 014141414 500500500500500 Freund's complete adjuvant, Freund's incomplete adjuvant, Freund's incomplete adjuvant, Freund's incomplete adjuvant, Freund's incomplete adjuvant Multiple injections at various points on the thorax and underwings.

[0064] Example 4: Total RNA Extraction and cDNA Synthesis

[0065] 1. Total RNA extraction: Chicken spleen was extracted, and lymphocytes were separated using density gradient centrifugation, at a ratio of 10-1... 7Add 1 mL of Trizol reagent to each cell and let it stand at room temperature for 5 minutes. Add 0.2 mL of chloroform and let it stand at room temperature for 5 minutes. After centrifugation, aspirate the supernatant, add 0.5 mL of isopropanol, and let it stand at room temperature for 10 minutes. Centrifuge for 10 minutes, discard the supernatant, add 0.5 mL of 75% ethanol to wash, invert and air dry, and add sterile water to dissolve the precipitated RNA.

[0066] 2. cDNA Synthesis

[0067] 2.1 Prepare the mixture according to the system described in Table 2:

[0068] Table 2

[0069] reagents Usage OligodTPrimer (50μM) 1μL dNTPMixture(10mMeach) 1μL Total RNA 5μg <![CDATA[RnasefreeddH2O]]> Up to 10 μL

[0070] 2.2 After incubating at 65℃ for 5 minutes, rapidly cool on ice;

[0071] 2.3 Add the reverse transcription reaction solution as shown in Table 3:

[0072] Table 3

[0073] reagents Usage The above denatured reaction solution 10μL 5×PrimeScriptIIBuffer 4μL Rnase Inhibitor (40 U / μL) 0.5 μL (20 U) PrimeScript II RTase (200 U / μL) 1μL (200U) <![CDATA[RNasefreeddH2O]]> Up to 20μL

[0074] 2.4 Perform the reverse transcription reaction under the conditions described in Table 4:

[0075] Table 4

[0076] temperature time 30℃ 10min 42℃ 60min 95℃ 5min 4℃ Hold

[0077] 2.5 Store the obtained cDNA library at -80℃.

[0078] Example 5: Amplification of the Anti-Choleric Acid Single-Chain Antibody Gene

[0079] 1. Amplify the antibody light chain (VL) and heavy chain (VH) genes separately.

[0080] 1.1 The primer sequences for amplifying the single-chain antibody gene are shown in Table 5:

[0081] Table 5

[0082] name Sequence (5ʹ-3ʹ) serial number CSCVHo-F ggtcagtcctctagatcttccgccgtgacgttggacgag SEQ ID No. 6 CSCG-B ctggccggcctggccactagtggagaggagacgatgacttcggtcc SEQ ID No. 7 CSCVK gtggcccaggcggccctgactcagccgtcctcggtgtc SEQ ID No. 8 CKJo-B ggaagatctagaggactgacctaggacggtcagg SEQ ID No. 9 CSC-F gaggaggaggaggaggaggtggcccaggcggccctgactcag SEQ ID No. 10 CSC-B gaggaggaggaggaggaggagctggccggcctggccactagtggagg SEQ ID No. 11 G-back gcccccttattagcgtttgccatc SEQ ID No. 12 Ompseq aagacagctatcgcgattgcagtg SEQ ID No. 13

[0083] Note: CSC-F SfiI restriction site: GGCCCAGGCGGCC; CSC-B SfiI restriction site: GGCCGGCCTGGCC.

[0084] 1.2 The antibody heavy chain variable region gene was amplified using upstream primer CSCVHo-F and downstream primer CSCG-B; the antibody light chain variable region gene (VL) was amplified using upstream primer CSCVK and downstream primer CKJo-B; the systems are shown in Table 6:

[0085] Table 6

[0086] reagents Usage Sterilized water To 50μL 10×PCR buffer 1μL 10mMdNTPmix 1μL Upstream primer (10µM) 1μL Downstream primer (10µM) 1μL cDNA 500ng Taq DNA enzyme 1μL Total 50μL

[0087] 1.3 The reaction conditions are shown in Table 7.

[0088] Table 7

[0089]

[0090] 1.4 After performing 1.5% agarose gel electrophoresis on the VH and VL gene fragments, the gel fragments containing the VH and VL gene fragments were cut off with a sterile scalpel and recovered;

[0091] 2. Synthesis of anti-cholic acid single-chain antibody gene

[0092] Using the VL and VH genes obtained by gel extraction as templates, overlapping PCR amplification was performed with upstream primer CSC-F and downstream primer CSC-B to obtain single-chain antibody genes. Figure 1 AB and C are the PCR results of VL, VH, and single-chain antibody gene fragments, respectively.

[0093] Example 6: Construction of a phage single-chain antibody library

[0094] 1. Enzyme digestion reaction of vector pComb3X and single-chain antibody gene fragment

[0095] 1.1 Add the reagents listed in Table 8 below to the PCR tube in sequence and mix well;

[0096] Table 8

[0097] reagents Usage 10×BufferM 20μL pComb3X plasmid orscFv gene fragment 10μg SfiI endonuclease 18μL (360U) <![CDATA[RNasefreeddH2O]]> Up to 200 μL

[0098] 1.2 Incubate overnight at 50°C, then cut the gel to recover the enzyme digestion product.

[0099] 2. Ligation of vector pComb3X and single-stranded gene fragments

[0100] 2.1 Add each reagent from Table 9 below to the PCR tube in sequence and mix well;

[0101] Table 9

[0102] reagents Usage pComb3X vector digested with SfiI enzyme 600ng SfiI-digested scFv fragment 1320ng 10×Ligase buffer 20μL T4 DNA ligase 10μL <![CDATA[RNasefreedH2O]]> Up to 200 μL

[0103] 2.2 Place the PCR tubes in a PCR instrument and incubate overnight at 16°C;

[0104] 2.3 Heat-inactivate T4 DNA ligase at 65℃ for 10 minutes, then store at -20℃.

[0105] Electroporation of the product from the ligation of vector pComb3X and single-stranded gene fragments

[0106] 3.1 Add 3 µL of the ligation product to E. coli ER2738 electrotransform competent cells and incubate on ice for 30 minutes;

[0107] 3.2 Transfer to a cooled electroporation cup for electroporation conversion;

[0108] 3.3 Add 1 mL of SB medium preheated to 37°C and resuspend the transformed cells;

[0109] 3.4 The transformed cells were placed in a shaker and oscillated at 37°C and 250 rpm for 1 hour to induce the expression of the resistance gene in E. coli;

[0110] 3.5 Add 200µL carbenicillin (50µg / mL) and 200µL tetracycline (20µg / mL), and continue culturing for 2 hours.

[0111] 4. Construction of single-chain antibody phage display library

[0112] 4.1 Add 1 mL of 1×10⁻⁶ bacteria to the transformed bacterial culture. 13 CFU / mL helper phage VCSM13;

[0113] 4.2 Place the bacterial culture in a shaker at 37℃ and 250 rpm for 2 hours;

[0114] 4.3 Add kanamycin to a final concentration of 70 μg / mL and continue shaking and incubating overnight;

[0115] 4.4 Centrifuge for 20 min, collect the supernatant, and add 50 mL of 5×PEG / NaCl solution;

[0116] 4.5 Centrifuge for 20 min, add 5 mL of PBS solution containing 1% BSA, filter through a 0.22 µm filter membrane, and the filtrate is the single-chain antibody phage library.

[0117] Example 7: Screening of Specific Single-Chain Antibodies

[0118] 1. Dilute the heterologous coating antigen to 10 µg / mL with coating buffer, add 100 µL / well to a 96-well microplate, and coat overnight at 4°C;

[0119] The coating buffer is a 0.05 M carbonate buffer with pH 9.6; its preparation method is as follows: weigh 2.93 g of NaHCO3 and 1.59 g of Na2CO3, dissolve them in 900 mL of deionized water, adjust the pH to 9.6, and bring the volume to 1 L with distilled water. Store at room temperature.

[0120] 2. Discard the coating buffer, wash the plate three times with PBST, add 300µL / well of 3% BSA solution, and block at 37℃ for 1 hour;

[0121] 3. Discard the blocking buffer (3% BSA), wash the plate three times with PBST, and add 100µL of phage display single-chain antibody library (1×10⁻⁶) to each well. 12 (cfu / mL), blocked at 37℃ for 1 hour;

[0122] 4. Shake off the phage library solution and vigorously pipette it 10 times with PBST;

[0123] 5. Add 100µL of glycocholic acid standard (1000ng / mL) and elute competitively at 37℃ for 1 hour;

[0124] 6. Collect the supernatant and add it to 2 mL of freshly cultured E. coli ER2738 bacterial culture. Let it stand at 37°C for 30 min.

[0125] 7. Add 1 mL of helper phage VCSM13 (1×10¹³ cfu / mL), add 97 mL of SB medium and carbenicillin (final concentration 50 µg / mL), and culture the bacterial solution overnight in a shaker.

[0126] 8. Centrifuge the bacterial culture, precipitate the supernatant with 5×PEG / NaCl, resuspend it with 2mL of 1%BSA / PBS, and then put the obtained phages into the next round of panning.

[0127] 9. A total of four rounds of biological panning were conducted. The panning conditions in the second, third, and fourth rounds, including the concentration of the coating antigen, the concentration of the glycocholic acid standard, the number of washes, and the concentration of Tween-20, were more stringent than those in the previous round. The panning conditions are shown in Table 10 below:

[0128] Table 10

[0129] Number of selections Coating antigen concentration (µg / mL) Standard concentration (µg / mL) Number of washes Tween-20 concentration (%) Round 1 10 100 10 0.05 Second round 1 10 15 0.1 Third round 0.1 1 20 0.5 Fourth round 0.1 0.1 20 0.5

[0130] The positive clones obtained through screening were sequenced, and their amino acid sequences are shown in SEQ ID NO. 1. The amino acid sequence consists of a heavy chain variable region as shown in SEQ ID NO. 3, a linker peptide as shown in SEQ ID NO. 4, and a light chain variable region as shown in SEQ ID NO. 5. The linker peptide is located between the heavy chain variable region and the light chain variable region. Its nucleotide sequence is shown in SEQ ID NO. 2.

[0131] Implementation Case 8: Prokaryotic Expression and Purification of Anti-Choleric Acid Single-Chain Antibody

[0132] 1. Prokaryotic expression of single-chain antibody proteins

[0133] 1.1 The positive plasmid was heat-transformed into the expression host bacterium E. coli TOP10F´, plated on LB agar plates (containing 50 µg / mL carbenicillin), and incubated upside down overnight;

[0134] 1.2 Pick a single colony and inoculate it into 5 mL of LB liquid medium (containing 50 µg / mL carbenicillin), and incubate overnight in a shaker;

[0135] 1.3 Transfer the bacterial culture that has been cultured overnight to 200 mL LB liquid medium containing 50 µg / mL carbenicillin at an inoculation rate of 1%, add IPTG to a final concentration of 0.5 mM, and culture overnight in a shaker;

[0136] 1.4 Centrifuge to discard the supernatant, then sonicate to disrupt the protein.

[0137] 1.5 Centrifuge to collect the supernatant containing soluble protein.

[0138] 2. Purification of single-chain antibody proteins

[0139] 2.1 Add the supernatant to the nickel ion affinity chromatography column;

[0140] 2.2 Add 4 mL of washing buffer (PBS containing 50 mM imidazole) to elute the purification column 1-2 times;

[0141] 2.3 Add 2 mL of elution buffer (PBS containing 250 mM imidazole) to elute the purification column three times and collect the eluent;

[0142] 2.4 The obtained single-chain antibody solution was placed in a dialysis bag and then dialyzed in PBS (0.01M, pH=7.4) at 4°C for 3 days, with the solution changed twice a day to remove small molecules such as imidazole.

[0143] The single-chain antibodies obtained by dialysis were validated using SDS-PAGE, and the results are as follows: Figure 2 As shown, the molecular weight of the single-chain antibody is approximately 30 kDa.

[0144] Implementation Case 9: Application of Single-Chain Antibodies

[0145] (1) Dilute the coating antigen to 2 µg / mL with carbonate buffer (0.1 mol / L, pH 9.2), add 100 µL / well to a 96-well microplate, and coat overnight at 4°C;

[0146] (2) Wash the plate three times with PBST buffer, add 300 μL of blocking buffer per well, and block at 37°C for 1 h;

[0147] (3) Wash the plate three times with PBST, add 50 μL / well of single-chain antibody and equal volumes of glycocholic acid standards of various concentrations (1000, 100, 10, 1, 0.1, 0.01, 0.001 μg / mL), mix well, and incubate at 37°C for 1 h;

[0148] (4) Wash the plate five times with PBST, add 100 μL / well of mouse anti-HA-HRP enzyme-labeled monoclonal antibody diluted 1:5000 (v / v), and incubate at 37°C for 1 h;

[0149] (5) Wash the plate three times with PBST, add 100 μL / well of TMB substrate solution, and react at 37°C in the dark for 10 min.

[0150] (6) Add 50 μL / well 2MH2SO4 to stop the reaction, and read the absorbance value at 450 nm (OD450) using a microplate reader.

[0151] (7) A competitive inhibition standard curve was plotted with the logarithm of the concentration of glycocholic acid standard as the abscissa and the absorbance value as the ordinate. The sensitivity was 3.96 μg / mL and the linear range was 1.50~10.44 ng / mL. This shows that the single-chain antibody provided in this application has high sensitivity and is suitable for rapid immunoassay of glycocholic acid, and has good application value.

Claims

1. A highly sensitive glycocholic acid single-chain antibody, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

1.

2. The highly sensitive glycocholic acid single-chain antibody according to claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

2.

3. The highly sensitive glycocholic acid single-chain antibody according to claim 1, characterized in that, The amino acid sequence comprises a heavy chain variable region as shown in SEQ ID NO. 3, a linker peptide as shown in SEQ ID NO. 4, and a light chain variable region as shown in SEQ ID NO. 5, wherein the linker peptide is located between the heavy chain variable region and the light chain variable region.

Citation Information

Patent Citations

  • Glycocholic-acid immunodetection reagent based on anti-glycocholic acid specific antibody and preparation method thereof

    CN105481977A

  • Nano enzyme-linked immunosorbent assay method for detecting glycocholic acid

    CN110927378A