Aspergillus niger HY4-25 and its application in extracting total flavonoids from lotus leaves

Abstract

The invention discloses a kind of HY4-25 and its application in the extraction of total flavonoids from lotus leaves. Before the total flavonoids are extracted from lotus leaves by ethanol ultrasonic extraction, the crude enzyme solution prepared by microbial fermentation is added for enzymatic hydrolysis. The enzyme-producing microorganism Aspergillus niger HY4-25 used is purposefully screened for being able to hydrolyze the cell wall of lotus leaves. The fermentation liquid cultivated by enzyme production contains a variety of hydrolases, which can synergistically hydrolyze substances such as cellulose and pectin in lotus leaves, damage the cell wall, and help dissolve flavonoids. The extraction yield of total flavonoids is significantly improved. The method for enzymatic hydrolysis of lotus leaves provided by the present invention can increase the yield of total flavonoids extracted from lotus leaves by 36.3% compared with the direct use of ethanol ultrasonic extraction method.

Description

(I) Technical field

[0001] The invention belongs to the technical field of bioengineering, and particularly relates to a strain of Aspergillus niger HY4-25 and application thereof in extracting total flavonoids from lotus leaves. (II) Background technology

[0002] Lotus leaf is the leaf of Nelumbo nucifera Gaertn., a plant of the family Nelumbo. Lotus, also known as lotus, lotus flower, etc., grows in ponds and lakes. It is distributed in most parts of my country, and is mainly produced in Hunan, Zhejiang and Jiangsu. For a long time, lotus leaf has been widely used in both food and medicine. Lotus leaf is included in the medicinal materials and decoction pieces in the previous editions of the Pharmacopoeia of the People's Republic of China. It is bitter and flat in nature and belongs to the liver, spleen and stomach meridians. It has the functions of clearing away heat and dampness, promoting the clear yang, cooling blood and stopping bleeding. It is mainly used to treat summer heat and thirst, summer dampness diarrhea, spleen deficiency diarrhea, blood heat vomiting and bleeding, and bloody stool and metrorrhagia. Lotus leaf has significant therapeutic effects because it contains a variety of active ingredients. As early as November 1991, in the document Weijianfa (1991) No. 45 of the Ministry of Health of the People's Republic of China, lotus leaf was included in the second batch of "both food and medicine" list. In addition to the common chemical components such as carbohydrates, lipids, proteins, and tannins found in common plants, lotus leaves are also rich in flavonoids, alkaloids, and polysaccharides. Among the many chemical components of lotus leaves, flavonoid compounds have outstanding biological activity and have significant functions in anti-oxidation, anti-aging, treatment of cardiovascular and cerebrovascular diseases, and lowering blood lipids. my country has abundant lotus leaf resources, and extracting total flavonoids from lotus leaves can improve the economic efficiency of agricultural lotus root cultivation.

[0003] The main extraction methods of plant total flavonoids include water extraction, alkaline water extraction, organic solvent extraction and CO2 supercritical extraction. Based on the first three methods, there are also enhanced extraction methods assisted by ultrasound, high pressure, microwave and enzymatic hydrolysis. Different extraction methods have their own advantages and disadvantages. For example, the water extraction method has low cost, but the total flavonoid yield is not high, and the extract contains a large amount of polysaccharides and proteins; organic solvent extraction method often uses ethanol extraction, and the advantage is that the extraction yield and product purity are improved; ultrasound or microwave assisted extraction method adds ultrasound or microwave treatment on the basis of water extraction or ethanol extraction method to promote flavonoid dissolution, and the extraction yield is improved to a certain extent; CO2 supercritical extraction method extracts total flavonoids with higher purity, but the extraction yield is often not high, and the equipment requirements are relatively high. At present, the most widely used method is ultrasound assisted ethanol extraction. Although the ethanol consumption is large, it can be recycled and reused, and the cost of using ultrasound is also low.

[0004] In recent years, enzymatic hydrolysis has been widely used to extract active ingredients from plants. It uses one or more of cellulase, hemicellulase, pectinase or protease to pretreat plant raw materials, which can hydrolyze plant cell wall components (cellulose, hemicellulose, lignin, pectin and protein, etc.), which is beneficial to the release of active ingredients during extraction, thereby increasing the extraction yield of the product. Enzymatic hydrolysis has also been reported to extract total flavonoids from lotus leaves. For example, Zhang Shengbang et al. used cellulose and pectinase to assist ethanol extraction of total flavonoids from lotus leaves, with a yield of 3.74%, which is significantly higher than the 1.59% of non-enzymatic extraction [Zhang Shengbang, Ye Jing, Chen Cong. Optimization of the process of extracting flavonoid compounds from lotus leaves by compound enzyme method. Food Science, 2012, 33 (22): 149-153]. When pretreating plant raw materials with pure enzymes, the amount of enzyme used is often large, and its cost cannot be ignored. In addition, plant cell walls are composed of multiple components, and it is difficult to achieve very ideal results with a single enzyme hydrolysis. The combined use of multiple enzymes increases the extraction cost.

[0005] Microorganisms have a strong ability to produce enzymes, especially some actinomycetes and molds, which can produce a variety of hydrolytic enzymes that decompose plant tissues, including cellulase, hemicellulase, ligninase, pectinase and protease, etc. Therefore, if a certain microorganism is cultivated under appropriate conditions, the fermentation liquid contains a large amount of hydrolytic enzymes, and the fermentation liquid (crude enzyme liquid) is used to directly hydrolyze plant materials. These enzymes can synergistically decompose cell wall components, thereby facilitating the release of effective ingredients and significantly improving the extraction rate; in addition, the use of crude enzyme liquid that has not been separated and purified has a lower preparation cost.

[0006] In order to improve the extraction rate of total flavonoids from lotus leaves, the invention uses crude enzyme solution prepared by mold fermentation to enzymatically hydrolyze lotus leaves, and then uses ethanol ultrasonic method to extract total flavonoids, so that the extraction rate of total flavonoids can be greatly improved. (III) Summary of the invention

[0007] The present invention aims to provide a new microbial strain, Aspergillus niger HY4-25, and its application in extracting total flavonoids from lotus leaves. After the lotus leaves are enzymatically hydrolyzed with crude enzyme solution prepared by fermentation of the strain, the extraction rate of total flavonoids can be greatly improved.

[0008] The technical solution adopted by the present invention is:

[0009] The present invention provides a new microbial strain - Aspergillus niger HY4-25, which is deposited in Guangdong Microbiological Culture Collection Center, with a deposit number of GDMCC No: 62851, a deposit date of September 25, 2022, and an address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province; Postal Code 510070.

[0010] The Aspergillus niger HY4-25 described in the present invention is an excellent strain isolated from the microbial enrichment culture of lotus leaves and obtained through screening and mutagenesis breeding. The colony morphology characteristics of the Aspergillus niger HY4-25 are as follows: on a potato dextrose agar (PDA) plate culture medium, after culturing at 28°C for 48 hours, the front of the colony is black with a large number of black particles on the surface, and the center of the reverse colony is yellow-brown with no exudate, and there is no soluble pigment in the culture medium; conidiophores occur in the matrix with a diameter of 10-15 μm; the apical capsule is nearly spherical, with a double layer of conidial stalks of varying lengths on the periphery, and conidia are produced on the outer stalks, with conidia heads in a typical "chrysanthemum" shape; the conidia are brown spherical, with a diameter of 3.0-4.0 μm and a rough surface. A colony photo of Aspergillus niger HY4-25 cultured on a PDA plate culture medium at 28°C for 48 hours is shown in Figure 1 .

[0011] The nucleotide sequence of the ribosomal DNA internal transcribed spacer (rDNA-ITS) of Aspergillus niger HY4-25 is shown in SEQ ID NO.1.

[0012] The present invention also provides an application of the Aspergillus niger HY4-25 in extracting total flavonoids from lotus leaves, and the application method is: (1) filtering the fermentation liquid obtained by culturing the Aspergillus niger HY4-25, and collecting the filtrate as a crude enzyme liquid; (2) mixing the crude enzyme liquid with lotus leaf powder, performing enzymolysis at 35-40° C. for 4-6 hours, and then adding anhydrous ethanol in an amount of 1.5-2.0 times the volume of the crude enzyme liquid to the enzymolysis system for ultrasonic extraction, and filtering to obtain a total flavonoid extract; and (3) evaporating the total flavonoid extract to dryness under reduced pressure, dissolving it in ethanol, concentrating it, and vacuum drying it to obtain a total flavonoid extract.

[0013] Furthermore, the preparation method of the crude enzyme solution in step (1) is as follows: inoculating Aspergillus niger HY4-25 spores into an enzyme production medium, culturing at 30°C and 200-250 r / min for 64-72 hours, filtering the fermentation liquid, and obtaining the filtrate as the crude enzyme solution; the final concentration composition of the enzyme production medium is as follows: 30-40 g / L wheat bran, 5-6 g / L (NH4)2SO4, 3-4 g / L peptone, 3-5 g / L KH2PO4, 0.5-1.0 g / L MgSO4·7H2O, 0.3-0.5 g / L CaCl2, 0.1-0.2 g FeSO4·7H2O, and the solvent is tap water with a pH of 6.0-6.5.

[0014] Furthermore, the enzyme production culture medium preferably consists of: 40 g / L wheat bran, 5 g / L (NH4)2SO4, 4 g / L peptone, 3 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.5 g / L CaCl2, 0.1 g FeSO4·7H2O, and the solvent is tap water, pH 6.0.

[0015] Before the Aspergillus niger HY4-25 of the present invention is cultured in a plate culture medium to produce spores, the spores are then suspended in physiological saline and inoculated into an enzyme production culture medium at a volume fraction of 4%-6% for culture. The specific enzyme production culture method is as follows:

[0016] ① Preparation of spore liquid: inoculate Aspergillus niger HY4-25 on a potato dextrose agar (PDA) plate culture medium, and culture at 28-30°C for 54-60h to obtain a plate culture; add sterile physiological saline to the plate culture, stir with an inoculation loop to suspend the spores, and obtain Aspergillus niger HY4-25 spore liquid; the final concentration composition of the PDA plate culture medium is: 200g / L potato (cut into small pieces, boiled with water for 20min, and the residue is removed and the juice is retained), 20g / L glucose, 20g / L agar, the solvent is tap water, and the pH is natural (measured 6.5).

[0017] ② Enzyme production culture: The Aspergillus niger HY4-25 spore liquid after activation culture in step ① is inoculated at a volume fraction of 4%-6%, and is inoculated into the enzyme production culture medium. The culture is shaken at 30°C and 200-250r / min for 64-72h to obtain a fermentation liquid with a dry cell concentration of 5.17-5.36g / L and a cellulase activity of 119-127U / mL.

[0018] Furthermore, the volume amount of the crude enzyme solution in step (2) is 6-10 mL / g based on the mass of lotus leaf powder [i.e., the material-enzyme ratio (g:mL) is 1:6-1:10], and the lotus leaf powder is obtained by drying fresh lotus leaves at 85°C, crushing them, and passing through a 40-mesh sieve to obtain fine powder.

[0019] Furthermore, the preparation method of the total flavonoid extract in step (2) is as follows: after the enzymatic hydrolysis of the lotus leaf is completed, anhydrous ethanol in an amount of 1.5-2.0 times the volume of the crude enzyme solution is added to the system, so that the volume fraction of ethanol in the system reaches 60%-66.7%, and the solid-liquid ratio (g:mL) is 1:18-1:25. After stirring evenly, place in an ultrasonic cleaning machine with a water bath temperature of 70-75°C, extract at 100-200W for 40-60min; after the ultrasonic alcohol extraction is completed, filter while hot to obtain the total flavonoid extract.

[0020] Furthermore, in step (3), the method for recovering total flavonoids from the total flavonoid extract is as follows: the total flavonoid extract is distilled at 45°C and -0.1MPa until no liquid flows out, anhydrous ethanol is added in a volume of 4-8mL / g based on the mass of the raw lotus leaf, the mixture is fully shaken and centrifuged at 8000r / min for 5-10min, the supernatant is distilled at 45°C and -0.1MPa to 1 / 10 of the original volume, the supernatant is transferred to a clean culture dish, and vacuum dried at 50°C and -0.1MPa to obtain a total flavonoid extract.

[0021] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: before the total flavonoids are extracted from lotus leaves by ethanol ultrasonic extraction, the crude enzyme solution prepared by microbial fermentation is added for enzymatic hydrolysis. The enzyme-producing microorganism Aspergillus niger HY4-25 used is purposefully screened for the ability to hydrolyze the cell wall of lotus leaves. The fermentation liquid cultured by enzyme production contains a variety of hydrolases, which can synergistically hydrolyze substances such as cellulose and pectin in lotus leaves, damage the cell wall, and help dissolve flavonoids. The extraction rate of total flavonoids is significantly improved. The method for enzymatic hydrolysis of lotus leaves provided by the present invention can increase the extraction rate of total flavonoids from lotus leaves by 36.3% compared with the direct ethanol ultrasonic extraction method. (IV) Description of the drawings

[0022] Figure 1 This is a colony photograph of Aspergillus niger HY4-25 cultured on PDA at 28°C for 48 hours.

[0023] Figure 2 The standard curve for the determination of total flavonoids by spectrophotometry.

[0024] Figure 3 This is the standard curve for determining glucose using the DNS method. (V) Specific implementation methods

[0025] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0026] The lotus leaf described in the present invention is the leaf of the lotus plant Nelumbo nucifera Gaertn., which is produced in Deqing County, Zhejiang Province. The lotus leaf powder is the fine powder obtained by drying fresh mature lotus leaves at 85°C, crushing them and passing through a 40-mesh sieve.

[0027] Example 1: Isolation and screening of enzyme-producing microbial strains

[0028] The microbial strain used for fermentation and enzyme hydrolysis of lotus leaves is isolated and screened according to the following steps:

[0029] (1) Add 10 g of lotus leaf powder to a 250-mL conical flask, add 20 mL of sterile saline, stir evenly, and culture at 28°C for 72 h. Dilute the enriched culture full of mold with sterile saline to 1×10 -6 , 1×10 -7 , 1×10 -8 After dilution was repeated for 2 times, 0.1 mL of the dilution was spread on potato dextrose agar (PDA) plate medium and cultured at 28 °C for 48 h. Fungal colonies with different colors and morphologies were picked and transferred to fresh PDA plate medium and cultured at 28 °C for 60 h to obtain 9 pure culture strains. The numbers of the strains are shown in Table 1.

[0030] (2) Add 10 mL of sterile physiological saline to each of the fresh plate cultures of the nine strains and stir with an inoculating loop to suspend the spores to obtain the spore liquid of each strain.

[0031] (3) Take 2 mL of the spore liquid of each strain prepared in step (2) and inoculate it into 50 mL of enzyme production medium (the inoculation amount is 4% by volume), and after culturing the enzyme production under the conditions of 30°C and 200 r / min shaking for 72 h, all the fermentation liquid is filtered with a Buchner funnel, and the collected filtrate is the crude enzyme liquid.

[0032] (4) Add 1 g of lotus leaf powder to each of 9 50-mL centrifuge tubes, add 10 mL of the crude enzyme solution of each strain prepared in step (3) (the feed-enzyme ratio is 1:10), stir evenly, and then enzymolyze at 35°C for 6 h to obtain lotus leaf hydrolysate.

[0033] (5) To all the lotus leaf hydrolysates hydrolyzed by the crude enzyme solution of each strain in step (4), 15 mL of anhydrous ethanol (1.5 times the volume of the crude enzyme solution, 60% ethanol volume fraction of the system, and a solid-liquid ratio of 1:25) was added respectively, and the mixture was shaken and placed in an ultrasonic cleaner at 70° C. in a water bath, and ultrasonically extracted at 100 W for 60 min. The mixture was filtered with a Buchner funnel while hot, and the filtrate was collected and the total flavonoid content was determined by spectrophotometry.

[0034] Starting from step (4), 10 mL of enzyme-producing culture medium without inoculation of microorganisms was used instead of crude enzyme solution as a non-enzyme hydrolysis control; 10 mL of 2000 U / mL cellulase phosphate buffer (pH 6.0, 0.2 mol / L) was used instead of crude enzyme solution as a cellulase hydrolysis control. The total flavonoids extraction yields of lotus leaves hydrolyzed with crude enzyme solutions of different strains and the control are shown in Table 1.

[0035] Table 1 Total flavonoids extraction rate of lotus leaves hydrolyzed by different strains of crude enzyme solution and control

[0036]

[0037] As can be seen from the data in Table 1, after the lotus leaves were hydrolyzed with the crude enzyme solution prepared by fermentation of HY4 strain, the total flavonoids extraction rate was 5.64%, which was 19.2% higher than the control without hydrolysis of 4.73%. Treating lotus leaves with cellulase can also significantly improve the extraction rate of total flavonoids, which is 9.51% higher than the control without hydrolysis, but far less than the crude enzyme solution prepared by fermentation of HY4 strain. After the lotus leaves were hydrolyzed with the crude enzyme solution of some microbial strains, the extraction rate of total flavonoids did not increase, and even decreased, such as HY3 and HY8 strains. The above results show that the microbial enzyme-producing strains used for enzymatic hydrolysis of lotus leaves to improve the extraction rate of total flavonoids are selective, not only requiring the ability to produce enzymes to hydrolyze the lotus leaf cell wall components, but also requiring the inability to produce enzymes to degrade flavonoids. The present invention selects HY4 strain as the enzyme-producing strain to improve the extraction rate of total flavonoids in lotus leaves.

[0038] The PDA plate culture medium is prepared according to the following composition and method: wash and peel potatoes and cut them into small cubes with a side length of about 1 cm, weigh 200 g, add 1000 mL of tap water, boil for 20 minutes, filter through 4 layers of gauze to remove residues, make up the filtrate to 1000 mL, add 20 g of glucose and 20 g of agar, the pH is natural (measured at about 6.5), heat until the agar is dissolved, then divide it into Erlenmeyer flasks, sterilize it at 121° C. with high-pressure steam for 20 minutes, pour it into a sterile culture dish with a diameter of 9 cm before solidification, and 15-20 mL per dish.

[0039] The final concentration composition and preparation method of the enzyme production medium are: 40g / L wheat bran, 5g / L (NH4)2SO4, 4g / L peptone, 3g / L KH2PO4, 0.5g / L MgSO4·7H2O, 0.5g / L CaCl2, 0.1g FeSO4·7H2O, the solvent is tap water, pH 6.0. A 250-mL conical flask is filled with 50mL of enzyme production medium, the mouth is tied with 8 layers of gauze, and sterilized with high-pressure steam at 121°C for 20min.

[0040] The total flavonoid content is determined by spectrophotometry. The specific method is as follows: 2.5 mL of the total flavonoid sample solution to be measured (the sampling volume is appropriately adjusted depending on the total flavonoid concentration in the sample, and the control determination A 510 = 0.2–0.8, the solid total flavonoids crude extract was dissolved in a 60% ethanol aqueous solution), added to a 10-mL graduated test tube, 0.4 mL of a 5% sodium nitrite (NaNO2) aqueous solution was added, allowed to stand for 6 min, 0.6 mL of a 10% aluminum nitrate [Al(NO3)3] aqueous solution was added, allowed to stand for 6 min, 2 mL of a 20% sodium hydroxide (NaOH) aqueous solution was added, and the volume was made up to 10 mL with a 60% ethanol aqueous solution, shaken, allowed to stand for 15 min, and the absorbance at a wavelength of 510 nm was measured with a spectrophotometer (A 510), from the rutin standard curve ( Figure 2 ) to calculate the total flavonoids concentration in the sample, and then multiply the concentration by the volume of the measured sample to obtain the total flavonoids mass.

[0041] Drawing of rutin standard curve: Prepare 0.25g / L rutin standard solution with 60% ethanol aqueous solution. Take 0, 0.5, 1.0, 1.5, 2.0, 2.5mL of rutin standard solution in 10-mL graduated test tubes respectively, add 60% ethanol aqueous solution to 2.5mL, add 0.4mL of 5% sodium nitrite aqueous solution, let stand for 6min, add 0.6mL of 10% aluminum nitrate aqueous solution, let stand for 6min, add 2mL of 20% sodium hydroxide aqueous solution, and then dilute to 10mL with 60% ethanol aqueous solution, shake well, let stand for 15min, and measure the absorbance (A) at a wavelength of 510nm on a spectrophotometer. 510 ). With rutin concentration as the horizontal axis, A 510 Draw a standard curve for the ordinate ( Figure 2 ).

[0042] The yield of total flavonoids extracted from lotus leaves is calculated according to the following formula:

[0043]

[0044] Example 2: Mutation breeding of enzyme-producing strain HY4

[0045] The strain HY4 was subjected to mutation breeding to screen strains with better enzyme production performance. The specific method is as follows:

[0046] (1) Preparation of spore solution: After activating strain HY4 on PDA plate medium at 28°C for 48 hours, add 5 mL of sterile saline and stir with an inoculation loop to suspend the spores. Transfer 1 mL of spore solution to a conical flask containing 50 mL of sterile saline (with 20-30 glass beads) and shake at room temperature for 15 minutes. Filter the spore solution to remove the hyphae (plug a small ball of cotton wool at the bottom of the triangular funnel), count the spores in the filtrate under a microscope with a hemocytometer, and dilute it appropriately with sterile saline to adjust the number of spores to 1.46×10 7 Pieces / mL.

[0047] (2) Mutagenesis: Under red light illumination, take 1.0 mL of the above spore solution and a sterile paper clip and place them in 5 culture dishes with a diameter of 6 cm. The culture dishes are placed on magnetic stirrers and irradiated at a distance of 30 cm from a 15W ultraviolet lamp that has been preheated for 30 minutes for 1, 2, 3, 4, and 5 minutes. Take 0.5 mL of the spore solution after the above irradiation treatment, dilute it appropriately, and transfer 0.1 mL to spread on PDA plate culture medium. In the same way, dilute the spore solution that has not been irradiated with ultraviolet light and spread it on the plate as a control to calculate the lethality. The inoculated PDA plate is wrapped with black cloth and inverted at 28°C for 36 hours. The colonies on the plate are counted and the lethality is calculated.

[0048] (3) Screening: The colonies on the PDA plate with a lethality rate of more than 90% were picked and transferred to fresh PDA plate culture medium to obtain 38 strains. 10 mL of sterile physiological saline was added to the fresh plate culture of each strain after culturing at 28°C for 60 hours, and the spores were suspended by stirring with an inoculation loop to obtain the spore liquid of each strain. 2 mL of the spore liquid of each strain was taken and inoculated into 50 mL of enzyme production culture medium. After 72 hours of shaking culture at 30°C and 200 r / min, the fermentation liquid was filtered with a Buchner funnel, the filtrate was collected, and the cellulase activity of the fermentation filtrate of each strain was determined. 10 strains with a relatively higher enzyme activity than that of the wild strain were selected. According to the method of Example 1, the crude enzyme liquid fermented by these 10 strains was used to enzymatically hydrolyze lotus leaves, and the total flavonoids were extracted by ethanol ultrasonication. The total flavonoid extraction rate after the crude enzyme liquid of the mutant strains was enzymatically hydrolyzed into lotus leaves is shown in Table 2.

[0049] Table 2 Total flavonoids extraction rate after enzymatic hydrolysis of lotus leaves by crude enzyme solution of multiple screening mutant strains

[0050]

[0051] From the data in Table 2, it can be seen that among the 10 strains screened, the activity of the strain numbered HY4-25 in fermentation to produce cellulase is 122U / mL, which is 47.5% higher than the 83.4U / mL of the wild strain HY4. After the crude enzyme solution prepared by fermentation of the strain was used to hydrolyze lotus leaves, the total flavonoids extraction rate was 6.37%, which was 12.9% higher than the 4.73% of the wild strain HY4 and 34.7% higher than the 4.73% of the control without hydrolysis. Therefore, the present invention selects the HY4-25 strain as the enzyme-producing strain for improving the extraction rate of total flavonoids from lotus leaves.

[0052] The cellulase activity assay was performed by adding 1.5 mL of 1% sodium carboxymethyl cellulose solution (pH 6.0, prepared with 0.2 mol / L phosphate buffer) and 0.5 mL of crude enzyme solution to a 10-mL graduated test tube, respectively, and keeping the mixture in a 50°C water bath for 30 min. Then, 3 mL of DNS reagent was added and boiled for 5 min. After cooling with running water, the mixture was fixed to 10 mL with deionized water and shaken. The crude enzyme solution inactivated by boiling at 100°C for 10 min was used as a reference and the absorbance (A) at a wavelength of 540 nm was measured by a spectrophotometer. 540 ), based on the glucose standard curve ( Figure 3 ) Calculate the glucose concentration in the sample, and then calculate the cellulase activity (U / mL). Definition of cellulase activity: Under the conditions of pH 6.0 and 50°C, the amount of enzyme required to hydrolyze sodium carboxymethyl cellulose to produce 1 μg of glucose per minute is 1 enzyme activity unit (U).

[0053] The cellulase activity was calculated according to the following formula (1).

[0054]

[0055] In formula (1), C: glucose concentration (mg / mL) calculated from the standard curve; V1: volume of enzyme reaction system, i.e. 2 mL; T: reaction time, i.e. 30 min; V2: volume of crude enzyme solution, i.e. 0.5 mL.

[0056] Drawing of glucose standard curve: Add 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 mL of standard glucose solution with a concentration of 1 mg / mL to 6 10-mL graduated test tubes, then add 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, 0.8 mL of pH 6.0, 0.2 mol / L phosphate buffer, and then add 3.0 mL of DNS solution. Boil the mixture in a boiling water bath for 5 min, cool it in running water, dilute it to 10 mL with deionized water, shake it well, and measure A in a spectrophotometer. 540 , with glucose concentration as the horizontal axis, A 540 Draw a standard curve for the ordinate ( Figure 3 ).

[0057] Preparation of DNS reagent: Add 6.3g of 3,5-dinitrosalicylic acid and 262mL of 2mol / L NaOH aqueous solution to 500mL of hot aqueous solution containing 182g of sodium tartrate, then add 5g of redistilled phenol and 5g of sodium sulfite, stir to dissolve, cool, add deionized water to make up to 1L, store in a brown bottle, and use after 7 days.

[0058] Example 3: Classification and Identification of Strain HY4-25

[0059] Strain HY4-25 was streaked on a PDA plate medium. After culturing at 28°C for 48 hours, the front of the colony was black with a large number of black particles on the surface, and the center of the reverse colony was yellow-brown with no exudate. There was no soluble pigment in the culture medium. The conidiophores were generated in the matrix with a diameter of 10–15 μm. The apical capsule was nearly spherical with a diameter of 50–70 μm. The apical capsule was surrounded by double-layered conidial stalks of varying lengths. Conidia were produced on the outer stalks, and the conidial heads were in the typical "chrysanthemum" shape. The conidia were brown spherical with a diameter of 3.0–4.0 μm and a rough surface. The colony photos of Aspergillus niger HY4-25 cultured on a PDA plate medium at 28°C for 48 hours are shown in Figure 1 .

[0060] The rDNA-ITS nucleotide sequence of strain HY4-25 was measured as shown in SEQ ID NO.1. The sequence was compared by BLAST at NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov), and had 100% homology with the rDNA-ITS sequences of typical strains Aspergillus niger ATCC16888, Aspergillus foetidus CBS 121.28, and Aspergillus welwitschiae CBS139.54. However, the colony morphology of strain HY4-25 was more consistent with that of Aspergillus niger, so the biological classification position of strain HY4-25 was determined as follows (refer to Mycobank, http: / / www.mycobank.org): Fungi, Ascomycota, Pezizomycotina, Eurotiomycetes, Eurotiomycetidae, Eurotiales, Aspergillaceae, Aspergillus, Aspergillus niger.

[0061] The rDNA sequence of the ITS region is:

[0062] CCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCG TGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGA GTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTTGGGTCGCCGTCCCTCTCCGGGGGGACGGGCCCGAAAGG CAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATAC.

[0063] In summary, strain HY4 was isolated from the lotus leaf powder microbial enrichment, and after ultraviolet mutagenesis, strain HY4-25, namely Aspergillus niger HY4-25, was screened and obtained. The strain is deposited in Guangdong Microbiological Culture Collection Center, with the deposit number: GDMCC No: 62851, the deposit date is September 25, 2022, and the address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province; Postal Code 510070.

[0064] Example 4: Application of Aspergillus niger HY4-25 enzymatic hydrolysis to extract total flavonoids from lotus leaves

[0065] The total flavonoids in lotus leaves can be extracted by enzymatic hydrolysis with Aspergillus niger HY4-25 in the following steps:

[0066] (1) The spore powder of Aspergillus niger HY4-25 stored in a freeze-dried tube was inoculated into a fresh PDA plate culture medium and cultured at 30° C. for 60 h. 10 mL of sterile physiological saline was added to the plate culture medium and stirred with an inoculation loop to suspend the spores to obtain a spore liquid of Aspergillus niger HY4-25. The components and preparation method of the PDA plate culture medium are the same as those in Example 1.

[0067] (2) 2 mL of the spore liquid prepared in step (1) was used to inoculate 50 mL of the enzyme production medium (the inoculation amount was 4% by volume), and the culture was carried out at 30° C. and 200 r / min shaking conditions for 72 h to obtain a fermentation liquid with a dry cell concentration of 5.22 g / L. The entire fermentation liquid was filtered with a Buchner funnel, and the collected filtrate was the crude enzyme liquid, and the cellulase activity of the filtrate was 119 U / mL. The final concentration composition and preparation method of the enzyme production medium were the same as those in Example 1.

[0068] (3) 5 g of lotus leaf powder was placed in a 250-mL conical flask, and 50 mL of the crude enzyme solution prepared in step (2) (the feed-enzyme ratio was 1:10) was added. After stirring evenly, the mixture was enzymolyzed at 35° C. for 6 h to obtain lotus leaf hydrolysate.

[0069] (4) Add 75 mL of anhydrous ethanol (1.5 times the volume of the crude enzyme solution, 60% ethanol volume fraction, solid-liquid ratio 1:25) to all the lotus leaf hydrolysates in step (3), shake well, place in an ultrasonic cleaner in a 70°C water bath, perform ultrasonic extraction at a power of 100 W for 60 min, and filter with a Buchner funnel to obtain a total flavonoid extract.

[0070] (5) The total flavonoid extract prepared in step (4) was distilled at 45°C and -0.1 MPa under reduced pressure until no liquid flowed out, 40 mL of anhydrous ethanol (8 mL / g based on the mass of the raw lotus leaf powder) was added, and after sufficient oscillation, it was transferred into a centrifuge tube and centrifuged at 8000 r / min for 5 min. The supernatant was distilled at 45°C and -0.1 MPa to about 4 mL, and transferred into a clean culture dish and dried under vacuum at 50°C and -0.1 MPa to obtain a total flavonoid extract.

[0071] According to the above steps, 0.815 g of total flavonoid extract was obtained, and the total flavonoid content was 37.5%, that is, 0.306 g of total flavonoids was obtained, and the extraction yield was 6.12%.

[0072] Comparative Example 1: Extraction of total flavonoids from lotus leaves by conventional ethanol ultrasonic method (compared with Example 4)

[0073] (1) 5 g of lotus leaf powder was placed in a 250-mL conical flask, and 125 mL of 60% ethanol aqueous solution (solid-liquid ratio was 1:25) was added. After shaking, the mixture was placed in an ultrasonic cleaner in a 70°C water bath and ultrasonically extracted at a power of 100 W for 60 min. The total flavonoids extract was filtered using a Buchner funnel to obtain the extract.

[0074] (2) The total flavonoid extract prepared in step (1) was distilled at 45°C and -0.1 MPa under reduced pressure until no liquid flowed out, 40 mL of anhydrous ethanol (8 mL / g based on the mass of the raw lotus leaf powder) was added, and after sufficient shaking, it was transferred into a centrifuge tube and centrifuged at 8000 r / min for 5 min. The supernatant was distilled at 45°C and -0.1 MPa to about 4 mL, and transferred into a clean culture dish and vacuum dried at 50°C and -0.1 MPa to obtain a total flavonoid extract.

[0075] According to the above steps, 0.645 g of total flavonoid extract was obtained, and the total flavonoid content was 35.4%, that is, 0.228 g of total flavonoids was obtained, and the extraction yield was 4.56%.

[0076] Comparing the results of Example 4 and Comparative Example 1, it can be seen that before extracting total flavonoids from lotus leaves, enzymatic hydrolysis of crude enzyme solution prepared by fermentation of Aspergillus niger HY4-25 was added, and the extraction rate of total flavonoids increased from 4.56% to 6.12%, an increase of 34.2%.

[0077] Example 5: Application of Aspergillus niger HY4-25 enzymatic hydrolysis to extract total flavonoids from lotus leaves

[0078] The total flavonoids in lotus leaves can be extracted by enzymatic hydrolysis with Aspergillus niger HY4-25 in the following steps:

[0079] (1) The spores of the PDA colony of Aspergillus niger HY4-25 stored at 4°C were inoculated into a fresh PDA plate culture medium and cultured at 30°C for 54 h. 10 mL of sterile physiological saline was added to the plate culture and the spores were suspended by stirring with an inoculating loop to obtain a spore solution of Aspergillus niger HY4-25. The components and preparation method of the PDA plate culture medium were the same as those in Example 1.

[0080] (2) 5 mL of the spore liquid prepared in step (1) was used to inoculate 100 mL of the enzyme production medium (the inoculation amount was 5% by volume), and the mixture was cultured at 30°C and 250 r / min under shaking conditions for 68 h to obtain a fermentation liquid with a dry cell concentration of 5.36 g / L. All the fermentation liquid was filtered with a Buchner funnel, and the collected filtrate was the crude enzyme liquid, and the cellulase activity of the filtrate was 127 U / mL. The final concentration composition of the enzyme production medium was the same as that of Example 1, and 100 mL of the enzyme production medium was placed in a 250-mL conical flask, which was tied with 8 layers of gauze and sterilized with high-pressure steam at 121°C for 20 min.

[0081] (3) 10 g of lotus leaf powder was placed in a 500-mL conical flask, and 80 mL of the crude enzyme solution prepared in step (2) (the feed:enzyme ratio was 1:8) was added. After stirring evenly, the mixture was hydrolyzed at 40° C. for 5 h to obtain lotus leaf hydrolysate.

[0082] (4) Add 160 mL of anhydrous ethanol (twice the volume of the crude enzyme solution, 66.7% ethanol volume fraction of the system, and a solid-liquid ratio of 1:24) to all the lotus leaf hydrolysates in step (3), shake well, place in an ultrasonic cleaner in a 75°C water bath, perform ultrasonic extraction at a power of 150 W for 50 min, and filter with a Buchner funnel to obtain a total flavonoid extract.

[0083] (5) The total flavonoid extract prepared in step (4) was distilled under reduced pressure at 45°C and -0.1 MPa until no liquid flowed out, 60 mL of anhydrous ethanol (6 mL / g based on the mass of the raw lotus leaf powder) was added, and after sufficient shaking, it was transferred into a centrifuge tube and centrifuged at 8000 r / min for 10 min. The supernatant was distilled to about 6 mL at 45°C and -0.1 MPa, transferred into a clean culture dish, and vacuum dried at 50°C and -0.1 MPa to obtain a total flavonoid extract.

[0084] According to the above steps, 1.66 g of total flavonoid extract was obtained, and the total flavonoid content was 38.2%, that is, 0.634 g of total flavonoids was obtained, and the extraction yield was 6.34%.

[0085] Comparative Example 2: Extraction of total flavonoids from lotus leaves by conventional ethanol ultrasonic method (compared with Example 5)

[0086] (1) 10 g of lotus leaf powder was placed in a 500-mL conical flask, and 240 mL of 66.7% ethanol aqueous solution (solid-liquid ratio was 1:24) was added. After shaking, the mixture was placed in an ultrasonic cleaner in a 75°C water bath and ultrasonically extracted at a power of 150 W for 50 min. The total flavonoids extract was filtered using a Buchner funnel to obtain the extract.

[0087] (2) The total flavonoid extract prepared in step (1) was distilled under reduced pressure at 45°C and -0.1 MPa until no liquid flowed out, 60 mL of anhydrous ethanol (6 mL / g based on the mass of the raw lotus leaf powder) was added, and after sufficient shaking, it was transferred into a centrifuge tube and centrifuged at 8000 r / min for 10 min. The supernatant was distilled to about 6 mL at 45°C and -0.1 MPa, transferred into a clean culture dish, and vacuum dried at 50°C and -0.1 MPa to obtain a total flavonoid extract.

[0088] According to the above steps, 1.27 g of total flavonoid extract was obtained, and the total flavonoid content was 36.6%, that is, 0.465 g of total flavonoids was obtained, and the extraction yield was 4.65%.

[0089] Comparing the results of Example 5 and Comparative Example 2, it can be seen that before extracting total flavonoids from lotus leaves, enzymatic hydrolysis of the crude enzyme solution prepared by fermentation of Aspergillus niger HY4-25 was added, and the total flavonoid extraction rate was increased from 4.65% to 6.34%, an increase of 36.3%.

[0090] Example 6: Application of Aspergillus niger HY4-25 enzymatic hydrolysis to extract total flavonoids from lotus leaves

[0091] The total flavonoids in lotus leaves can be extracted by enzymatic hydrolysis with Aspergillus niger HY4-25 in the following steps:

[0092] (1) The spores of the PDA colony of Aspergillus niger HY4-25 stored at 4°C were inoculated into a fresh PDA plate culture medium and cultured at 30°C for 54 h. 10 mL of sterile physiological saline was added to the plate culture and the spores were suspended by stirring with an inoculating loop to obtain a spore solution of Aspergillus niger HY4-25. The components and preparation method of the PDA plate culture medium were the same as those in Example 1.

[0093] (2) 18 mL of the spore liquid prepared in step (1) was used to inoculate 300 mL of the enzyme production medium (the inoculation amount was 6% by volume), and the mixture was cultured at 30°C and 250 r / min under shaking conditions for 64 h to obtain a fermentation liquid with a dry cell concentration of 5.17 g / L. All the fermentation liquid was filtered with a Buchner funnel, and the collected filtrate was the crude enzyme liquid, and the cellulase activity of the filtrate was 116 U / mL. The final concentration composition of the enzyme production medium was the same as that in Example 1, 300 mL of the enzyme production medium was placed in a 1-L conical flask, the mouth was tied with 8 layers of gauze, and sterilized with high-pressure steam at 121°C for 20 min.

[0094] (3) 50 g of lotus leaf powder was placed in a 1-L conical flask, and 300 mL of the crude enzyme solution prepared in step (2) (the feed:enzyme ratio was 1:6) was added. After stirring evenly, the mixture was hydrolyzed at 40°C for 4 h to obtain lotus leaf hydrolysate.

[0095] (4) Add 600 mL of anhydrous ethanol (twice the volume of the crude enzyme solution, 66.7% ethanol volume fraction of the system, and a solid-liquid ratio of 1:18) to all the lotus leaf hydrolysates in step (3), shake well, place in an ultrasonic cleaner in a 75°C water bath, perform ultrasonic extraction at a power of 200 W for 40 min, and filter with a Buchner funnel to obtain a total flavonoid extract.

[0096] (5) The total flavonoid extract prepared in step (4) was distilled under reduced pressure at 45°C and -0.1 MPa until no liquid flowed out, 200 mL of ethanol (4 mL / g based on the mass of the raw lotus leaf powder) was added, and after sufficient oscillation, it was transferred into a centrifuge tube and centrifuged at 8000 r / min for 10 min. The supernatant was distilled at 45°C and -0.1 MPa to about 20 mL, and evenly distributed into 2 clean culture dishes, and vacuum dried at 50°C and -0.1 MPa to obtain the total flavonoid extract.

[0097] According to the above steps, 8.25 g of total flavonoid extract was obtained, and the total flavonoid content was 38.3%, that is, 3.16 g of total flavonoids were obtained, and the extraction yield was 6.32%.

[0098] Comparative Example 3: Extraction of total flavonoids from lotus leaves by conventional ethanol ultrasonic method (compared with Example 6)

[0099] (1) 50 g of lotus leaf powder was placed in a 1-L conical flask, and 900 mL of 66.7% ethanol aqueous solution (solid-liquid ratio was 1:18) was added. After shaking, the mixture was placed in an ultrasonic cleaner in a 75°C water bath and ultrasonically extracted at a power of 200 W for 40 min. The total flavonoids extract was filtered using a Buchner funnel to obtain the extract.

[0100] (2) The total flavonoid extract prepared in step (1) was distilled under reduced pressure at 45°C and -0.1 MPa until no liquid flowed out, 200 mL of ethanol (4 mL / g based on the mass of the raw lotus leaf powder) was added, and after sufficient oscillation, the mixture was transferred into a centrifuge tube and centrifuged at 8000 r / min for 10 min. The supernatant was distilled to about 20 mL at 45°C and -0.1 MPa, and evenly distributed into 2 clean culture dishes, and vacuum dried at 50°C and -0.1 MPa to obtain a total flavonoid extract.

[0101] According to the above steps, 6.31 g of total flavonoid extract was obtained, and the total flavonoid content was 37.1%, that is, 2.34 g of total flavonoids were obtained, and the extraction yield was 4.68%.

[0102] By comparing the results of Example 6 and Comparative Example 3, it can be seen that before extracting total flavonoids from lotus leaves, enzymatic hydrolysis of the crude enzyme solution prepared by fermentation of Aspergillus niger HY4-25 was added, and the total flavonoid extraction rate was increased from 4.68% to 6.32%, an increase of 35.0%.

Claims

1. Aspergillus niger HY4-25, deposited in Guangdong Microbiological Culture Collection Center, deposit number: GDMCC No: 62851, deposit date September 25, 2022, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province; Postal Code: 510070.

2. Use of the Aspergillus niger HY4-25 according to claim 1 in extracting total flavonoids from lotus leaves.

3. The use according to claim 2, characterized in that The application method is as follows: (1) filtering the fermentation liquid obtained by culturing Aspergillus niger HY4-25, and collecting the filtrate as the crude enzyme liquid; (2) mixing the crude enzyme liquid with lotus leaf powder, performing enzymolysis at 35-40° C. for 4-6 hours, and then adding anhydrous ethanol in an amount of 1.5-2.0 times the volume of the crude enzyme liquid to the enzymolysis system for ultrasonic extraction, and filtering to obtain a total flavonoid extract; (3) evaporating the total flavonoid extract to dryness under reduced pressure, dissolving it in ethanol, concentrating it, and vacuum drying it to obtain a total flavonoid extract.

4. The use according to claim 3, characterized in that The preparation method of the crude enzyme solution in step (1) is as follows: inoculating Aspergillus niger HY4-25 spores into an enzyme production medium, culturing at 30°C and 200-250 r / min for 64-72 hours, filtering the fermentation liquid, and obtaining the filtrate as the crude enzyme solution; the final concentration composition of the enzyme production medium is as follows: 30-40 g / L wheat bran, 5-6 g / L (NH4)2SO4, 3-4 g / L peptone, 3-5 g / L KH2PO4, 0.5-1.0 g / L MgSO4·7H2O, 0.3-0.5 g / L CaCl2, 0.1-0.2 g FeSO4·7H2O, and the solvent is tap water with a pH of 6.0-6.

5.

5. The use according to claim 4, characterized in that The enzyme production culture medium is composed of: 40 g / L wheat bran, 5 g / L (NH4)2SO4, 4 g / L peptone, 3 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.5 g / L CaCl2, 0.1 g FeSO4·7H2O, the solvent is tap water, and the pH value is 6.

0.

6. The use according to claim 4, characterized in that Before the enzyme production culture, the Aspergillus niger HY4-25 is first cultured on a plate culture medium to produce spores, and then the spores are suspended in physiological saline and inoculated into the enzyme production culture medium at a volume fraction of 4%-6% for culture. The specific enzyme production culture method is: ① Preparation of spore liquid: inoculate Aspergillus niger HY4-25 into a PDA plate culture medium, culture at 28-30°C for 54-60 hours to obtain a plate culture; add sterile physiological saline to the plate culture, stir with an inoculation loop to suspend the spores, and obtain Aspergillus niger HY4-25 spore liquid; the final concentration of the PDA plate culture medium is as follows: 200 g / L potato, 20 g / L glucose, 20 g / L agar, the solvent is tap water, and the pH is natural; ② Enzyme production culture: the Aspergillus niger HY4-25 spore liquid after activation culture in step ① is inoculated at a volume fraction of 4%-6%, inoculated into the enzyme production culture medium, and cultured at 30° C. and 200-250 r / min with shaking for 64-72 hours to obtain the fermentation liquid.

7. The use according to claim 3, characterized in that The volume dosage of the crude enzyme solution in step (2) is 6-10 mL / g based on the mass of lotus leaf powder.

8. The use according to claim 3, characterized in that The lotus leaf powder in step (2) is obtained by drying fresh lotus leaves at 85° C., crushing the leaves, and passing through a 40-mesh sieve to obtain fine powder.

9. The use according to claim 3, characterized in that The preparation method of the total flavonoids extract in step (2) is as follows: after the enzymatic hydrolysis of the lotus leaves is completed, anhydrous ethanol in an amount of 1.5-2.0 times the volume of the crude enzyme solution is added to the system, the mixture is stirred evenly and placed in an ultrasonic cleaning machine with a water bath temperature of 70-75° C., and extracted at 100-200W for 40-60 minutes; after the ultrasonic alcohol extraction is completed, the mixture is filtered while hot to obtain the total flavonoids extract.

10. The use according to claim 3, characterized in that The method for recovering total flavonoids from the total flavonoid extract in step (3) is as follows: the total flavonoid extract is distilled at 45° C. and −0.1 MPa until no liquid flows out, anhydrous ethanol is added in a volume of 4-8 mL / g based on the mass of the raw lotus leaf, the mixture is fully shaken and centrifuged at 8000 r / min for 5-10 min, the supernatant is distilled at 45° C. and −0.1 MPa to 1 / 10 of the original volume, and vacuum dried at 50° C. and −0.1 MPa to obtain a total flavonoid extract.

Images