Process for the preparation and use of acyl-coa oxidase

By using genetic engineering screening and synonymous codon optimization, combined with E. coli expression vectors and chromatography column purification, the problem of large-scale production of acyl-CoA oxidase was solved, achieving efficient and low-cost enzyme preparation.

CN116042664BActive Publication Date: 2025-11-04GUANGZHOU DAYUANQI BIOTECHNOLOGY CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211704989.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-29
Publication Date
2025-11-04
Estimated Expiration
2042-12-29

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve large-scale industrial production of acyl-CoA oxidase. Traditional preparation methods are complex and have low yields, while genetic engineering preparation is limited by inclusion body expression and poor enzyme activity.

Method used

We screened bacterial strains that could express highly active soluble acyl-CoA oxidase using genetic engineering techniques, optimized synonymous codon bias, used E. coli expression vectors such as pET-28a(+), and obtained high-purity enzymes through column chromatography. We then optimized the preparation method to suit industrial production.

Benefits of technology

This method enables the preparation of acyl-CoA oxidase with high enzyme activity, high expression level, and low cost, simplifies the purification process, and is suitable for large-scale industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116042664B_ABST
    Figure CN116042664B_ABST
Patent Text Reader

Abstract

The application discloses a preparation method and application of acyl-CoA oxidase. In the application, a strain source capable of expressing soluble acyl-CoA oxidase with high enzyme activity is screened from a large number of acyl-CoA oxidase-containing strain sources through genetic engineering technology, and a corresponding industrial production method of acyl-CoA oxidase is provided. The method has simple purification steps, high enzyme activity, high protein expression amount and low production cost.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular to a preparation method and application of acyl-CoA oxidase. BACKGROUND

[0002] Acyl-CoA oxidase (ACX / ACO) is widely present in various organisms, located in peroxisomes, and involved in the first step of the beta oxidation of various fatty acids in peroxisomes. The enzyme is also a rate-limiting enzyme for the activation metabolism of fatty acids. The ACX gene family has six isozymes, which can be divided into three categories according to the recognition of carbon chain length in the catalytic reaction. They are: long-chain ACX (LACX) for recognizing long-chain fatty acids, medium-chain ACX (MACX) for recognizing medium-chain fatty acids, and short-chain ACX (SACX) for recognizing short-chain fatty acids. In the field of in vitro diagnosis, acyl-CoA oxidase catalyzes the oxidation reaction of acyl-CoA, which can be used for the detection of free fatty acid concentration in blood.

[0003] Acyl-CoA oxidase can be prepared from natural products such as plants and microorganisms. Such preparation methods usually use Tris-HCl buffer and potassium phosphate buffer extraction method. In order to improve the purity, multiple purification processes are often used, such as: acetone extraction, heat treatment, ammonium sulfate precipitation and phenyl sepharose chromatography, and hydroxyapatite molecular sieve column. These steps are complex, require multiple materials, and have low yield, which is difficult to apply to large-scale industrial production. For example, the document “Purification and Properties of Acyl-CoA Oxidase from Candida tropicalis” discloses a method for extracting and purifying the target protein from Candida tropicalis. The method has low yield, and the specific activity of the product is only 21.8 U / mg. Based on genetic engineering, the preparation of recombinant acyl-CoA oxidase is suitable for industrial preparation, but it is still difficult to achieve large-scale industrial production due to factors such as most of the products being inclusion bodies and poor enzyme activity. Therefore, there is still a need to develop a suitable large-scale industrial production method for acyl-CoA oxidase. SUMMARY

[0004] The purpose of the present application is to provide a preparation method of acyl-CoA oxidase.

[0005] Another purpose of the present application is to provide a polynucleotide sequence encoding acyl-CoA oxidase.

[0006] Another purpose of the present application is to provide a vector adapted to the polynucleotide sequence encoding acyl-CoA oxidase.

[0007] Another purpose of the present application is to provide a kit containing a polynucleotide sequence encoding acyl-CoA oxidase.

[0008] To solve the above technical problems, the present application provides a polynucleotide encoding acyl-CoA oxidase, wherein the polynucleotide is codon-optimized, and the polynucleotide is selected from any one of the following:

[0009] (i) a polynucleotide having a sequence as shown in SEQ ID NO. 1;

[0010] (ii) a polynucleotide having a sequence with a homology of more than 95% to the sequence as shown in SEQ ID NO. 1; and

[0011] (iii) a polynucleotide complementary to the polynucleotide sequence as described in (i) or (ii).

[0012] The present application provides an expression vector comprising the polynucleotide according to the first aspect of the present application.

[0013] In some preferred embodiments, the expression vector is an Escherichia coli expression vector, more preferably pET-28a(+).

[0014] The present application provides a host cell comprising the expression vector according to the second aspect of the present application; or

[0015] the genome of the host cell is integrated with the polynucleotide according to the first aspect of the present application.

[0016] In some preferred embodiments, the host cell is Escherichia coli.

[0017] In some preferred embodiments, the host cell is Escherichia coli BL21(DE3) strain.

[0018] The present application provides a method for preparing acyl-CoA oxidase, comprising the steps of: culturing the host cell according to the third aspect of the present application to express the target protein; and

[0019] isolating the target protein, thereby obtaining the acyl-CoA oxidase;

[0020] In some preferred embodiments, the host cell is obtained by transforming Escherichia coli with a plasmid containing the polynucleotide according to the first aspect of the present application.

[0021] In some preferred embodiments, the host cell is cultured using SB, TB, LB, or SOC medium, more preferably TB medium.

[0022] In some preferred embodiments, the host cell is cultured in a shaking environment.

[0023] In some preferred embodiments, the host cell is cultured at a temperature of 16 to 19℃ or 35 to 39℃, more preferably at a temperature of 16 to 19℃.

[0024] In some preferred embodiments, the host cell is cultured in a culture medium containing a kanamycin resistance gene.

[0025] In some preferred embodiments, the host cell is cultured, and IPTG is used for induction to express the target protein.

[0026] In some preferred embodiments, the host cell is cultured, and then IPTG is used for induction to express the target protein, until the OD600 is 0.6 to 0.8.

[0027] In some preferred embodiments, the step of isolating the target protein comprises:

[0028] The supernatant of the broken target protein is eluted from the chromatography column with the mobile phase, and the eluate is collected.

[0029] In some preferred embodiments, the chromatography column is a Ni-column affinity chromatography column (Ni-NTA).

[0030] The fifth aspect of the present application provides a kit comprising: the polynucleotide provided in the first aspect of the present application; or

[0031] the expression vector provided in the second aspect of the present application; or

[0032] the host cell provided in the third aspect of the present application; or

[0033] or the acyl-CoA oxidase prepared according to the method of the fourth aspect of the present application.

[0034] The present application has at least the following advantages over the prior art:

[0035] (1) The present application screens a strain source that can express high-enzyme-activity soluble acyl-CoA oxidase from a large number of acyl-CoA oxidase-containing strain sources by genetic engineering technology, and provides a corresponding method for industrial production of acyl-CoA oxidase, which has simple purification steps, high enzyme activity, high protein expression, and low production cost.

[0036] (2) In the preferred embodiments of the present application, the optimized codon with high soluble expression is obtained by screening through synonymous codon bias optimization, which further improves the yield and production efficiency.

[0037] It should be understood that, in the scope of the present application, the above technical features of the present application and the technical features specifically described in the following (such as the examples) can be combined with each other to form new or preferred technical solutions. Due to the limited space, they will not be listed one by one here. BRIEF DESCRIPTION OF DRAWINGS

[0038] One or more embodiments are illustrated by the pictures in the drawings corresponding thereto, which do not constitute a limitation on the embodiments.

[0039] Figure 1 is the SDS-PAGE identification chart of the expression product of the acyl-CoA oxidase from B. barnesi derived according to the embodiments of the present application in LB medium (the recombinant plasmid contains optimized codon I);

[0040] Figure 2 is the SDS-PAGE identification chart of the expression product of the acyl-CoA oxidase from B. barnesi derived according to the embodiments of the present application in TB medium (the recombinant plasmid contains optimized codon I);

[0041] Figure 3 is the SDS-PAGE identification chart of the expression product of the acyl-CoA oxidase from B. barnesi derived according to the embodiments of the present application in TB and LB medium at 18℃;

[0042] Figure 4 is the SDS-PAGE identification chart of the expression product of the acyl-CoA oxidase from B. barnesi derived according to the embodiments of the present application in TB and LB medium at 18℃;

[0043] Figure 5 is the SDS-PAGE chart of the purified acyl-CoA oxidase from B. barnesi derived according to the embodiments of the present application (the recombinant plasmid contains optimized codon I);

[0044] Figure 6 is the standard curve chart of the acyl-CoA oxidase activity measurement according to the embodiments of the present application. DETAILED DESCRIPTION

[0045] The inventors have developed a method for preparing acyl-CoA oxidase with high enzyme activity based on genetic engineering, which improves the expression of soluble protein and is suitable for industrial large-scale production. The development of the method for preparing acyl-CoA oxidase with high enzyme activity based on genetic engineering in the present application is based on the following procedures: S1: first, the strain source is screened by genetic engineering technology, and strains that express products as inclusion bodies in Escherichia coli are discarded; S2: the supernatant soluble protein crude product is collected for enzyme activity detection, and strains that express products without enzyme activity in Escherichia coli are further discarded, and a strain source that has soluble expression and high enzyme activity in Escherichia coli is selected; S3: the gene sequence encoding acyl-CoA oxidase in the finally selected strain source is subjected to synonymous codon bias optimization, and the optimized codon with high soluble protein yield is selected from several optimized codons, and a matching acyl-CoA oxidase expression method is developed based on the optimized codon to obtain a large amount of soluble acyl-CoA oxidase with high enzyme activity.

[0046] The method for preparing acyl-CoA oxidase suitable for industrial large-scale production in the present application involves 1) a step of obtaining a target gene / obtaining a nucleic acid sequence related to a target protein; 2) a step of obtaining an optimized codon by optimizing the synonymous codon of the target gene; 3) a step of introducing the optimized codon into a vector; 4) a step of introducing the vector into a host cell; and 5) a step of culturing the host cell and obtaining the target protein. Preferably, it also involves 6) a step of purifying the target protein.

[0047] Obtaining a target gene / obtaining a nucleic acid sequence related to a target protein

[0048] The nucleic acid sequence related to the target gene or the target protein in the present application is obtained by analyzing the amino acid sequences of acyl-CoA oxidases in different strains. Different biological sources of the same protein have different amino acid sequences, and the gene sequence obtained based on different sources of the target protein usually has unpredictable functional activity. In an embodiment of the present application, the amino acid sequences of a large number of different sources of the target protein are analyzed by NCBI database to obtain the sequence information of the target gene from different sources. In some embodiments, the acyl-CoA oxidases from Barnase, amoeba and Pseudomonas are analyzed by NCBI database to obtain the corresponding acyl-CoA oxidase gene sequence information.

[0049] After obtaining the sequence information of the target protein, the polynucleotide sequence can be prepared by methods well known to those skilled in the art. The full-length nucleotide sequence of the target protein or its element or a fragment thereof can be obtained by PCR amplification, recombination or artificial synthesis in the present application. For PCR amplification, primers can be designed according to the published nucleotide sequence, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared according to the conventional method known to those skilled in the art can be used as a template for amplification to obtain the relevant sequence. When the sequence is long, two or more PCR amplifications are often required, and then the fragments amplified in each amplification are spliced together in the correct order.

[0050] Once the relevant sequence is obtained, recombination can be used to obtain the relevant sequence in large quantities. This is usually by cloning it into a vector, then into cells, and then separating the relevant sequence from the proliferated host cells by conventional methods.

[0051] In addition, the relevant sequence can also be synthesized by artificial synthesis method, especially when the length of the fragment is short. Generally, a long fragment of sequence can be obtained by first synthesizing a plurality of small fragments and then connecting them.

[0052] The method of amplifying DNA / RNA by PCR technology is preferably used to obtain the gene of the present application. The primers for PCR can be appropriately selected according to the sequence information of the present application disclosed herein, and can be synthesized by conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as gel electrophoresis.

[0053] Synonymous codon preference optimization

[0054] The present application relates to polynucleotide sequences optimized by synonymous codon preference. The obtained target gene sequence is optimized by synonymous codon preference, and the target gene sequence optimized by synonymous codon preference can express the same amino acid sequence as the target protein. In some embodiments of the present application, Escherichia coli synonymous codon preference optimization is performed on the gene sequence from Barnardia, and several optimized codons are obtained, exemplarily the optimized codon I shown in SEQ ID NO: 1, the optimized codon IV shown in SEQ ID NO: 4-7, the optimized codon V, the optimized codon VI and the optimized codon VII. In another embodiment, Escherichia coli synonymous codon preference optimization is performed on the gene sequence from Amoeba, and several optimized codons are obtained, exemplarily the optimized codon II shown in SEQ ID NO: 2. In another embodiment, Escherichia coli synonymous codon preference optimization is performed on the gene sequence from Pseudomonas, and several optimized codons are obtained, exemplarily the optimized codon III shown in SEQ ID NO: 3.

[0055] The same source of the target protein gene, the optimized codons obtained by different ways of synonymous codon bias optimization, generally, these optimized codons can express active target proteins in host cells, but the expression amount is not the same. In some embodiments of the present application, the optimized codons obtained by Escherichia coli synonymous codon bias optimization of the acyl-CoA oxidase gene sequence from Barnesiella genus, a large number of inclusion bodies are expressed, and part of them are soluble expression, for example, optimized codon I and optimized codon V, optimized codon VI and optimized codon VII, only optimized codon I has soluble expression. Under the same conditions, the soluble protein expression amount of the optimized codons with soluble expression also has obvious differences, for example, optimized codon I and optimized codon IV, the soluble protein expression amount of optimized codon I introduced into Escherichia coli is obviously higher than that of optimized codon IV.

[0056] The expression products obtained by introducing the target protein genes from different sources and optimized by synonymous codon bias optimization into host cells have large activity differences. In an embodiment, the expression products of optimized codon I from Barnesiella genus and optimized codon II from Amoeba genus optimized by Escherichia coli synonymous codon bias optimization have significant activity differences in Escherichia coli, and only optimized codon I from Barnesiella genus has enzyme activity.

[0057] The present application also relates to polynucleotides having more than 80%, preferably more than 85%, more preferably more than 90%, more preferably more than 91%, more preferably more than 95% homology with the sequences shown in SEQ ID NO: 1-7; and polynucleotides complementary to the sequences shown in SEQ ID NO: 1-7.

[0058] Vector of target gene

[0059] The present application also relates to vectors comprising the polynucleotides (optimized codons) of the present application. "Vectors" in the present application mean linear or circular DNA molecules comprising a segment encoding a protein of interest operably linked to other segments that provide for its transcription. Such additional segments can include promoter and terminator sequences, and can optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, vectors, etc. The vector segment can be derived from a host organism, another organism, a plasmid or viral DNA, or can be synthetic. The vector can be any expression vector, synthetic or conveniently manipulated by recombinant DNA techniques, the choice of vector depending largely on the host cells into which it is to be introduced. Thus, the vector can be an autonomously replicating vector, i.e., a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid. Alternatively, the vector can be one which, when introduced into a host cell, is integrated into the DNA of the cell, and replicated together with the cellular DNA. In one embodiment, the vector of the present application is an expression vector. In one embodiment of the present application, pET-28a(+) is selected as the vector to achieve higher expression efficiency.

[0060] Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequences of the present application and appropriate transcriptional / translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, etc. The DNA sequences described can be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Illustratively, the vector DNA molecule is cleaved by an endonuclease into a linear molecule that can be ligated to the foreign gene, and then the codon-optimized gene fragment of interest is ligated to the vector, which can be achieved by using a single restriction site cohesive end ligation, directional cloning of double restriction enzyme cleavage fragments, cohesive end ligation of different restriction enzyme cleavage sites, blunt end ligation, artificial linker ligation, or ligation of the foreign DNA fragment with oligonucleotide ends.

[0061] Transformation of host cells with vectors containing the gene of interest

[0062] The present application also relates to host cells genetically engineered with the vector or the fusion protein coding sequence of the present application. The vector containing the codon-optimized gene of interest can be inserted, transfected or otherwise transformed into host cells by known methods, so as to obtain transformants containing the codon-optimized gene of interest of the present application and capable of expressing the protein of interest. In the present application, "host cell" refers to a cell into which a foreign polynucleotide and / or vector is introduced. The host cell can be a eukaryotic host cell or a prokaryotic host cell, and the host cell is preferably bacteria, and more preferably Escherichia coli, and even more preferably Escherichia coli Rosetta (DE3) strain.

[0063] Method for preparing protein of interest

[0064] The present application also relates to a method for preparing a protein of interest, which can express or produce a recombinant protein by using the polynucleotide sequence of the present application. Generally, the method comprises the following steps:

[0065] (1) transforming or transducing a suitable host cell with the polynucleotide of the present application (or variant) encoding the protein of the present application, or with a recombinant expression vector containing the polynucleotide;

[0066] (2) culturing the host cell in a suitable medium;

[0067] (3) isolating and purifying the protein from the medium or the cell.

[0068] In step (1), the transformation or transduction of a suitable host cell with a recombinant expression vector containing the polynucleotide can be performed by conventional techniques well known to those skilled in the art, and when the host is Escherichia coli, heat shock and electroporation can be used.

[0069] The obtained transformants can be cultured by conventional methods to express the polypeptide encoded by the gene of the present application. Depending on the host cell used, the medium used in the culture can be selected from various conventional media, and preferably SB, TB, LB or SOC medium. The culture is carried out under conditions suitable for the growth of the host cell. After the host cell grows to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature shift or chemical induction), and the cell is cultured for a further period of time. In order to promote the expression of the protein of interest and increase the expression amount of soluble protein, in a preferred embodiment of the present application, the host cell is cultured in TB or LB medium, and the medium used contains kanamycin resistance gene.

[0070] In order to further promote the soluble expression of the protein of interest, in a preferred embodiment of the present application, the host cell is cultured to OD 600After 0.6-0.8, IPTG is used for induction, and the culture is continued at 17 to 19°C or 35 to 39°C for about 8 to 12 hours.

[0071] The protein in the above method can be expressed in the cell, or on the cell membrane, or secreted outside the cell. If necessary, the protein can be separated and purified by various separation methods by using its physical, chemical and other properties. Therefore, in the present application, after the target protein is successfully cultured, the step of separating and purifying it is also involved, for example, in step (3), the protein is separated and purified from the culture medium to obtain high-purity target protein. Although the method of purifying the target protein can be a conventional means familiar to those skilled in the art, including but not limited to: conventional renaturation treatment, treatment with protein precipitants (salting-out method), centrifugation, osmotic lysis, ultra-treatment, ultra-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods. The method for separating the target protein is provided in the preferred embodiment of the present application, which comprises: eluting the supernatant of the crushed target protein with the mobile phase through the chromatography column at the same time, and collecting the eluate; the mobile phase comprises Buffer A, Buffer B and / or Buffer C; wherein Buffer A comprises a solution of Tris (concentration 50 mM) and NaCl (concentration 50 mM); Buffer B comprises a solution of Tris (concentration 50 mM), NaCl (concentration 50 mM) and imidazole (concentration 500 mM); Buffer C comprises a solution of Tris (concentration 50 mM) and NaCl (concentration 1 M).

[0072] Preferably, in the elution step, the elution procedure comprises a first stage and a second stage; in the first stage, the mobile phase used is Buffer A; in the second stage, the mobile phase used is a mixture of Buffer A and Buffer B, wherein the volume percentage content of Buffer A gradually decreases from 100% to 40%, and the volume percentage content of Buffer B gradually increases from 0% to 60%.

[0073] More preferably, the elution procedure further comprises a third stage, and in the third stage, the mobile phase used is Buffer B.

[0074] The target protein product after elution and purification is dialyzed, and the dialysis sample is collected. The concentration of the dialysis sample can be measured by the BCA method, and the yield is calculated.

[0075] In the present application, the use of any example or exemplary language (e.g., "for instance") provided herein is intended merely to better illuminate the present application and does not pose a limitation on the scope of the application otherwise claimed. No language in the present specification should be construed as indicating any non-claimed element essential to the practice of the application.

[0076] If the definition or use of a term in a reference is inconsistent or not consistent with the definition of that term as described herein, the definition of the term as described herein is used and the definition of the term in the reference is not used.

[0077] Various terms used herein are set forth below. If a term is not defined in the text, it should be given the broadest definition that would be given to that term by a person skilled in the art at the time of the printing of the publication or the issuance of the patent.

[0078] As used herein, the term "isolated" refers to a nucleic acid or polypeptide that is separated from at least one other component (e.g., nucleic acid or polypeptide) with which the nucleic acid or polypeptide is associated in nature. In one embodiment, the nucleic acid or polypeptide is found in the presence of, if at all, only the solvent, buffer, ion or other component normally present in its solution. The terms "isolated" and "purified" do not include nucleic acids or polypeptides present in their natural source.

[0079] As used herein, the terms "polynucleotide" and "polynucleotide sequence" can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand.

[0080] The present application also relates to variants of the above-mentioned polynucleotides, which encode protein fragments, analogs and derivatives having the same amino acid sequence as the present application. The variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which can be a substitution of one or more nucleotides, a deletion or an insertion, but does not materially alter the functional properties of the encoded polypeptide.

[0081] As used herein, the term "codon optimization" refers to a way to improve the efficiency of gene synthesis according to the codon usage bias exhibited by the organism in which the protein is actually expressed or produced (including E. coli, yeast, mammalian blood cells, plant cells, insect cells, etc.), avoiding the use of low-usage or rare codons.

[0082] As used herein, the terms "homology" and "identity" are used interchangeably to refer to the percentage of identical (i.e., identical) nucleotides or amino acids between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be measured by the following method. The nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned, the number of positions at which the identical nucleotides or amino acid residues occur in the aligned polynucleotides or polypeptides is counted, and compared to the number of positions in the aligned polynucleotides or polypeptides that contain different nucleotides or amino acid residues. A polynucleotide can differ at one position, for example, by containing a different nucleotide (i.e., a substitution or variation) or a deletion of a nucleotide (i.e., an insertion or deletion of one or two nucleotides in the polynucleotide). A polypeptide can differ at one position, for example, by containing an amino acid (i.e., a substitution or variation) or a deletion of an amino acid (i.e., an insertion or deletion of one or two amino acids in the polypeptide). Sequence identity can be calculated by dividing the number of positions containing identical nucleotides or amino acid residues by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing identical nucleotides or amino acid residues by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide, and then multiplying by 100.

[0083] As used herein, the terms "sequence complement" and "reverse sequence complement" are used interchangeably to refer to a sequence that is opposite in direction to the original polynucleotide sequence and complementary to the original polynucleotide sequence. For example, if the original polynucleotide sequence is ACTGAAC, its reverse complement is GTTCAT.

[0084] As used herein, the term "expression" includes any step involved in the production of a polypeptide in a host cell, including but not limited to, transcription, translation, post- translational modification, and secretion. The expression can be harvested, i.e., recovered, from the host cell or the expression product.

[0085] In order to make the objects, technical solutions and advantages of the embodiments of the present application clearer, the present application will be further described below with specific examples. It should be understood that these examples are only used to illustrate but not to limit the scope of the present application. The experimental methods in the following examples, if no specific conditions are indicated, are generally carried out according to the conventional conditions or the conditions recommended by the manufacturers. Unless otherwise specified, percentages and parts are weight percentages and weight parts. The experimental materials and reagents used in the following examples, if not specifically stated, can be obtained from commercially available channels.

[0086] Unless otherwise indicated, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. It should be noted that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the exemplary embodiments of the present application.

[0087] Example 1

[0088] In this embodiment, plasmids containing optimized codons of acyl-CoA oxidase from B. cepacia, from Amoeba and from Pseudomonas were synthesized and introduced into E. coli culture to obtain monoclonal.

[0089] (1) Construction of acyl-CoA oxidase plasmid

[0090] The gene sequence of acyl-CoA oxidase from B. cepacia was obtained and optimized for E. coli synonymous codon bias preference to obtain optimized codon I (SEQ ID NO. 1), which was connected to the pET-28a(+) vector and entrusted to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis.

[0091] The gene sequence of acyl-CoA oxidase from Amoeba was obtained and optimized for E. coli synonymous codon bias preference to obtain optimized codon II (SEQ ID NO. 2). It was connected to the pET-28a(+) vector and entrusted to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis.

[0092] The gene sequence of acyl-CoA oxidase from Pseudomonas was obtained and optimized for E. coli synonymous codon bias preference to obtain optimized codon III (SEQ ID NO. 3). It was connected to the pET-28a(+) vector and entrusted to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis.

[0093] (2) Introduction of recombinant plasmid into host E. coli

[0094] Take 1 μL of the expression plasmid prepared in step (1) above, add to 30 μL of E. coli competent BL21(DE3) under ice bath conditions, ice bath for 30 min, 42°C water bath for 45 s, immediately ice for 2 min, add 400 μL of SOC medium without antibiotics, 37°C, 230 rpm shaking culture for 45 min. Take 100 μL of bacterial solution and evenly spread on LB plate containing 100 μg / mL kanamycin, 37°C incubator culture overnight.

[0095] (3) Expression of target gene

[0096] Pick the monoclonal prepared in step (2) and aseptically inoculate in LB and TB medium containing 100 μg / mL kanamycin, with two repeats, 37°C, 220 rpm shaking culture until OD600 is between 0.6-0.8, IPTG induction, respectively placed in 37°C and 18°C shaking culture overnight. Take sample and perform ultrasonic crushing for SDS-PAGE identification. The identification results are shown in Figures 1 to 4 .

[0097] According to Figures 1 to 4 , the acyl-CoA oxidases from B. barnesiae and Pseudomonas were expressed in supernatant in E. coli, and the acyl-CoA oxidase from Amoeba was expressed in inclusion body.

[0098] (4) Purification of the target protein

[0099] About 4 g of the recombinant bacteria from B. barnesiae and Pseudomonas prepared in step (3) was weighed and added with 20 mL of Lysis Buffer and dispersed on ice using a disperser. The cells were broken by ultrasonic: Ф10 probe, power 10%, work 5.5 s, stop 9.9 s, ultrasonic breaking for 30 min. Centrifugation at 20000 rpm at 4℃ for 30 min, taking the supernatant, and filtering through a 0.22 μm membrane. Purification was performed using 1 mL of Ni-NTA, and the preparation of each component of the mobile phase is referred to Table 1, and the flow rate of the mobile phase was 0.5 mL / min. After the sample was applied, 20 mL of Lysis Buffer was used to flush UV and conductance to the baseline. The elution program included: Step 1: 0% B, 10 CV, 1.5 ml / min; Step 2: 0-60% B, 20 CV, 1.5 ml / min; Step 3: 100% B, 15 CV, 1.5 ml / min.

[0100] Table 1

[0101]

[0102]

[0103] The purified product was collected for subsequent enzyme activity test. The electrophoresis results of part of the purified product are shown in Figure 5 ( Figure 5 The electrophoresis results of the collected sample of the acyl-CoA oxidase from B. barnesiae are shown in Figure 5 It can be seen that the target protein can be hung on the column and eluted at a concentration of 130 mM imidazole. According to the SDS results, eluent B1-B7 was selected for dialysis, and 13 mL of sample was obtained after dialysis. The concentration was measured by BCA, and the results were: R2=0.996, the concentration was 1.917 mg / mL, the yield was 24.921 mg, and the yield was 6.23 mg / g of bacteria.

[0104] SEQ ID NO. 1

[0105] ATGACCGAAGTAGTTGACCGTGCTTCTTCTCCGGCTTCTCCTGGTTCCACTACCGCTGCGGCAGATGGTGCGAAAGTAGC

[0106] GGTTGAACCGCGTGTTGACGTTGCAGCTCTGGGTGAACAACTGCTGGGCCGTTGGGCGGATATCCGTCTGCACGCACGTG

[0107] ACCTGGCTGGTCGTGAGGTGGTTCAGAAAGTTGAGGGCCTGACTCACACTGAACACCGTTCTCGTGTTTTTGGTCAACTG

[0108] AAATACCTGGTTGACAACAACGCCGTACACCGTGCATTCCCATCTCGTCTGGGCGGTTCTGACGATCATGGTGGCAATAT

[0109] CGCAGGCTTCGAAGAACTGGTTACTGCTGATCCGAGCCTGCAGATCAAAGCGGGCGTACAGTGGGGTCTGTTTGGTAGCG

[0110] CGGTTATGCACCTGGGCACCCGTGAACATCACGATAAATGGCTGCCGGGTATCATGTCCCTGGAGATCCCGGGCTGCTTC

[0111] GCAATGACCGAGACTGGTCACGGCTCCGACGTCGCTTCTATTGCAACCACCGCAACCTACGATGAAGAAACTCAGGAATT

[0112] TGTGATCGACACCCCATTCCGTGCAGCATGGAAAGACTACATCGGCAACGCAGCAAACGATGGTCTGGCGGCGGTTGTTT

[0113] TCGCCCAGCTGATCACGCGTAAAGTAAACCATGGTGTGCATGCTTTCTACGTTGATCTGCGTGACCCGGCGACTGGTGAC

[0114] TTTCTGCCGGGTATTGGTGGTGAGGACGACGGTATCAAAGGTGGCCTGAACGGTATTGACAATGGCCGTCTGCATTTCAC

[0115] CAACGTTCGTATTCCGCGTACCAATCTGCTGAACCGTTACGGCGACGTAGCTGTTGACGGTACCTACAGCAGCACTATCG

[0116] AATCCCCGGGTCGTCGCTTTTTCACCATGCTGGGCACTCTGGTTCAAGGTCGCGTAAGCCTGGATGGCGCAGCCGTTGCA

[0117] GCATCTAAAGTGGCTCTGCAGAGCGCTATTCATTATGCAGCGGAACGTCGCCAGTTCAACGCTACTAGCCCTACCGAAGA

[0118] AGAAGTCCTGCTGGACTACCAGCGTCATCAGCGCCGTCTGTTCACGCGTCTGGCAACCACCTACGCTGCATCCTTCGCTC

[0119] ACGAGCAGCTGCTGCAGAAATTCGATGATGTTTTCAGCGGCGCACACGATACCGATGCAGATCGTCAGGATCTGGAAACC

[0120] CTGGCGGCTGCGCTGAAACCGCTGTCTACTTGGCACGCACTGGATACGCTGCAGGAATGCCGTGAAGCTTGTGGTGGCGC

[0121] GGGTTTCCTGATTGAAAACCGTTTCGCTTCCCTGCGCGCTGACCTGGATGTGTACGTCACCTTTGAAGGTGATAACACCG

[0122] TTCTGCTGCAGCTGGTTGCGAAACGTCTGCTGGCTGACTACGCTAAAGAATTCCGTGGCGCTAACTTTGGTGTTCTGGCG

[0123] CGCTATGTGGTTGATCAAGCTGCGGGTGTAGCACTGCACCGTACTGGTCTGCGTCAGGTGGCTCAGTTCGTCGCTGATTC

[0124] TGGTTCTGTTCAGAAAAGCGCTCTGGCACTGCGCGACGAAGAGGGTCAGCGTACTCTGCTGACCGACCGTGTGCAATCTA

[0125] TGGTGGCTGAAGTTGGTGCTGCGCTGAAAGGTGCTGGTAAACTGCCGCAGCATCAGGCAGCAGCGCTGTTTAACCAGCAC

[0126] CAGAACGAACTGATCGAAGCGGCTCAAGCGCATGCTGAACTGCTGCAATGGGAAGCGTTCACCGAAGCACTGGCGAAAGT

[0127] AGATGACGCGGGCACGAAAGAAGTTCTGACCCGCCTGCGCGACCTGTTTGGTCTGTCCCTGATTGAAAAGCATCTGAGCT

[0128] GGTATCTGATGAATGGTCGTCTGTCCATGCAACGTGGTCGTACCGTTGGCACGTATATCAACCGTCTGCTGGTTAAAATC

[0129] CGTCCGCACGCGCTGGATCTGGTAGATGCATTCGGCTACGGTGCTGAACATCTGCGTGCTGCTATCGCAACTGGTGCCGA

[0130] AGCAACCCGTCAGGACGAAGCGCGTACTTACTTCCGTCAGCAACGCGCGTCTGGTTCTGCACCGGCTGATGAAAAAACTC

[0131] TGCTGGCGATCAAAGCAGGCAAATCTCGC

[0132] SEQ ID NO.2

[0133] ATGAACCCGGACCTGAAACGCGAACGTAAAGGCGCATCCTTTGATGCAACCGCAACTCGTGAACGTTTTCAGAAACTGGT

[0134] AGCGGATGAACCGGTGTTTGCGAATGATGACAAATACTTCCTGTCTCGTGTGCAGAACTATGAACGTGTTCTGCAGAAGG

[0135] TTGTGCGCGGCATCCAAATGTGCATCGAACATAACATCACTCCGGAAGATGCGGAATACCTGTTCCACTTCATCGGTGAA

[0136] GAGTTCATGGTTGCGCTGCACTGGTCCATGTTCATCCCGACCCTGCAGGGTCAGGCTACCAACGACCAGAAACTGCAGTG

[0137] GCTGCCGCTGGCGCAGACCTTCCAGATCATTGGCTGTTATGCCCAGACGGAGATGGGTCATGGCTCCAACGTGCGTGGTC

[0138] TGGAAACGACCGCGACCTACGACAAAGCGACGCAGGAATTCGTTCTGCATTCCCCTACCCTGACTTCCACCAAATGGTGG

[0139] CCGGGCGGCCTGGGCAAAACGTCCACTCACTGCGTCACTCACGCACGTCTGCTGGTGGAAGGCAAGGACCATGGTGTGGC

[0140] CACCTTCATCGTTCAGATTCGCTCTACCGATGACCATGCGCCGATGCCGGGCGTAACTGTCGGCGATATCGGTCCTAAAT

[0141] TTGGCTACGACACCCAGGATAACGGTTTCCTGCGTTTTGACCACGTTCGTATCCCACGTGATCAAATGCTGATGAAATAC

[0142] AAGCAGGTCTCCCCGGAAGGTGTTGTGACCGAAGCACCGAAAAAGCTGTCTAAACTGAGCTATGGCACCATGATGTACAT

[0143] TCGCTCCCGCATCGTTGGTGGTGCATCCTCTACGCTGGCACGTGCGTGCACCATTGCAGTACGTTATTCCGCTGTACGTC

[0144] GTCAGTTCAGCGACGCAGACAACGAACCGGAAAAACAGGTACTGGACTACCGTATGCAGCAGTATCGTCTGCTGCCGCTG

[0145] CTGGCCACTGCATACGCATTCCATTTCACCGGTCGTTACATGCGTAACATCTACGATGAGCTGATGCGTAACATCCAGTC

[0146] CGACGACGTGTCTGCGCTGCCGGAAGTTCACGCGACCTCTGCGGGCCTGAAAGCGGTTACCACTTGGATGACCGCGGATG

[0147] GTATTGAGGAATGCCGTAAATGCTGCGGTGGCCACGGCTACAGCAAGTTTGCGGGTATTTCTGACATTTACGTAAACTAT

[0148] GTACCAGCCTGCACTTATGAAGGCGATAACGTTGTCATGTGCCTGCAGACCGCGCGTTACCTGGTTAAGACCGCACGTGG

[0149] CGCTGCAAAGGGTGAACCTCTGGTGGGCAGCGTGCAGTGTCCGGCGCAGAAAGTTGCGGATTTCCTGTGCCCGCGTACCT

[0150] GGGTTGATGCTTTTGCGCTGCGTGCACGCTTCTGCGTTTTCGAGACCGTTAAAAAACTGGACGCTCTGAAGGGTCGTGGT

[0151] CTGAACGATAAACAGGTTTGGAACGAAGCTCAGATCGATCTGGTAAAGATGACCAAAGCGCATTGTTATTACACCATCGT

[0152] GCGTAATTTCGCAAACGCGGTAGAAAAGGTTGAGGATAAACAGCTGCAGGCCGTTCTGCACAAACTGTGCATGCTGTTCG

[0153] CGCTGTACCAGGTGCAGCGTGACCTGGGCGATTTTACTTGTTCTGGTTACCTGGCTCAGGAACAGGTCCCGCTGCTGAAC

[0154] GAAGCTGTGGAAGTGCTGCTGAGCGAACTGCGTAAAGACGCTGTACCGCTGGTAGACTCTTTCGACTTCTCTGATCACTT

[0155] TCTGAACAGCAGCCTGGGTCGTTACAACGGTGACGTCTATGAGCACATGTATAAATGGGCGCAGAAGGAACCACTGAACC

[0156] AGGCGCCGTACGCTACCCAGCCTCCAGGCTATGAAAAATACCTGAAACGCCTGCTGAACGGCGAGGTACTGCAGGAAGCC

[0157] ATCCAGAACAAAATGACTAAAGCTAACCTG

[0158] SEQ ID NO.3

[0159] ATGACTGACAGCTCTATTCCTGGCGCTGATGCACTGAAGGCACGTGATGAACTGCGCGATGTTCTGTTTGGCGGTACCTT

[0160] CGAATCTCACCATCAGTCCATTCGCAAAGTGCTGCTGGACCCGATCTTCGATCCGCAGAGCGGTCTGAACATGGAACAAG

[0161] CTGGTCGTCTGGCTTACGCTCGTAGCCGTCATGTGCACGGTGCGCTGGAACGTCCGCTGGAAATTCTGGCGAACCCGCGT

[0162] CGTCTGTTCGCTCTGGCAGAATGGCCGTCTCTGCTGGATGTTGCATCTTTTAGCCTGCTGATGGTGCACTACAACCTGTG

[0163] CCTGGGTACCGTGTTCGACCATGCGCGCGACCGTTCCGATATCGCTGATCTGACCGAAGCCCTGGACGGCCTGACCTCTT

[0164] TCGGTCCTTACATGGCTACCGAACTGGGTTTCGGTAACAATGTCGCTGCTCTGCAAACTGAAGCAGTGTACGATCGTCAG

[0165] AGCCAGACCTTCACCCTGAACACCCCATCTGTTTCTGCGCAGAAATACATGAGCTACAGCGGCTTCGGCGACATCCCGAA

[0166] AGTGGCAACCGTTATGGCGCGTCTGAAAATCGAAGGTAAAGATTATGGCGTCTTCCCGTTCCTGGTTCGCCTGTCTACTG

[0167] AGGCTGGTCTGTGCCCAGGTATCCGTGCTGCACTGTGTCCGGAAAAACCGGTTCAGGGCCTGGATAACGGTCTGACCTGG

[0168] TTTGACAACGTGCGCGTACCGCGTTCTAGCCTGCTGCATGGTGATATGGGTCACTTCGCCGAAGATGGTCACTTCGTAGT

[0169] TGGTGCAGGCAACGCTCGTTCTCGTTTCCTGCGCGCAATGAGCCGCATTGTTCCAGGTCGTCTGTGCGTTGCATCTGCAG

[0170] CGCAGGGCGCATCTCGTGCATCTCTGTACATCGCGCTGCGTTATGGTCAACAGCGTCTGACTAACGCTCCGGGTACTAAC

[0171] GATATGCCGGTTATTGAATATCGTTCTTACCAGGTCCCACTGTTCTCTGCACTGGCGTCTACCTACGCCATGACCCTGCT

[0172] GCTGAACGAAGCTAAGGCGCGTTTCCTGGCAAACACCACTGAACCGGCTGTTGACGTTGTGTCTCTGATCAACATCACCA

[0173] AAGCTCTGGCGACTTGGGACGCGTCTGCAGTCATCGCAGAGTGTCGCGAACGTTGTGGTGCACAGGGCATCTTCTCTGCC

[0174] AACCGTATCGCTGACTACGGTTCTCTGCTGCAGGGCCTGGTCACCGCAGAAGGTGATAACCTGGTCCTGCTGGCTACCGT

[0175] TGCAGGCCAGCTGCTGGCTCAGGTATGGCAGGGTCCAGAACCTCTGCGTCCGGTTCGTGCTCGTCGTCTGGCTGAACCTG

[0176] AGTGGCTGATCGCCGCTATTGCGTTCCGCGAACATCAACTGTGGCTGACCATCCGCGAAGAAATGAACACTGATGAGCGT

[0177] GGCTATTTCGAAGTGTGGAACGACGCAATGAACCCTGGCCTGGAACTGGCTCGTCTGCGTGGTGAACGTCTGGCACTGGA

[0178] ACAGCTGTGGTCTGCCTCTCTGCACGCACAGCAAGACGAGGCTAAAGCGGCGCTGAACTGTCTGGCAAGCCTGTACGGTC

[0179] TGAACCTGCTGCGTCGTGACGCGGCTTGGTACCTGGCACACGAACTGATTGATGCTGGTCAAGCACTGTCTCTGCCGGGC

[0180] CGTATCGATCAACAGTGCGTTGCACTGCGTCCGCATGTTTCCATGCTGATTGACGGTTTTGGTCTGAGCCCTGAACTGCT

[0181] GCGTGCTCCGATCGCTCAGGACGATTACATCCAGGCCTTCTGCAAACAGGTTAATGCGAACGTAGAC

[0182] Example 2

[0183] In this embodiment, the purified B. burnsi and Pseudomonas-derived acyl-CoA oxidase were taken for subsequent enzyme activity detection experiments. The specific steps are as follows:

[0184] (1) Solution preparation

[0185] 1M Tris-HCl pH 8.0: weigh Tris powder 121.14g, pour into a 1L beaker and add sterilized purified water to 800ml. After stirring evenly, use concentrated hydrochloric acid to adjust the pH to 8.0 at 25°C, then make up to 1L. 0.22um filtration, 4°C storage;

[0186] 5mM palmitoyl coenzyme A: weigh 10mg palmitoyl coenzyme A powder dissolved in 1.99mL deionized water.

[0187] 5mM FAD: weigh 0.0041g FAD powder dissolved in 1mL deionized water, avoid light storage.

[0188] 0.1% 4-aminoantipyrine: weigh 0.05g 4-aminoantipyrine powder dissolved in 50mL deionized water, avoid light storage.

[0189] 0.1% phenol: weigh 0.05g phenol powder dissolved in 50mL deionized water, avoid light storage.

[0190] 5mL working solution preparation reference table 2.

[0191] Table 2

[0192] Reagent Volume added Final concentration 1 M Tris-HCl 0.1 mL 20 mM 0.1% 4-AA 1.56 mL 1.5 mM 0.1% phenol 1 mL 2.1 mM Peroxidase (5 U / μL) 5 μL 25U FAD (5 mM) 10 μL 10 μM Palmitoyl CoA (5 mM) 500 μL 0.5 mM ddH2O 1795 μL

[0193] Preparation of positive enzyme: 200U of positive enzyme (commercially available acyl-CoA oxidase control) was dissolved in 0.2mL PBS pH 7.4 buffer to make 1U / μL enzyme solution, which was further diluted according to the gradient, and the dilution was PBS pH 7.4 buffer.

[0194] (2) Instrument detection

[0195] The microplate reader was preheated for 30 min, 100 μL of reaction solution was added, and the absorbance value was detected at 500 nm. The blank group was added with 1 μL of enzyme diluent, and the absorbance value A1 was detected at 500 nm. The experimental group was added with 1 μL of enzyme solution of each concentration, shaken and mixed for 5 s, reacted for 5 min, and the absorbance value A2 was detected at 500 nm. The standard curve is shown in Figure 6 The OD difference A2-A1 of the sample and the blank was calculated, and the sample concentration was calculated according to the difference. The results are shown in Table 3.

[0196] Table 3

[0197]

[0198]

[0199] The purified B. barnesae-derived recombinant acyl-CoA oxidase had a concentration of 1.917 mg / mL, an average activity of 0.2611 U / μL, and a specific activity of (0.4628*1000) / 1.917=241.4 U / mg. The recombinant acyl-CoA oxidase from Pseudomonas had no enzyme activity.

[0200] Example 3

[0201] In this example, the B. barnesae-derived acyl-CoA oxidase with good enzyme activity was selected as the purified product, and the coding gene was optimized by different ways of E. coli synonymous codon bias, and the optimized codon with high soluble expression amount was screened.

[0202] The B. barnesae-derived acyl-CoA oxidase gene sequence was selected, and different from the synonymous codon bias optimization of Example 1, a large number of optimized codons were obtained, such as the optimized codons shown in SEQ ID NO. 4-7, and the recombinant plasmid was synthesized and cultured in E. coli according to the same method of Example 1, and the soluble expression amount was measured. The results are shown in Table 4.

[0203] Table 4

[0204] Optimized codon Soluble expression Purification yield Optimized codon I Soluble expression 6.23 mg / g Optimized codon IV Inclusion body expression / Optimized codon V Soluble expression 4.58 mg / g Optimized codon VI Inclusion body expression / Optimized codon VII Inclusion body expression /

[0205] SEQ ID NO. 4:

[0206] ATGACTGAAGTAGTGGATAGAGCTAGTTCCCCAGCATCCCCTGGATCAACTACCGCTGCTGCTGATGGTGCCAAAGTTGCAGTTGAACCAAGAGTTGACGTCGCTGCTCTGGGAGAACAGTTACTAGGAAGATGGGCTGATATAAGGTTGCATGCTAGAGATCTGGCTGGTAGAGAGGTCGTTCAAAAGGTCGAGGGTCTTACTCATACCGAACACAGATCCAGAGTCTTTGGACAACTTAAATACTTGGTCGACAATAACGCCGTTCATAGAGCTTTTCCTAGTAGGTTAGGAGGATCTGATGACCACGGTGGAAACATTGCTGGCTTTGAAGAATTGGTAACAGCTGATCCTTCCCTTCAGATTAAGGCTGGCGTCCAATGGGGCCTTTTTGGATCCGCTGTTATGCACCTTGGTACACGTGAGCACCATGATAAGTGGCTGCCAGGAATTATGAGTCTGGAGATCCCCGGTTGTTTTGCTATGACAGAAACAGGACATGGTTCCGACGTTGCTAGTATTGCAACAACCGCTACTTACGATGAAGAAACTCAGGAGTTCGTCATTGACACTCCATTCCGTGCTGCATGGAAGGACTATATTGGAAACGCTGCTAATGACGGACTTGCTGCAGTGGTATTTGCCCAACTAATAACACGAAAAGTTAACCATGGCGTTCATGCCTTCTATGTCGATTTGAGAGACCCCGCCACAGGTGACTTTTTGCCAGGTATAGGAGGTGAGGATGATGGTATAAAGGGAGGTTTGAACGGTATAGATAATGGAAGGTTGCACTTCAC

[0207] CAACGTAAGAATTCCACGTACAAACCTGCTGAACAGATATGGCGATGTGGCTGTCGACGGTACATACAGTTCAACTATTG

[0208] AAAGTCCTGGTCGAAGATTCTTTACTATGCTGGGAACCTTAGTTCAGGGACGTGTTAGTTTGGATGGTGCCGCTGTTGCT

[0209] GCTAGTAAGGTTGCTTTACAGTCTGCTATCCACTATGCCGCTGAAAGACGTCAGTTCAACGCCACTTCTCCTACCGAAGA

[0210] AGAGGTTTTGTTAGACTACCAAAGGCACCAGAGAAGACTATTCACAAGATTGGCAACAACGTACGCTGCTTCTTTCGCTC

[0211] ATGAACAACTTTTGCAGAAGTTTGATGATGTTTTTTCTGGAGCACACGACACTGACGCAGACAGACAGGATCTAGAGACC

[0212] CTTGCTGCTGCTCTGAAACCACTATCCACTTGGCACGCACTTGACACCTTGCAAGAATGTAGAGAAGCTTGTGGTGGTGC

[0213] TGGTTTCTTGATTGAAAATAGATTTGCTTCCTTAAGAGCAGATTTAGATGTCTATGTCACTTTTGAAGGAGACAATACCG

[0214] TTCTGCTTCAACTTGTCGCTAAGCGATTGTTAGCCGATTATGCTAAGGAGTTCAGAGGAGCTAATTTTGGCGTACTGGCA

[0215] CGATACGTTGTTGATCAGGCTGCTGGAGTTGCTCTTCATAGGACTGGCCTAAGACAGGTTGCTCAATTCGTAGCCGATTC

[0216] CGGAAGTGTGCAAAAGTCTGCCTTGGCACTACGTGATGAAGAAGGTCAAAGAACATTGTTGACCGACCGAGTTCAATCCA

[0217] TGGTCGCTGAGGTGGGAGCCGCTTTGAAGGGAGCTGGAAAGCTACCCCAACATCAAGCAGCTGCCCTATTCAACCAACAT

[0218] CAAAACGAACTTATTGAAGCAGCACAGGCTCATGCAGAATTATTGCAGTGGGAGGCTTTCACAGAAGCTTTGGCTAAGGT

[0219] TGACGATGCCGGAACTAAGGAAGTGTTGACTAGACTGAGAGACTTGTTTGGTCTATCTCTGATTGAAAAGCACCTATCCT

[0220] GGTACTTAATGAACGGTCGACTGTCTATGCAGAGAGGAAGAACTGTCGGAACTTATATTAATAGACTTCTAGTGAAGATC

[0221] AGGCCACACGCCCTTGATTTGGTGGATGCTTTCGGATACGGTGCCGAACATCTTAGGGCTGCTATTGCAACTGGTGCTGA

[0222] GGCTACAAGACAGGACGAAGCCCGTACTTACTTTAGACAACAGCGAGCTTCCGGATCCGCACCAGCAGATGAAAAAACAT

[0223] TATTAGCTATCAAAGCTGGTAAATCTAGG

[0224] SEQ ID NO.5:

[0225] ATGACGGAAGTAGTAGACCGAGCATCATCTCCAGCTTCACCAGGATCCACAACAGCTGCTGCAGATGGCGCAAAGGTTGC

[0226] GGTGGAACCTAGAGTTGATGTCGCGGCTCTTGGAGAACAGCTTCTCGGCAGATGGGCAGATATTCGTCTGCATGCAAGAG

[0227] ACCTTGCGGGGCGCGAAGTCGTTCAGAAAGTGGAAGGACTGACACATACCGAACATCGCTCTCGTGTCTTTGGACAGCTG

[0228] AAATACCTGGTCGATAACAATGCTGTGCATCGTGCTTTTCCGAGCAGATTGGGCGGATCTGATGACCACGGGGGAAACAT

[0229] CGCCGGCTTCGAAGAACTGGTGACGGCAGATCCTTCACTTCAGATTAAAGCGGGAGTGCAGTGGGGCCTTTTCGGATCAG

[0230] CTGTGATGCATCTGGGTACCAGAGAACATCATGACAAATGGCTTCCGGGAATCATGTCACTTGAAATTCCTGGATGTTTC

[0231] GCTATGACGGAGACCGGTCACGGGTCTGACGTTGCCTCAATTGCCACAACAGCGACATACGATGAGGAAACACAAGAATT

[0232] TGTCATAGACACACCTTTTCGAGCTGCTTGGAAAGATTATATAGGAAACGCTGCGAACGATGGCCTTGCAGCGGTAGTTT

[0233] TTGCGCAACTTATAACAAGAAAAGTTAACCATGGGGTCCACGCCTTCTACGTTGACCTTAGAGATCCTGCCACAGGTGAT

[0234] TTCTTACCAGGTATCGGGGGCGAAGATGATGGTATTAAAGGAGGTTTAAACGGGATCGATAATGGTCGTTTACATTTTAC

[0235] TAACGTTCGCATTCCGCGCACTAACTTGTTAAACCGCTATGGCGACGTGGCAGTCGATGGAACATATTCCTCTACGATTG

[0236] AAAGCCCGGG ACGTCGGTTT TTCACAATGT TAGGCACACT TGTACAAGGT AGAGTCTCGT TAGATGGCGC GGCAGTAGCA

[0237] GCAAGCAAAG TTGCTCTGCA GTCTGCCATT CATTATGCTG CGGAACGACG GCAGTTTAAT GCGACCAGCC CGACAGAAGA

[0238] AGAGGTCCTT CTCGATTACC AGAGACATCA GAGAAGACTT TTCACTCGTC TTGCAACGAC TTATGCGGCT TCCTTTGCTC

[0239] ATGAACAGCT TTTGCAAAAA TTCGACGATG TCTTTTCTGG CGCGCATGAT ACTGACGCTG ACCGTCAGGA TCTGGAGACA

[0240] TTGGCCGCCG CCCTTAAACC GTTATCCACC TGGCATGCTT TAGACACGCT TCAAGAATGC CGAGAAGCGT GCGGCGGAGC

[0241] AGGTTTTTTG ATTGAGAATA GATTTGCGTC CTTGCGCGCG GACTTAGATG TTTATGTTAC ATTTGAGGGC GACAACACAG

[0242] TACTGTTACA ATTAGTTGCT AAACGCCTGC TTGCCGATTAT GCGAAGGAAT TC CGAGGCGCT AATTTTGGCG TGCTGGCA

[0243] CGCTATGTTG TTGATCAAGC TGCGGGTGTT GCATTGCATC GGACAGGGCT CAGACAGGTT GCTCAATTTG TTGCCGACTC

[0244] AGGCTCCGTG CAAAAGTCCG CATTGGCACT GCGGGATGAA GAAGGACAGC GAACGCTGCT GACAGACCGG GTACAGTCTA

[0245] TGGTAGCAGAAGTCGGCGCTGCGCTTAAAGGTGCAGGAAAACTTCCGCAGCACCAGGCCGCTGCTCTCTTCAACCAGCAT

[0246] CAGAATGAACTGATCGAAGCTGCCCAAGCGCACGCCGAACTGTTACAATGGGAAGCATTCACAGAAGCGCTTGCTAAGGT

[0247] AGATGATGCGGGTACCAAAGAAGTGTTAACCCGTCTGAGAGACCTGTTTGGGCTGTCACTGATAGAGAAACATTTATCAT

[0248] GGTATCTCATGAACGGACGGCTCAGCATGCAGCGTGGACGTACTGTTGGGACCTACATTAATAGACTTCTGGTAAAAATC

[0249] CGCCCTCATGCTCTTGATCTCGTAGATGCTTTTGGCTACGGCGCAGAACATCTTAGAGCTGCAATTGCGACAGGAGCGGA

[0250] AGCTACTCGCCAAGACGAAGCACGGACATATTTTCGGCAGCAGCGAGCAAGTGGTTCAGCCCCAGCAGACGAAAAAACAT

[0251] TGCTTGCGATTAAAGCCGGCAAGTCAAGA

[0252] SEQ ID NO.6:

[0253] ATGACTGAAGTCGTTGATAGAGCATCCTCACCCGCATCTCCAGGTTCAACGACAGCCGCTGCTGATGGTGCTAAGGTTGC

[0254] TGTGGAACCAAGAGTTGATGTCGCGGCACTGGGTGAACAATTATTAGGTCGTTGGGCTGATATCCGTCTTCATGCTAGGG

[0255] ATTTGGCTGGTAGAGAGGTAGTTCAAAAGGTGGAGGGGTTGACCCACACAGAACATAGATCTAGGGTTTTTGGTCAGTTG

[0256] AAATACTTGGTGGATAATAATGCTGTACATAGGGCTTTTCCATCCAGGTTGGGTGGATCAGACGACCATGGTGGTAACAT

[0257] CGCAGGTTTTGAAGAACTAGTAACCGCTGATCCATCTCTTCAAATCAAAGCTGGAGTCCAATGGGGCCTGTTCGGGAGTG

[0258] CTGTTATGCATCTAGGTACAAGAGAGCATCATGATAAGTGGTTGCCTGGAATAATGAGTTTGGAAATTCCCGGTTGTTTT

[0259] GCTATGACCGAGACGGGTCACGGCTCTGATGTCGCCTCCATCGCTACAACTGCAACCTACGATGAAGAAACCCAAGAATT

[0260] TGTTATAGATACCCCTTTTAGAGCTGCATGGAAAGATTATATCGGTAATGCTGCAAACGATGGTCTTGCTGCTGTGGTTT

[0261] TCGCGCAATTGATTACTCGTAAAGTTAATCATGGTGTTCACGCTTTCTACGTAGATTTGCGTGACCCAGCTACTGGGGAT

[0262] TTCTTGCCAGGTATCGGTGGTGAAGACGATGGTATTAAAGGTGGTTTGAATGGGATTGATAATGGCAGATTACATTTTAC

[0263] AAACGTGAGAATCCCTAGAACAAACCTTCTAAACAGATATGGAGATGTAGCAGTTGATGGTACCTACAGTTCAACAATAG

[0264] AATCACCTGGTAGAAGATTCTTCACCATGTTGGGTACTCTGGTTCAAGGAAGAGTGAGTTTGGATGGGGCAGCAGTTGCT

[0265] GCTTCAAAAGTGGCTTTGCAAAGCGCCATTCATTATGCAGCAGAACGTAGACAATTTAATGCCACTTCTCCGACTGAGGA

[0266] AGAGGTATTATTGGATTACCAAAGGCATCAGAGGAGGTTATTTACGAGATTAGCAACTACTTACGCTGCATCTTTTGCAC

[0267] ACGAACAATTGCTGCAAAAATTTGACGACGTTTTTTCAGGTGCACATGATACAGATGCCGATAGGCAAGATTTGGAGACT

[0268] CTTGCCGCCGCACTTAAACCACTTAGTACTTGGCATGCTCTAGACACTCTTCAAGAGTGCAGAGAGGCATGCGGTGGAGC

[0269] GGGATTTCTGATAGAAAATAGATTTGCAAGCTTAAGAGCCGATTTGGATGTCTACGTTACCTTTGAAGGTGACAATACTG

[0270] TTCTTTTGCAATTGGTTGCTAAGAGGTTGTTGGCCGATTACGCAAAGGAATTCAGAGGAGCTAATTTTGGTGTTTTGGCC

[0271] AGATACGTAGTCGATCAAGCTGCCGGGGTTGCACTGCATAGAACAGGTCTTAGACAAGTGGCACAGTTCGTCGCGGATTC

[0272] AGGTAGCGTACAAAAGTCAGCCCTAGCCCTTAGGGATGAAGAAGGCCAGAGAACCTTGCTAACTGATAGAGTACAATCTA

[0273] TGGTAGCTGAAGTTGGAGCAGCTTTGAAGGGTGCCGGGAAATTACCACAGCATCAAGCCGCAGCGTTGTTTAACCAGCAT

[0274] CAAAATGAATTAATCGAAGCTGCTCAAGCTCACGCAGAATTGTTGCAATGGGAAGCTTTTACTGAAGCTCTAGCTAAGGT

[0275] CGATGATGCGGGCACGAAAGAGGTTTTGACTAGATTACGTGATCTGTTCGGATTGTCTTTGATTGAAAAACATTTATCTT

[0276] GGTATTTAATGAATGGTCGTTTAAGTATGCAGAGGGGAAGAACAGTTGGTACATATATTAACCGTTTGCTTGTAAAGATA

[0277] AGGCCTCATGCGTTGGATCTTGTTGACGCCTTTGGATATGGGGCAGAACATTTAAGGGCTGCTATCGCAACCGGTGCTGA

[0278] GGCAACTAGACAAGATGAAGCAAGAACATATTTCAGACAGCAAAGAGCAAGTGGAAGCGCCCCAGCTGACGAAAAGACCT

[0279] TGTTGGCTATCAAAGCGGGAAAGTCCAGA

[0280] SEQ ID NO.7:

[0281] ATGACTGAGGTAGTGGACAGGGCTTCTAGTCCTGCATCTCCTGGATCTACAACTGCAGCTGCCGACGGTGCAAAGGTGGC

[0282] AGTTGAGCCTAGAGTGGACGTTGCTGCCCTCGGAGAACAACTGCTGGGTCGGTGGGCCGATATTAGGTTGCATGCCAGAG

[0283] ATCTGGCCGGTAGGGAAGTCGTTCAGAAGGTCGAAGGACTGACCCACACCGAACATAGGAGCAGAGTTTTCGGCCAGCTT

[0284] AAATACCTGGTTGATAATAATGCAGTCCACAGAGCCTTTCCCAGCCGACTTGGAGGAAGCGACGACCACGGAGGCAATAT

[0285] CGCAGGCTTTGAAGAGCTGGTTACCGCCGATCCCTCCCTTCAAATTAAAGCCGGGGTGCAGTGGGGTCTGTTTGGTAGTG

[0286] CAGTAATGCACCTGGGCACAAGGGAACACCACGACAAGTGGCTCCCAGGGATCATGAGCCTGGAAATCCCGGGGTGTTTT

[0287] GCCATGACCGAAACCGGACATGGCTCTGACGTGGCGTCTATTGCTACAACGGCAACTTACGACGAGGAAACCCAAGAGTT

[0288] TGTTATAGATACCCCCTTCAGAGCCGCCTGGAAGGACTATATCGGTAATGCAGCAAACGATGGTCTCGCCGCCGTTGTGT

[0289] TTGCCCAGCTGATTACAAGAAAGGTGAACCACGGGGTTCACGCATTTTACGTGGATCTCAGAGACCCTGCAACCGGTGAT

[0290] TTCTTGCCTGGCATCGGAGGGGAAGATGACGGGATCAAGGGTGGCCTGAATGGGATTGACAACGGTAGGCTGCATTTCAC

[0291] AAACGTGAGGATCCCCAGGACCAACCTGCTCAATAGATACGGTGATGTGGCCGTAGATGGTACATACTCCAGCACCATCG

[0292] AGTCCCCCGGACGAAGGTTTTTTACCATGTTGGGTACGCTCGTCCAGGGCCGGGTGTCTCTTGATGGAGCAGCGGTGGCA

[0293] GCTTCAAAGGTGGCCCTCCAGTCTGCCATTCACTACGCTGCTGAGCGAAGGCAGTTCAACGCCACCTCTCCAACCGAGGA

[0294] GGAGGTGCTGTTGGATTACCAAAGGCACCAAAGACGCCTTTTCACCCGGCTCGCAACCACATACGCAGCAAGCTTCGCGC

[0295] ACGAGCAGCTGCTCCAGAAGTTCGATGACGTTTTCTCTGGAGCCCATGATACCGATGCCGATAGGCAAGACCTGGAGACC

[0296] TTGGCAGCAGCACTGAAACCTCTCTCAACCTGGCACGCTTTGGACACTTTGCAGGAATGCAGGGAGGCATGCGGAGGTGC

[0297] TGGCTTCCTGATCGAGAACCGCTTTGCTTCACTTCGCGCCGATCTTGACGTATATGTCACTTTCGAAGGGGACAATACCG

[0298] TGCTTCTCCAGCTTGTCGCAAAAAGACTGCTGGCAGACTACGCCAAGGAATTCAGAGGAGCAAATTTTGGAGTATTGGCC

[0299] AGATACGTCGTGGATCAGGCAGCGGGAGTTGCACTGCACAGGACTGGCTTGCGCCAGGTTGCTCAGTTTGTGGCCGACAG

[0300] TGGAAGCGTACAGAAGAGTGCATTGGCTCTGCGGGATGAGGAAGGGCAGAGAACGCTGCTGACCGATCGGGTGCAGTCAA

[0301] TGGTGGCAGAGGTGGGCGCAGCTCTGAAAGGAGCAGGGAAACTGCCTCAGCATCAGGCTGCTGCTCTGTTCAACCAGCAC

[0302] CAGAACGAGCTGATCGAGGCCGCACAAGCCCATGCAGAGTTGCTGCAGTGGGAGGCGTTTACAGAGGCCCTGGCTAAAGT

[0303] TGATGATGCTGGCACTAAAGAGGTCCTCACTAGGTTGCGGGATCTCTTCGGACTGTCTCTGATTGAAAAACATCTGTCAT

[0304] GGTATCTGATGAATGGACGACTTTCCATGCAGCGGGGGAGAACAGTGGGAACTTATATTAACCGGCTGCTGGTAAAAATT

[0305] CGACCCCATGCTCTCGACCTGGTGGATGCCTTTGGTTACGGCGCTGAACACCTCCGGGCTGCTATAGCCACTGGAGCAGA

[0306] AGCCACAAGGCAGGACGAGGCCAGGACATACTTTAGACAACAGAGAGCCAGTGGATCTGCCCCCGCTGATGAAAAGACCC

[0307] TGCTCGCAATTAAAGCAGGCAAGTCCAGG

[0308] Those skilled in the art can understand that the above-mentioned embodiments are specific examples for implementing the present application, and in practical applications, various changes can be made in form and details without departing from the spirit and scope of the present application.

Claims

1. An isolated polynucleotide encoding an acyl-CoA oxidase, characterized in that, The polynucleotide is codon-optimized, and the polynucleotide is as shown in SEQ ID NO.

1.

2. An expression vector, characterized by, The expression vector comprises the polynucleotide as claimed in claim 1.

3. The expression vector of claim 2, wherein, The expression vector is an E. coli expression vector.

4. A host cell, characterized in that, The host cell comprises the expression vector as claimed in claim 2 or 3; or The polynucleotide as claimed in claim 1 is integrated into the genome of the host cell.

5. A method of preparing acyl-CoA oxidase, characterized by, The method comprises the steps of: transforming a host cell with a vector containing the polynucleotide as claimed in claim 1; culturing the host cell to express the acyl-CoA oxidase.

6. The method of claim 5, wherein, The host cell is cultured using TB medium.

7. The method of claim 5, wherein, The host cell is cultured at a temperature of 16 to 19℃.

8. The method of claim 5, wherein, When culturing the host cell, IPTG is used to induce the expression of the target protein.

9. A kit characterized in that, The kit comprises: the polynucleotide as claimed in claim 1; or the expression vector as claimed in claim 2 or 3; or the host cell as claimed in claim 4.