Bamboo mosaic virus-mediated foreign expression system and its applications

Through the exogenous expression system mediated by bamboo mosaic virus, the problems of low transformation efficiency and long cycle in bamboo gene function research were solved, and a transient transformation system was established to achieve rapid and efficient exogenous gene expression in bamboo, saving time and economic costs.

CN116042701BActive Publication Date: 2025-06-13FUJIAN AGRI & FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310105479.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-13
Publication Date
2025-06-13
Estimated Expiration
2043-02-13

AI Technical Summary

Technical Problem

In the study of gene function, bamboo has problems with low stable genetic transformation efficiency and long cycle, and lacks an effective transient transformation system.

Method used

Using the exogenous expression system mediated by bamboo mosaic virus, a bamboo mosaic virus-mediated transient transformation system mediated by bamboo mosaic virus genome, pCAMBIA1302 linearized vector, ORF5 subgenomic promoter, RNA silencing inhibitor P19, T2A self-slicing peptide, exogenous gene and Agrobacterium GV3101 and other components were constructed.

Benefits of technology

It has achieved rapid and efficient expression of exogenous genes in bamboo, which is convenient for identifying bamboo gene functions, greatly saving time and economic costs, and is of pioneering significance in the study of bamboo plant functional genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116042701B_ABST
    Figure CN116042701B_ABST
Patent Text Reader

Abstract

The present invention provides a bamboo mosaic virus-mediated exogenous expression system and its application, belonging to the technical field of genetic engineering. The components of the exogenous gene expression system include the bamboo mosaic virus genome, the linearized pCAMBIA1302 vector, the ORF5 subgenomic promoter, the RNA silencing suppressor P19, the T2A self-cleaving peptide, the exogenous gene, and Agrobacterium tumefaciens GV3101. This overexpression system can be applied to the study of gene functions in Phyllostachys edulis and Dendrocalamus latiflorus, and can provide scientific guidance for bamboo molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a bamboo mosaic virus-mediated foreign expression system and its application. Background Art

[0002] Bamboo is one of the important forest resources in the world. It is one of the fastest-growing plants among monocotyledons and is widely planted in subtropical regions. Bamboo has high economic value and ecological value. At present, the bamboo forest area in China has exceeded 100 million mu, and the output value of the Chinese bamboo industry has been increasing year by year. Bamboo products from China, ranging from toothpicks to building materials for houses, are sold well in many countries around the world. However, the stable genetic transformation system of bamboo is difficult and has a long cycle. Therefore, the establishment of an instantaneous transformation system is of great significance for the technical system of gene function research of bamboo plants.

[0003] Plant virus vectors have been proven to be effective tools for studying plant gene functions. Plant viruses can carry target genes into hosts and express and translate them in the whole plant during the virus infection process. BaMV is a positive single-stranded RNA virus of plants, with a cap structure at the 5' end and a poly(A) tail at the 3' end. Its genomic structure contains 5 open reading frames. However, the BaMV-mediated transformation system has never been reported in bamboo. Developing and utilizing the BaMV-mediated transformation system is a great advantage for exploring the gene functions of bamboo. In this study, to solve the problems of low efficiency and long cycle of stable genetic transformation of bamboo, we successfully established a bamboo mosaic virus-mediated expression system in bamboo for the first time. Summary of the Invention

[0004] The purpose of the present invention is to provide a bamboo mosaic virus-mediated foreign expression system and its application.

[0005] To achieve the above purpose, the present invention adopts the following technical solutions:

[0006] A bamboo mosaic virus-mediated foreign gene expression system, the components of the foreign gene expression system include the bamboo mosaic virus genome, the linearized pCAMBIA1302 vector, the ORF5 subgenomic promoter, the RNA silencing suppressor P19, the T2A self-cleaving peptide, the foreign gene, and Agrobacterium tumefaciens GV3101; the foreign gene includes the EGFP gene and the RUBY gene.

[0007] The construction method of the above-mentioned bamboo mosaic virus-mediated foreign gene expression system includes the following steps:

[0008] 1) Extract the total RNA of Dendrocalamus latiflorus infected with bamboo mosaic virus, reverse transcribe the extracted total RNA to obtain cDNA, and use the reverse transcribed cDNA as a template to perform PCR amplification to obtain the full-length genomic sequence of bamboo mosaic virus;

[0009] 2) The pCAMBIA1302 vector was digested with the restriction endonucleases XhoI and SpeI to obtain a linearized pCAMBIA1302 vector. The full-length genomic sequence of Bamboo mosaic virus driven by the 2×35s promoter was ligated to the linearized pCAMBIA1302 vector to obtain the pCAMBIA1302-BaMV vector;

[0010] 3) The ORF5 subgenomic promoter sequence was inserted between the ORF4 and ORF5 sequences of the pCAMBIA1302-BaMV vector. Then, the RNA silencing suppressor P19 sequence and the T2A self-cleaving peptide sequence were ligated in sequence and cloned into the SacI restriction site of the pCAMBIA1302-BaMV vector to obtain a recombinant viral vector;

[0011] 4) The foreign gene was ligated to the recombinant viral vector obtained in step 3) and then transferred into competent Agrobacterium tumefaciens GV3101 cells to obtain an expression system for foreign genes mediated by Bamboo mosaic virus;

[0012] Among them, the full-length genomic sequence of the Bamboo mosaic virus is shown in SEQ ID NO.1, the ORF5 subgenomic promoter sequence is shown in SEQ ID NO.2, the RNA silencing suppressor P19 sequence is shown in SEQ ID NO.3, and the T2A self-cleaving peptide sequence is shown in SEQ ID NO.4;

[0013] Among them, the primer sequences used for PCR amplification are:

[0014] Forward primer: 5’-GAAAACCACTCCAAACGAAACGAAA-3’,

[0015] Reverse primer: 5’-gtttcgtcctttagggactcgtcag-3’.

[0016] Use of the above-mentioned expression system for foreign genes mediated by Bamboo mosaic virus in the field of Phyllostachys edulis gene function analysis.

[0017] Use of the above-mentioned expression system for foreign genes mediated by Bamboo mosaic virus in the field of Dendrocalamus latiflorus gene function analysis.

[0018] The remarkable advantages of the present invention are:

[0019] The advantage of the present invention is that for the first time, a transient transformation system mediated by plant viruses has been successfully established in bamboo. This system can express foreign genes quickly and efficiently, facilitating the identification of bamboo gene functions and the exploration of the functional mechanisms of target genes. Phenotypes can be obtained within a short time, greatly saving time and economic costs. The establishment of this transient transformation system has pioneering significance for the study of functional genes in bamboo plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : Structure diagram of recombinant virus plasmid. Among them, A is the structure diagram of the initial virus; B is the structure diagram of the recombinant virus with EGFP as the target gene; C is the structure diagram of the recombinant virus with RUBY as the target gene.

[0021] Figure 2 : Phenotype diagram of recombinant virus plasmid infecting Dendrocalamus latiflorus. Among them, A shows the mosaic phenotype in the new leaves 30 days after infection and the EGFP fluorescence is observed; B shows the EGFP fluorescence observed in the whole plant of the new tillering seedlings of the axillary buds of Dendrocalamus latiflorus 45 days after infection; C shows the RUBY phenotype observed in the new leaves and the whole plant of the tillering seedlings 45 days after infection; D shows the RUBY phenotype in the roots of Dendrocalamus latiflorus.

[0022] Figure 3 : Phenotype diagram of recombinant virus plasmid infecting Phyllostachys edulis. Among them, A shows the mosaic phenotype in the new leaves 20 days after infection and the EGFP fluorescence is observed; B shows the EGFP fluorescence observed in the roots of Phyllostachys edulis 45 days after infection; C shows the RUBY phenotype observed in the roots of Phyllostachys edulis 45 days after infection; D shows the RUBY phenotype in the leaves of Phyllostachys edulis. DETAILED DESCRIPTION OF THE INVENTION

[0023] The technical solutions of the present invention will be further introduced below in conjunction with the accompanying drawings and specific embodiments.

[0024] Example 1 Cultivation of Tobacco Plant Materials and Bamboo Plant Materials

[0025] Select 30-40 well-dried tobacco seeds into a centrifuge tube, add 1 ml of 30% sodium hypochlorite to the centrifuge tube, shake and wash at 50 rpm for 10 min, and then wash the tobacco seeds 5-7 times with sterilized ultrapure water in a laminar flow cabinet to wash the sodium hypochlorite on the surface of the tobacco seeds clean. Sow the washed tobacco seeds evenly on the 1 / 2MS medium, place them in a light incubator at 28°C for 7 days, then transplant the tobacco seedlings into the mixed soil (nutrient soil: vermiculite m / m = 2:1). After transplantation, moisten the roots of the tobacco seedlings with distilled water, and finally spray a small amount of water to keep them moist for 15-20 days. After the leaves grow to 3-5 cm, carry out the subsequent experimental treatment.

[0026] Select Phyllostachys edulis and Dendrocalamus latiflorus seeds with plump and uniform texture. Remove the seed coats through a shelling machine, then soak them in water for 2 days, change the water once a day, remove the remaining seed coats floating on the water surface, and plant them in the mixed soil (nutrient soil: vermiculite m / m = 2:1) under greenhouse conditions. After evenly spreading the seeds on the soil surface, cover them with the same texture of soil for 1-2 cm, and cultivate for 18-25 days. After the leaves open to 0.8-1.0 cm, carry out the subsequent experimental treatment.

[0027] Example 2 Acquisition of Bamboo mosaic virus (BaMV) sequence

[0028] From the bamboo botanical garden of Fujian Agriculture and Forestry University, cut the relatively tender leaves of Dendrocalamus latiflorus infected with BaMV and showing typical mosaic symptoms, wrap them with tin foil and store them in liquid nitrogen. Then use a crusher to crush them, and then divide the powder into centrifuge tubes after crushing.

[0029] 1. Extraction of total RNA from Dendrocalamus latiflorus with mosaic phenotype

[0030] Aliquot 100 mg of the powder sample of Dendrocalamus latiflorus leaves obtained from the above treatment into a 1.5 mL RNase-free tube, and use the RNAprep Pure Plant Plus Kit (Polysaccharides&Polyphenolics-rich) (TIANGEN, no. DP441, China) to extract its total RNA. The specific operation is carried out according to the kit instructions, and the extraction of RNA is carried out under aseptic conditions. Use a NanoDrop 2000 spectrophotometer to detect the quality of DNA and RNA, and select RNA with good quality for downstream vector construction and genome sequencing work.

[0031] 2. RT-PCR

[0032] Take 1 μg of total RNA and use the PrimeScript TM II 1st Strand cDNA Synthesis Kit (TaKaKa, no. 6210A) kit to reverse transcribe the total RNA using the Random Primer provided in the kit as the primer. First, the RNA template denaturation reaction: 65 °C for 5 min, quickly cool on ice for 2 min; then, the reverse transcription reaction: 30 °C for 10 min, 42 °C for 60 min; finally, the enzyme inactivation reaction: 70 °C for 15 min, and the reaction system is 20 μL. All PCR reactions are carried out in a PCR instrument (Thermofisher, no. 4483636). The obtained reverse transcription product, that is, cDNA, is uniformly diluted 10 times, and the diluted cDNA is used as a template for downstream gene verification experiments.

[0033] 3. Acquisition of Bamboo mosaic virus sequence

[0034] Design upstream and downstream primers for amplifying the Bamboo mosaic virus genome, and the primers are synthesized by Shanghai Boshang Technology Co., Ltd. The PCR reaction uses 2× Flash Master Mix (Dye Plus) (P520, Vazyme). The total volume of the reaction system is 50 μl, including: 1 μl of cDNA, 2× Flash Master Mix (Dye Plus) 25 μl, forward primer (10 μM) 2 μl, reverse primer (10 μM) 2 μl, ddH 2 O 20 μl. The PCR reaction program is: 98 °C for 30 s, 98 °C for 10 s, 58 °C for 5 s, 72 °C for 25 s, 72 °C for 1 min, for 30 cycles. Among them, the upstream and downstream primer sequences are:

[0035] Forward primer: 5’-GAAAACCACTCCAAACGAAACGAAA-3’,

[0036] Reverse primer: 5’-gtttcgtcctttagggactcgtcag-3’.

[0037] PCR product detection: 1% agarose gel electrophoresis, voltage 140 V. After electrophoresis to obtain the target gene fragment of the correct size, cut the gel and operate according to the instructions of the kit (Hlingene Agarose Gel Recovery Kit, HDP202-01, Shanghai Huiling Biotechnology Co., Ltd.) to recover and purify to obtain the original bamboo mosaic virus gene sequence, as shown in SEQ ID NO.1 and Figure 1 A.

[0038] Example 3 Recombinant virus vector modification

[0039] Use XhoI and SpeI to double-digest the pCAMBIA1302 vector (www.snapgene.com / ) to obtain the linearized pCAMBIA1302 vector. Connect the bamboo mosaic virus gene sequence driven by the 2×35s promoter shown in SEQ ID NO.1 and Figure 1 A to the linearized pCAMBIA1302 vector through a seamless cloning kit (Thermo Fisher Fermentas). The specific steps are carried out according to the kit operation instructions to obtain the pCAMBIA1302-BaMV vector. In order to insert the target gene, the ORF5 subgenomic promoter sequence (SEQ ID NO.2) is inserted between the ORF4 and ORF5 sequences of the pCAMBIA1302-BaMV vector; in order to improve the infectivity of BaMV, the RNA silencing suppressor P19 sequence (SEQ ID NO.3) and the T2A self-cleaving peptide sequence (SEQ ID NO.4) derived from tomato bushy stunt virus (TBSV) are successively ligated and cloned into the SacI restriction site of the pCAMBIA1302-BaMV vector by infusion technology to obtain the recombinant virus vector.

[0040] Example 4 Acquisition of target gene fragment

[0041] Design the upstream and downstream primers for amplifying the EGFP gene (SEQ ID NO.5), and the primers were synthesized by Shanghai Boshang Technology Co., Ltd. Using the pUC22 vector plasmid (Lin, Y.C., Li, W., Chen, H., Li, Q., Sun, Y.H., Shi, R., et al. (2014) A simple improved-throughput xylem protoplast system for studying wood formation. Nat. Protoc. 9:2194–2205) as a template for PCR amplification, and the PCR reaction used 2× FlashMaster Mix (Dye Plus) (P520, Vazyme). The total reaction system was 50 μl, including: 1 μl of template, 25 μl of 2× Flash Master Mix (Dye Plus), 2 μl of upstream primer (10 μM), 2 μl of downstream primer (10 μM), and 20 μl of ddH 2 O. The PCR reaction program was: 98°C for 30 s, 98°C for 10 s, 58°C for 5 s, 72°C for 5 s, 72°C for 1 min, for 30 cycles. Among them, the sequences of the upstream and downstream primers were:

[0042] Upstream primer: 5’-taacatgcggtgacgtcgaggagaatcctggcccagtgagcaagggcgagga-3’,

[0043] Downstream primer: 5’-GAACAGGATGATGCAGttacttgtacagctcgtccatgc-3’.

[0044] Detection of PCR products: 1.5% agarose gel electrophoresis, voltage 140 V. After electrophoresis to obtain the target gene fragment of the correct size, cut the gel and operate according to the instructions of the kit (Hlingene Agarose Gel Recovery Kit, HDP202-01, Shanghai Huiling Biotechnology Co., Ltd.) to recover and purify the EGFP target gene fragment (SEQ ID NO.5).

[0045] Example 5 Construction of recombinant virus plasmid

[0046] Adopt the Infusion technology to ligate the target fragment with the recombinant virus vector, and select Hieff Universal One Step Cloning Kit (Homologous Recombination Cloning Kit, Cat#10922, Yeasen Biotechnology Co., Ltd.), add the following into a 200 μl centrifuge tube: 1 μl of the purified and recovered target gene fragment, 3 μl of the single-enzyme digested linearized recombinant virus vector, 4 μl of 2×Hieff Universal Enzyme Premix, pipette and mix well to avoid generating bubbles. Incubate the centrifuge tube in a 50 °C metal bath for 20 min.

[0047] Transform the ligation product into DH-5α competent cells, pick a single colony, and perform colony PCR verification; pick the colony with correct verification and add it to 5 ml of LB medium containing kanamycin at a final concentration of 50 mg / ml, and expand it in a shaker at 37 °C and 200 rpm for 12 h.

[0048] Take 800 μl of the above-obtained bacterial solution and mix it with 400 μl of 50% glycerol in a 1.5 ml centrifuge tube for bacterial preservation. Take 4 ml of the bacterial solution, centrifuge at 12000 rpm for 1 min to enrich the colonies, extract the plasmid using a kit (Hlingene High Purity Plasmid Mini Fast Extraction Kit, HDP201-01, Shanghai Huiling Biotechnology Co., Ltd.), and send it to Shanghai Boshang Technology Co., Ltd. for sequencing.

[0049] Transform the recombinant virus plasmid with correct sequencing results into Agrobacterium tumefaciens GV3101 competent cells, pick a single colony and add it to YEB medium containing rifampicin at a final concentration of 50 mg / ml and kanamycin at a final concentration of 50 mg / ml, culture it in a shaker at 28 °C and 200 rpm for 24 h, perform colony PCR verification, and take 800 μl of the bacterial solution with correct verification and mix it with 400 μl of 50% glycerol in a 1.5 ml centrifuge tube for bacterial preservation.

[0050] Example 6 Agrobacterium-mediated infection of tobacco plants with recombinant virus plasmid

[0051] Step 1: Transfer 500 μl of the Agrobacterium solution containing the recombinant virus plasmid to 4 ml of YEB liquid medium containing rifampicin at 50 mg / ml and kanamycin at 50 mg / ml, and culture it in a shaker at 28 °C and 200 rpm until the OD 600 reaches 0.5;

[0052] Step 2: Take 800 μl of the bacterial solution obtained in Step 1 and mix it with 400 μl of 50% glycerol in a 1.5 ml centrifuge tube for bacterial preservation. Take 1 ml of the remaining bacterial solution and centrifuge it at 12000 rpm for 1 min in a 2 ml round-bottom centrifuge tube, discard the supernatant. Use the suspension (10 mM MES, 10 mM MgCl 2, washed once with 100 μM AS, then resuspended in 2 ml, and the bacterial concentration was adjusted to OD 600 = 0.6, and left to stand at room temperature in the dark for 2 h;

[0053] Step 3: The same as the above two steps, using the recombinant virus vector without the target gene as the control group.

[0054] Step 4: Draw the bacterial liquid with a 1 ml syringe, gently prick 2 - 4 small holes on the tobacco leaves with the needle, press the syringe at the needle holes, gently press the bacterial liquid in the syringe to penetrate into the leaf tissue, mark the injected leaves with a marker pen, and then place the infected plants in a greenhouse with a light - dark cycle of 14 / 10 and a humidity of 60% for cultivation.

[0055] Example 7 Mechanical inoculation of bamboo plants with virus sap

[0056] Step 1: Seven days after the Agrobacterium tumefaciens containing the recombinant virus vector in Example 6 was used to infect tobacco, take the inoculated leaves of the tobacco plant, add 5 ml of virus infection buffer (PVP 1 wt%, PEG6000 1 wt%, tripotassium phosphate 50 mM, PH = 8, β - mercaptoethanol 10 mM) and a small amount of carborundum (600 mesh) in a mortar, quickly and thoroughly grind the leaves, and collect the leaf grinding liquid as the inoculation liquid;

[0057] Step 2: Evenly sprinkle a small amount of carborundum (600 mesh) on the leaves of Dendrocalamus latiflorus and Phyllostachys edulis, and dip a writing brush in a small amount of inoculation liquid to rub the leaf surface;

[0058] Step 3: After all inoculations are completed, cover and moisturize the treated plants for 10 min, then rinse all the carborundum on the plant leaves with a spray bottle filled with distilled water, and then place them in a 25 °C greenhouse for normal cultivation.

[0059] The construction and infection of the recombinant virus plasmid of the target gene RUBY (SEQ ID NO.6) were carried out using the same method as above. Among them, the upstream and downstream primer sequences for amplifying the RUBY gene are:

[0060] Upstream primer: 5’ - gaatcctggcccaATGGATCATGCGACCCTC - 3’,

[0061] Downstream primer: 5’ - CAGGATGATGCAGTCACTATCACTGGAGGCTTG - 3’.

[0062] Example 8 Observation of virus infection phenotypes

[0063] Water the infected materials regularly to ensure the healthy growth of the plants. Continuously observe the phenotypic changes of the plant leaves, and use a handheld dual-wavelength fluorescence excitation light source (LUYOR-3415, Shanghai Luyang Instrument Co., Ltd.) to observe the expression of the target gene.

[0064] According to the phenotypic results, exogenous genes mediated by bamboo mosaic virus can be expressed in Dendrocalamus latiflorus and Phyllostachys edulis.

[0065] Establishing a rapid and reliable transformation system is of great significance for the research of gramineous plants. Many plants are difficult to transform. Using the transient expression system mediated by bamboo mosaic virus established by us can quickly, efficiently and specifically study our target gene without the need for traditional genetic transformation of bamboo.

[0066] The above are only the preferred embodiments of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope of the present invention.

Claims

1. A bamboo mosaic virus-mediated foreign gene expression system, characterized in that: the components of the foreign gene expression system include the bamboo mosaic virus genome, the linearized pCAMBIA1302 vector, the ORF5 subgenomic promoter, the RNA silencing suppressor P19, the T2A self-cleaving peptide, the foreign gene, and Agrobacterium tumefaciens GV3101; the construction method of the foreign gene expression system includes the following steps: 1) Extract the total RNA of Dendrocalamus latiflorus infected with bamboo mosaic virus, reverse transcribe the extracted total RNA to obtain cDNA, and use the reverse transcribed cDNA as a template to perform PCR amplification to obtain the full-length genome sequence of bamboo mosaic virus; 2) Double-digest the pCAMBIA1302 vector with restriction enzymes XhoⅠ and SpeⅠ to obtain the linearized pCAMBIA1302 vector, and ligate the full-length genome sequence of bamboo mosaic virus driven by the 2×35s promoter with the linearized pCAMBIA1302 vector to obtain the pCAMBIA1302-BaMV vector; 3) Insert the ORF5 subgenomic promoter sequence between the ORF4 and ORF5 sequences of the pCAMBIA1302-BaMV vector, and then ligate the RNA silencing suppressor P19 sequence and the T2A self-cleaving peptide sequence in sequence and clone them into the SacⅠ restriction site of the pCAMBIA1302-BaMV vector to obtain a recombinant virus vector; 4) Ligate the foreign gene with the recombinant virus vector obtained in step 3), and then transfer it into Agrobacterium tumefaciens GV3101 competent cells to obtain a bamboo mosaic virus-mediated foreign gene expression system; the RNA silencing suppressor P19, the T2A self-cleaving peptide, and the foreign gene are located between ORF4 and ORF5 of the recombinant virus vector in sequence; the nucleotide sequence of the full-length genome of the bamboo mosaic virus is as shown in SEQ ID NO.1, the nucleotide sequence of the ORF5 subgenomic promoter is as shown in SEQ ID NO.2, the nucleotide sequence of the RNA silencing suppressor P19 is as shown in SEQ ID NO.3, and the nucleotide sequence of the T2A self-cleaving peptide is as shown in SEQ ID NO.4; the foreign gene includes the EGFP gene or the RUBY gene.

2. The bamboo mosaic virus-mediated foreign gene expression system according to claim 1, characterized in that: the primer sequences used for the PCR amplification are: Forward primer: 5’-GAAAACCACTCCAAACGAAACGAAA-3’, Reverse primer: 5’-gtttcgtcctttagggactcgtcag-3’.

3. Application of the bamboo mosaic virus-mediated foreign gene expression system according to claim 1 in the field of Phyllostachys edulis gene function analysis.

4. Application of the bamboo mosaic virus-mediated foreign gene expression system according to claim 1 in the field of Dendrocalamus latiflorus gene function analysis.