An efficient dynamic DNA nanosystem based on dual DNA walkers and its preparation and application

Abstract

The present invention belongs to the technical field of electrochemical sensing analysis and detection, and specifically relates to an efficient dynamic DNA nanosystem based on a double DNA walker, and its preparation and application. The present invention uses magnetic nanoparticles (MNPs) as carriers to prepare a multi-legged DNA walker. The hairpin structure of the walking chain makes it in a closed state. In order to activate it to a greater extent, the closed tethered walking chain is modified on the same particle surface at the same time, and a new type of double DNA walker is prepared, and further an efficient dynamic DNA nanosystem based on the double DNA walker is prepared. The efficient dynamic DNA nanosystem of the present invention has extremely high sensitivity to KRAS. In addition, it also shows good specificity, reproducibility and stability, and an ideal recovery rate is also measured when analyzing the target in serum.

Description

Technical Field

[0001] The invention belongs to the technical field of electrochemical sensing analysis and detection, and specifically relates to a high-efficiency dynamic DNA nanosystem based on a double DNA walker and its preparation and application. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] In order to meet the high requirements of clinical diagnosis for the accuracy of disease marker detection, DNA walkers, as a programmable, autonomous and efficient DNA nanotechnology, have been increasingly widely used in the field of biosensors. From the development in recent years, it can be found that multi-legged DNA walkers can connect to the track more stably during walking due to their higher local walking chain concentration, which makes up for the shortcomings of single-legged and bipedal DNA walkers that are easy to derail during the reaction, and thus show better detection performance. In practical applications, in most cases, it is necessary to first perform a closed treatment on the multi-legged DNA walker to achieve the response to the target, and at the same time, the walking chain is also released so that subsequent reactions can be carried out. Because the target is often extremely low in content and easily inactivated, in the previous work, the inventor used the target cyclic reaction to increase the activation degree of the multi-legged DNA walker. The inventor noticed that when the target is activated on the surface of the multi-legged DNA walker, it is easy to detach from the surface of the gold nanoparticles, resulting in unsatisfactory reaction efficiency, and it is difficult to fully release the closed walking chain with a high local concentration, which will greatly reduce the subsequent reaction efficiency of the multi-legged DNA walker and fail to exert its excellent signal amplification ability. Therefore, in order to further enhance the effect of target recycling in the activation process of multi-legged DNA walkers, it is necessary to develop technologies that can improve the continuity of related reactions.

[0004] In the operation of DNA walkers, their movement on the track mainly depends on uncontrollable random collisions, so in addition to the concentration, the position of the walking chain relative to the track is also a key factor in determining the reaction efficiency. Yang et al. reported a directional DNA walker with a spatially confined walking chain and track chain on the surface of a gold nanoparticle. The walking chain is tethered to the surface of the gold nanoparticle by a swing arm, which can limit the movement of the DNA walker on the three-dimensional track constructed by the DNA-functionalized gold nanoparticles, realize the spatially confined directional collision between the walking chain and the track chain, reduce the risk of derailment, accelerate enzymatic cutting, and significantly improve the reaction efficiency. As far as the inventor knows, there are few reports on the activation of multi-legged DNA walkers by tethered walking chains, so research in this area is worth trying.

[0005] Nuclease-assisted target cyclic amplification reactions are based on aptamer recognition and Watson-Crick base complementary pairing principles, which can produce various DNA duplexes with specific structures to trigger catalytic cleavage reactions of different nucleases such as endonucleases and exonucleases, which will lead to the recycling of targets or certain target recognition-related nucleic acids, thereby significantly improving sensitivity. Among them, the working principle of exonuclease III is to gradually and directionally cut off single nucleotides from the 3' blunt end or concave end without the need for specific recognition sites, which makes the design of nucleic acid probes more flexible. In addition, exonuclease III also has the advantages of low cost and not easy to inactivate, so it is widely used in various enzyme-assisted target cyclic reactions. In addition to repeated nuclease catalytic reactions for signal amplification, exonuclease III is also one of the most commonly used driving forces of DNA walkers. Autonomous DNA walking driven by exonuclease III can effectively simplify bioassay operations and well ensure the repeatability of biosensors. In addition, due to its excellent hydrolysis rate, exonuclease III-driven DNA walkers show high processability and mobility. Therefore, exonuclease III-assisted target cyclic amplification reaction can be used as a very suitable amplification technology in combination with multi-legged DNA walkers. Summary of the invention

[0006] In order to overcome the deficiencies of the prior art, the purpose of the present invention is to provide a dual DNA walker and a preparation method thereof and application in sensors. The present invention uses magnetic nanoparticles (MNPs) as carriers to prepare a multi-legged dual DNA walker, and the hairpin structure of the walking chain makes it in a closed state. In order to activate it to a greater extent, the closed tethered walking chain is modified on the surface of the same particle at the same time, thereby preparing a new type of dual DNA walker, and further preparing an efficient dynamic DNA nanosystem based on the dual DNA walker.

[0007] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0008] The first aspect of the present invention provides a method for preparing a double DNA walker, comprising the following steps:

[0009] S1, mix the Tris-HCl buffer containing hairpin H with the Tris-HCl buffer containing tethered walking chain TW and closed chain B in a ratio of 1:1, heat and maintain, then cool to room temperature and maintain, to obtain a mixed solution for standby use;

[0010] S2, the mixed solution obtained in step S1 is mixed and diluted with Tris-HCl buffer to disperse the activated MNPs, shaken overnight, and washed with Tris-HCl buffer to remove unbound DNA in the solution to obtain a double DNA walker;

[0011] The nucleotide sequence of the hairpin H is shown in SEQ ID No.1; the nucleotide sequence of the tethered walking chain TW is shown in SEQ ID No.2; and the nucleotide sequence of the closed chain B is shown in SEQ ID No.3.

[0012] The second aspect of the present invention provides a double DNA walker prepared by the above-mentioned preparation method of the double DNA walker.

[0013] The third aspect of the present invention provides a highly efficient dynamic DNA nanosystem, comprising the above-mentioned dual DNA walker, a sensing platform, ExoⅢ, a target and a DNA-MB; the nucleotide sequence of the DNA-MB is shown in SEQ ID No.4.

[0014] The fourth aspect of the present invention provides the use of the above-mentioned dual DNA walker and / or the above-mentioned high-efficiency dynamic DNA nanosystem in the preparation of a nucleic acid detection kit.

[0015] The beneficial effects achieved by one or more technical solutions of the present invention are as follows:

[0016] (1) The dual DNA walker of the present invention can be separated by magnetic separation, making it more convenient and faster in the preparation process and having a better separation effect. Through the clever chain design, the multi-legged dual DNA walker does not need to be cleaned during the detection process, which can greatly simplify the operation during the detection;

[0017] (2) Using the murine sarcoma viral oncogene (KRAS) as the target, driven by exonuclease III, the dual DNA walker was fully activated through the target circulation and the three-dimensional walking of the tethered walking chain. Then, the ultrasensitive electrochemical ratio detection of the target was achieved through the rapid rolling of the cascaded dual DNA walker on the electrode surface and the bidirectional signal amplification of the ratiometric electrochemical biosensor. The designed efficient dynamic DNA nanosystem has extremely high sensitivity to KRAS and shows great potential for practical applications.

[0018] (3) The successful preparation of the dual DNA walker and the feasibility of the scheme were fully confirmed by means of PAGE, TEM, UV-Vis, and Zeta potential. The analytical performance of the sensor was comprehensively evaluated by electrochemical testing, with a linear range of 10aM-1pM and a detection limit as low as 3.88aM. The results showed that the efficient dynamic DNA nanosystem of the present invention has high sensitivity. In addition, it also exhibits good specificity, reproducibility, and stability. An ideal recovery rate was also measured when analyzing the target in serum. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0020] Figure 1 The schematic diagram of the dual DNA walker and the efficient dynamic DNA nanosystem of the present invention for ultra-sensitive ratio detection of KRAS;

[0021] Figure 2 TEM images of MNPs (A) and MNP@(H+TW / B) (B) in Example 1;

[0022] Figure 3 UV-visible absorption spectra of the mixed solution of H and TW / B before (a) and after (b) reaction with MNPs;

[0023] Figure 4 Figure 1 is a polyacrylamide gel electrophoresis diagram of the activation stage of the double DNA walker, where 1, KRAS; 2, B; 3, TW; 4, H; 5, WS; 6, TW / B; 7, TW / B+KRAS; 8, TW / B+KRAS+ExoⅢ; 9, TW / H; 10, TW / H+ExoⅢ; 11, TW / B+KRAS+H+ExoⅢ; 12, TW / B+H(c DNA =1μM,c ExoⅢ =3U / μL); M, DNA marker (20,40,60,80,100,120,140,160,180,200,300,400,500bp);

[0024] Figure 5 The polyacrylamide gel electrophoresis diagram of the signal output stage, wherein, 1, A; 2, DNA-Fc; 3, TS; 4, DNA-MB; 5, WS; 6, TS / A; 7, TS / DNA-Fc; 8, TS / (A+DNA-Fc); 9, TS / (A+DNA-Fc)+WS; 10, TS / (A+DNA-Fc)+DNA-MB; 11, TS / (A+DNA-Fc)+WS+DNA-MB; 12, TS / (A+DNA-Fc)+H; 13, H (the concentrations of W and DNA-MB are 1μM, and the concentrations of other DNAs are all 250nM); M, DNA marker (20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 300, 400, 500bp);

[0025] Figure 6The bare gold electrode (a), gold electrode / TS (b), gold electrode / TS / (A+DNA-Fc) (c), gold electrode / TS / (A+DNA-Fc) / MNP@(WS+TW) (d) and the efficient dynamic DNA nanosystem of Example 6 (e) in the presence of 5.0 mM [Fe(CN)6] 3- / 4- Enquist plot of electrochemical impedance spectroscopy in 0.1M KCl;

[0026] Figure 7 The ACV response curves of the dual DNA walker of Example 1 to 0 pM KRAS (a) and 1 pM KRAS (b), as well as the monopod DNA walker H (c) and the untethered multipod DNA walker MNP-H (d) to 1 pM KRAS;

[0027] Figure 8 (A) ACV response curve of the efficient dynamic DNA nanosystem of Example 6 to different concentrations of KRAS: 0aM, 10aM, 100aM, 1fM, 10fM, 100fM and 1pM (from a to g); (B) I MB / I Fc With log c KRAS The linear relationship between

[0028] Fig. 9 is the ACV response intensity of the efficient dynamic DNA nanosystem of Example 6 when detecting KRAS, Sm-KRAS, Tm-KRAS and N-KRAS;

[0029] Fig.10 The ACV response intensity of the high-efficiency dynamic DNA nanosystem of Example 6 to KRAS after being stored at 4°C for 0, 1, 3, 5, and 7 days, respectively. DETAILED DESCRIPTION

[0030] Glossary: ​​Morpholineethanesulfonic acid (MES), N-hydroxysulfosuccinimide sodium salt (NHS), tris(2-carboxyethyl)phosphine hydrochloride (TCEP), 6-mercapto-1-hexanol (MCH), ethyl [3-(dimethylamino)propyl]carbodiimide hydrochloride (EDC), tris(hydroxymethylaminomethane) hydrochloride (Tris-HCl).

[0031] A first typical embodiment of the present invention is a method for preparing a double DNA walker, comprising the following steps:

[0032] S1, mix the Tris-HCl buffer containing hairpin H with the Tris-HCl buffer containing tethered walking chain TW and closed chain B in a ratio of 1:1, heat and maintain, then cool to room temperature and maintain, to obtain a mixed solution for standby use;

[0033] S2, the mixed solution obtained in step S1 is mixed and diluted with Tris-HCl buffer to disperse the activated MNPs, shaken overnight, and washed with Tris-HCl buffer to remove unbound DNA in the solution to obtain a double DNA walker;

[0034] The nucleotide sequence of the hairpin H is shown in SEQ ID No.1; the nucleotide sequence of the tethered walking chain TW is shown in SEQ ID No.2; and the nucleotide sequence of the closed chain B is shown in SEQ ID No.3.

[0035] In one or more examples of this embodiment, the activation process of the activated MNPs comprises the following steps:

[0036] The MNPs were diluted to 1 mg / mL with MEST buffer and washed thoroughly, and the supernatant was removed after magnetic separation. The MNPs were then dispersed with 0.1 M MES buffer containing 15-25 mg / mL NHS and 15-25 mg / mL LEDC, activated by shaking at 25°C, and washed twice with MES buffer and Tris-HCl buffer respectively. The supernatant was removed after magnetic separation to obtain activated MNPs.

[0037] In one or more examples of this embodiment, the concentration of hairpin H in the Tris-HCl buffer containing hairpin H in step S1 is 10-30 μM;

[0038] The ratio of the concentration of the tethered walking chain TW in the Tris-HCl buffer containing the tethered walking chain TW and the closed chain B to the concentration of the hairpin H in the Tris-HCl buffer containing the hairpin H is 1:10-1:30;

[0039] The concentration of the blocking chain B in the Tris-HCl buffer containing the tethered walking chain TW and the blocking chain B is 2-5 μM.

[0040] In one or more examples of this implementation mode, the heating temperature in step S1 is 85-95° C., the heating maintenance time is 10-30 min, and the cooling maintenance time is 2-12 h.

[0041] In one or more examples of this embodiment, the shaking temperature in step S2 is 25° C. and the shaking time is 12-24 hours.

[0042] The second typical embodiment of the present invention is a double DNA walker, which is prepared by the above-mentioned preparation method of the double DNA walker.

[0043] like Figure 1As shown in A, the double DNA walker is composed of two amino-modified walking chains. The hairpin H and the tethered walking chain TW are stably bound to the surface of MNPs through amide bonds. The hairpin structure of H itself closes the binding site in the stem, and TW is used as the "key" to open H to activate the multi-legged DNA walker. Its binding site is completely closed by the excess closed chain B. The thorough closing of H and TW can prevent the walker from participating in subsequent reactions when there is no target. In addition, the 3' ends of H and B are both convex ends, which also prevents exonuclease III from directly hydrolyzing them. When the target KRAS is present, KRAS can hybridize with B through a strand displacement reaction, and exonuclease III can recognize the 3' blunt end of B and hydrolyze it. KRAS with a 3' convex end will not be hydrolyzed and can continue to release TW through the target cyclic amplification reaction with the assistance of exonuclease III. A very small amount of target can achieve full release of TW. In order to ensure that TW can hybridize with H smoothly, the present invention inserts a mismatched base in the stem while ensuring that H forms a stable hairpin structure. The released TW can easily hybridize with H also modified on the surface of MNPs and open the hairpin, while forming the 3' blunt end of H. Exonuclease III acts as the driving force for TW to walk, hydrolyzing H to release TW so that it can continue to walk efficiently in three dimensions on the surface of MNPs. The final result is that H is partially hydrolyzed, the binding sites involved in the subsequent reaction are completely released, and the conversion to the walking chain WS (sequence table as shown in SEQ ID No. 8) is completed. At the same time, TW can walk continuously in a large range under the drive of exonuclease III because of its long flexible swing arm and the distance advantage between it and H, thus realizing the activation of the double DNA walker.

[0044] A third typical embodiment of the present invention is a highly efficient dynamic DNA nanosystem, comprising the above-mentioned dual DNA walker, a sensing platform, Exo III, a target and DNA-MB;

[0045] The nucleotide sequence of the DNA-MB is shown in SEQ ID No.4.

[0046] In one or more examples of this embodiment, the sensing platform is constructed by the following steps:

[0047] TS reduced by TCEP was added dropwise to the surface of the activated gold electrode, incubated at 4°C overnight, washed, immersed in MCH, and finally a mixed solution containing 2 μM auxiliary chain A and 2 μM DNA-Fc was added dropwise to the washed electrode surface, incubated at room temperature, washed, and obtained a sensing platform;

[0048] The nucleotide sequence of the auxiliary chain A is shown in SEQ ID No.5; the nucleotide sequence of the DNA-Fc is shown in SEQ ID No.6; and the nucleotide sequence of the TS is shown in SEQ ID No.7.

[0049] In one or more examples of this embodiment, the concentration of TCEP is 5-15 nM, the concentration of TS is 0.5-1.5 nM, the reduction condition is room temperature in the dark, and the reduction time is 1-2 h.

[0050] In one or more examples of this embodiment, the concentration of the MCH solution is 1 mM, the immersion time is 0.5-1.5 h, and the incubation time at room temperature is 60-90 min.

[0051] like Figure 1 As shown in Figure B, the track chain TS was modified on the surface of the bare gold electrode through the Au-S interaction, and the redundant active sites were blocked with MCH to prevent the occurrence of nonspecific adsorption. Then, the auxiliary chain A and DNA-Fc modified with ferrocene (Fc) were used to block TS, completing the construction of the sensor. Subsequently, the activated multi-legged DNA walker and DNA-MB modified with methylene blue (MB) were simultaneously introduced into the sensing interface. The activated multi-legged DNA walker was able to bind to TS through WS and displace A, exposing a foothold for DNA-MB to bind. DNA-MB displaced WS and DNA-Fc through branch migration, and the released WS continued to walk forward. Finally, driven by the chain displacement reaction, the multi-legged DNA walker continued to roll forward, and A and DNA-Fc were released. With the stable binding of a large amount of DNA-MB to TS, the electrochemical responses corresponding to Fc and MB decreased and increased respectively. The bidirectional signal change also further amplified the signal output, realizing the ratiometric electrochemical detection of the target.

[0052] During the entire detection process, multiple signal amplification is performed on the detection of the target through the exonuclease III-assisted target circulation and tethered DNA walker walking, the rolling of the multi-legged DNA walker on the electrode surface, and the ratiometric bidirectional signal amplification cascade. The hydrolysis of exonuclease III can avoid the reverse reaction and thus activate the walker to the greatest extent. The tethered TW has a longer flexible swing arm and is closer to H, which can effectively prevent derailment during walking and is more efficient than homogeneous reactions. The 3' ends of the double-stranded DNA on the electrode surface are designed as convex ends. On the one hand, they will not be hydrolyzed by exonuclease III. Therefore, the walker can complete the detection without washing during the detection process, which greatly improves the convenience and practicality of the sensor. On the other hand, it also brings the Fc molecules and MB molecules closer to the electrode, which can produce more obvious electrochemical signal responses. The ratiometric electrochemical biosensor can also effectively reduce interference from the external environment.

[0053] A fourth typical embodiment of the present invention is the use of the above-mentioned dual DNA walker and / or the above-mentioned high-efficiency dynamic DNA nanosystem in the preparation of a nucleic acid detection kit.

[0054] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in combination with specific embodiments and comparative examples.

[0055] Table 1 DNA and sequences used in the present invention (bold indicates mismatched bases)

[0056]

[0057] Example 1

[0058] 50 μL of MNPs (10 mg / mL) were transferred to a centrifuge tube, diluted to 1 mg / mL with MEST buffer and washed three times, and the supernatant was removed after magnetic separation. Then, MNPs were dispersed with 500 μL of 0.1 M MES buffer containing NHS (20 mg / mL) and EDC (20 mg / mL), and activated by shaking at 25°C for 3 hours.

[0059] In a centrifuge tube, 10 μL of H (100 μM) was diluted to 20 μM with 40 μL of 10 mM Tris-HCl buffer. At the same time, 0.5 μL of TW (100 μM), 2 μL of B (100 μM) and 47.5 μL of Tris-HCl buffer were added to another centrifuge tube. The solutions in the two centrifuge tubes were mixed and heated to 90 °C for 10 min, and then gradually cooled to room temperature for at least 2 h to allow H to form a stable hairpin structure and achieve the closure of TW. After the activation of MNPs was completed, the MNPs were washed twice with MES buffer and Tris-HCl buffer respectively, and the supernatant was removed after magnetic separation. Then, the annealed H, TW / B were fully mixed with 400 μL Tris-HCl buffer to redisperse MNPs and shaken overnight at 25 °C to allow H and TW / B to bind to the surface of MNPs through amide bonds. Finally, the samples were washed three times with Tris-HCl buffer to remove unbound DNA in the solution, and then re-dispersed and stored at 4 °C for future use, named MNP@(H+TW / B).

[0060] like Figure 2 As shown in A, the unmodified MNPs are spherical in shape with an average particle size of about 10 nm; Figure 2 As shown in B, after H and TW / B are modified on the surface of MNPs, it can be observed that the overall color of MNPs becomes darker. This is caused by the residual salt carried by the DNA anchored on the surface of MNPs, indicating that the DNA has been successfully modified on the surface of MNPs.

[0061] Figure 3 Curve a in the figure represents a mixed solution of H and TW / B, and an obvious characteristic peak is observed near 260 nm. The MNP@(H+TW / B) supernatant is taken out by magnetic separation and its UV-visible absorption spectrum is tested, as shown in Fig. Figure 3 As shown in the middle curve b, it can be seen that the characteristic peak of DNA is significantly reduced, indicating that after modification, the DNA in the solution is significantly reduced compared to the initial amount, which also indirectly illustrates the successful preparation of MNP@(H+TW / B).

[0062] Example 2

[0063] Different from Example 1, 5 μL of H (100 μM) was diluted to 10 μM with 45 μL of 10 mM Tris-HCl buffer.

[0064] Example 3

[0065] Different from Example 1, 7.5 μL of H (100 μM) was diluted to 15 μM with 42.5 μL of 10 mM Tris-HCl buffer.

[0066] Example 4

[0067] Different from Example 1, 12.5 μL of H (100 μM) was diluted to 25 μM with 37.5 μL of 10 mM Tris-HCl buffer.

[0068] Example 5

[0069] Different from Example 1, 15 μL of H (100 μM) was diluted to 30 μM with 35 μL of 10 mM Tris-HCl buffer.

[0070] Example 6

[0071] First, the gold electrode was polished with alumina slurry with a particle size of 50 nm until a mirror surface was obtained, and then the electrode was rinsed twice with anhydrous ethanol and ultrapure water respectively. Finally, the gold electrode was electrochemically activated by cyclic voltammetry (CV) in 0.5M H2SO4 solution, and the potential was scanned in the range of -0.2V to 1.6V at a scan rate of 0.1V / s until a stable cyclic voltammogram was obtained, and the activated gold electrode was obtained after being fully rinsed with ultrapure water.

[0072] 1μM TS was reduced with 10mM TCEP for 1 hour in the dark at room temperature to activate the thiol group, and then 5μL of the above solution was added to the surface of the activated gold electrode, and incubated overnight at 4°C to anchor TS on the gold electrode surface through gold-sulfur interaction. After cleaning, the electrode was immersed in 1mM MCH for 1h to block the excess active sites on the electrode surface and avoid nonspecific adsorption. Finally, a mixed solution containing 2μM A and 2μM DNA-Fc was added to the cleaned electrode surface and incubated at room temperature for 80min to hybridize with TS to form a TS / (A+DNA-Fc) three-chain complex. After cleaning, the construction of the sensing platform was completed.

[0073] The target of unknown concentration and 3U / μL ExoⅢ were mixed with 1mg / mL MNP@(H+TW / B) obtained in Example 1 and shaken at a constant temperature of 37°C for 90min. After the reaction was completed, the final solution was mixed with 2μM DNA-MB and dropped onto the constructed sensing platform surface and incubated at 37°C for 1h to obtain an efficient dynamic DNA nanosystem.

[0074] Example 7

[0075] The difference from Example 6 is that the MNP@(H+TW / B) obtained in Example 2 was used.

[0076] Example 8

[0077] The difference from Example 6 is that the MNP@(H+TW / B) obtained in Example 3 was used.

[0078] Example 9

[0079] The difference from Example 6 is that the MNP@(H+TW / B) obtained in Example 4 was used.

[0080] Example 10

[0081] The difference from Example 6 is that the MNP@(H+TW / B) obtained in Example 5 was used.

[0082] Experimental Example 1

[0083] The activation process of the double DNA walking system was verified by 12% polyacrylamide gel electrophoresis. Figure 4As shown, lanes 1 to 5 are KRAS, B, TW, H and WS respectively; lane 6 is a mixed solution of TW and B, and it can be seen that the bands representing TW and B disappear and a brighter band that is slower than TW appears. This band represents the TW / B double chain, indicating that B successfully blocks TW; after KRAS is added to TW / B, it can be observed that the band of TW / B becomes lighter, the band of KRAS disappears, and the band representing KRAS / B appears, and the band of TW also reappears (lane 7), which shows that KRAS successfully replaces B and hybridizes with it; after KRAS and exonuclease III are added to TW / B at the same time, the TW / B band disappears completely, the KRAS band reappears, and a bright TW band is also observed (lane 8), indicating that B is completely hydrolyzed and TW is completely released. Compared with lane 7, the reaction is more complete, which strongly confirms the cyclic reaction of the target. Lane 9 represents a mixed solution of TW and H, in which the slower band represents TW / H, and the bands representing TW and H become lighter, indicating that TW can open the hairpin of H and hybridize with it; after incubating TW / H with exonuclease III, it can be clearly seen in lane 10 that the band of TW / H completely disappears, the band of TW reappears, and a new band appears at the same time. According to the position of the band, it is determined to be WS obtained by partial hydrolysis of H, indicating that under the drive of exonuclease III, TW can effectively activate the walker; Lane 11 verifies the entire activation process as a whole, and only the bands representing TW, WS and KRAS are observed, which fully demonstrates that with the assistance of exonuclease III, TW is fully released through the target circulation, thereby achieving the activation of the walker; Lane 12 shows that the blocked TW cannot react with H and will not cause leakage.

[0084] exist Figure 5In the figure, the bands in lanes 1 to 5 represent A, DNA-Fc, TS, DNA-MB and WS, respectively; only one band was observed in lanes 6 and 7, representing TS / A and TS / DNA-Fc, respectively, indicating that TS can stably bind to A or DNA-Fc; lane 8 is a mixed solution of TS, A and DNA-Fc, and only one slower and brighter band can be seen, indicating the formation of the three-stranded complex TS / (A+DNA-Fc) and that TS can be completely blocked; after TS / (A+DNA-Fc) was mixed with excess WS, a band representing TS / (WS+DNA-Fc) appeared. Because WS has more bases than A, it is slower than TS / (A+DNA-Fc), and the band of A also reappeared (lane 9), confirming that WS hybridized with TS and replaced A; in lane 10, we mixed TS / (A+DNA-Fc) with excess DNA-MB to verify whether leakage occurred, and we can see that only The presence of TS / (A+DNA-Fc) and DNA-MB bands indicates that DNA-MB cannot bind to TS before the foothold is exposed. When WS and DNA-MB co-exist, the band representing TS / (A+DNA-Fc) almost disappears, the band of DNA-MB also becomes significantly lighter, while the bands of A and DNA-Fc reappear, and a bright band representing TS / DNA-MB appears (lane 11). This confirms that, driven by chain displacement, the TS / (WS+DNA-Fc) complex is first formed and the foothold for DNA-MB binding is exposed. Subsequently, DNA-MB displaces A and DNA-Fc through branch migration to form a stable TS / DNA-MB double chain with TS. In addition, in lane 12, only bands representing TS / (A+DNA-Fc) and H (corresponding to the H band in lane 13) can be observed, indicating that no reaction occurs after the two are mixed, that is, the inactivated walker cannot participate in the subsequent electrode reaction, and therefore will not cause leakage. The above results fully verified the reaction between DNA during the detection process and provided strong evidence for the feasibility of the scheme.

[0085] Experimental Example 2

[0086] Electrochemical characterization

[0087] By adding 5.0 mM [Fe(CN)6] 3- / 4- Electrochemical impedance spectroscopy was performed in 0.1 M KCl to verify the gradual modification and reaction of the electrode surface. Figure 6 As shown, the illustration is an equivalent fitting circuit, and the symbols in the figure represent: R ct is the surface charge transfer resistance, Z W is the Warburg impedance generated by the diffusion of the redox probe, R Ωis the electrolyte solution resistance, C d is the double layer capacitance. Curve a is the EIS spectrum of the bare gold electrode. It can be seen that it is almost a straight line, indicating that the conductivity of the electrode is very good, R ct The value is only 5.475Ω. After TS was anchored and the electrode was sealed with MCH, the phosphate backbone of DNA carried a large amount of negative charge, which would react with [Fe(CN)6] 3- / 4- There is a repulsion between the anions, and MCH will further hinder the [Fe(CN)6] 3- / 4- The diffusion of anions to the electrode surface results in a clear semicircular area on curve b. ct The value is 726.5Ω. After TS is blocked by A and DNA-Fc, more negative charges produce stronger electrostatic repulsion, and a larger semicircle appears, with R ct The value continues to increase to 1417Ω (curve c). The above results indicate the successful construction of the sensing platform.

[0088] In the subsequent reaction process, the MNP@(WS+TW) obtained after incubation with KRAS and ExoⅢ was first incubated with the gold electrode alone. Since WS can replace A in the three-chain complex on the electrode surface and hybridize with TS, MNP@(WS+TW) is connected to the electrode. At the same time, MNP@(WS+TW) contains a large amount of WS and TW and both have more bases, so the radius of the semicircle increases significantly, and its R ct The value increased to 1808Ω (curve d). After the gold electrode was incubated with MNP@(WS+TW) and DNA-MB, its R ct The value decreases to 1352Ω (curve e), indicating that DNA-MB provides a driving force for the rolling of MNP@(WS+TW) and forms a large number of TS / DNA-MB complexes on the electrode surface through a toehold-mediated chain displacement reaction. At the same time, A, MNP@(WS+TW) and DNA-Fc are separated from the track chain. Moreover, since the number of bases in DNA-MB is slightly less than the sum of the bases in A and DNA-Fc, the radius of curve e is also slightly smaller than that of curve c. All of these results strongly prove the successful construction of the sensing platform and the response of the sensing interface is in line with expectations.

[0089] Further, alternating current cyclic voltammetry (ACV) tests were performed in 10 mM Tris-HCl buffer solution. Figure 7As shown in the figure, when KRAS is not present, a very small current peak and a very large current peak are observed near -0.23 V and near +0.47 V (curve a), which correspond to the electrochemical signals of MB and Fc, respectively. This indicates that in the absence of KRAS, the hybridization site between TW and H is blocked by B, and the activation of MNP@(H+TW / B) cannot be initiated, and the subsequent reaction on the electrode surface will not occur. We speculate that this small background signal is due to the nonspecific hydrolysis of exonuclease III. After adding 1pM KRAS, it can be observed that IMB increases significantly, while IFc decreases significantly (curve b), indicating that KRAS undergoes a chain displacement reaction with TW / B and releases a large amount of TW through the target circulation assisted by exonuclease III. Subsequently, TW hybridizes with H, and the hairpin structure of H is opened and partially hydrolyzed by exonuclease III. After the continuous movement of TW, fully activated MNP@(WS+TW) is obtained, which then releases a large amount of DNA-Fc and generates a large amount of TS / DNA-MB by rolling on the electrode surface driven by TMSDR, resulting in the reverse change of IMB and IFc, and finally further amplifying the signal through the ratiometric signal output mode.

[0090] Under the condition of adding the same concentration of KRAS, we carried out a control experiment by replacing MNP@(H+TW / B) with a monopodial DNA walker (H). It can be seen that the values ​​of IMB and IFc in curve c also increased and decreased, respectively, but the amplitude of change was significantly smaller. This is because the activation process of the monopodial DNA walker occurs in the homogeneous phase, and TW can only hybridize with H and activate it through a small probability of random collision. This reaction mode is very inefficient, so the amount of WS in the final solution is small, and when the reaction occurs on the electrode surface, the single-stranded WS is also prone to derailment, resulting in poor continuity of the walking process. This is also a common problem of monopodial DNA walkers. Therefore, the dual-DNA walker designed in the present invention has higher reaction efficiency than the monopodial DNA walker. In addition, we also designed a non-tethered multi-legged DNA walker (MNP-H) to replace MNP@(H+TW / B), and also conducted further control experiments by detecting 1pM KRAS. It can be seen that a large ACV response appeared, and the changes in IMB and IFc were between the single-legged DNA walker and the tethered double DNA walker, indicating that MNP-H enriched the walking chain on the surface of MNPs, increased the local concentration of the walking chain, and effectively improved the reaction efficiency. However, the non-tethered TW also has the risk of derailment during the activation of MNP-H, so the final activation degree is still different from that of the double DNA walker, resulting in a relatively low electrochemical signal response. The above results all show that the double DNA walker we proposed has a better activation effect under the same conditions, and also fully confirms the feasibility and excellent signal amplification effect of the present invention.

[0091] Experimental Example 3

[0092] The high-efficiency dynamic DNA nanosystem obtained in Example 6 was used to detect different concentrations of KRAS and perform ACV tests, such as Figure 8 As shown in A, curves a to g represent the ACV response of the sensor to 0aM, 10aM, 100aM, 1fM, 10fM, 100fM and 1pM KRAS, respectively. It can be seen that with the increase of cKRAS, IMB and IFc show an increasing and decreasing trend, respectively. The IMB and IFc in the ACV curve were read, with log cKRAS as the horizontal axis and IMB / IFc as the vertical axis, and a standard curve was established after linear fitting ( Figure 8 B), the linear equation is IMB / IFc=1.765+0.07581log cKRAS, the linear range is between 10aM and 1pM, and the linear correlation coefficient is 0.9951. According to the 3σ rule, the lowest detection limit (LOD) of the sensor for KRAS is calculated to be as low as 3.88aM.

[0093] Experimental Example 4

[0094] The selectivity of the efficient dynamic DNA nanosystem was evaluated by detecting four different DNA fragments (all at a concentration of 1 pM), namely KRAS (nucleotide sequence as shown in SEQ ID No.9), single-base mismatched DNA (Sm-KRAS, nucleotide sequence as shown in SEQ ID No.10), three-base mismatched DNA (Tm-KRAS, nucleotide sequence as shown in SEQ ID No.11) and non-complementary DNA (N-KRAS, nucleotide sequence as shown in SEQ ID No.12). Fig. 9 As shown, it can be observed that the efficient dynamic DNA nanosystem of Example 6 shows a strong signal response when detecting KRAS, while the signal response to Sm-KRAS, Tm-KRAS and N-KRAS is significantly reduced, which indicates that the efficient dynamic DNA nanosystem has good selectivity.

[0095] In order to study the stability of the efficient dynamic DNA nanosystem, the efficient dynamic DNA nanosystem of Example 6 was stored at 4°C. After 0, 1, 3, 5, and 7 days, the same concentration of KRAS (1 pM) was detected. Fig.10 As shown, the efficient dynamic DNA nanosystem of Example 6 still maintained 92.87% of the initial response after being stored for 7 days, showing a relatively stable electrochemical response, indicating that the efficient dynamic DNA nanosystem has acceptable stability.

[0096] Experimental Example 5

[0097] In order to study the analytical performance of the designed efficient dynamic DNA nanosystem in complex biological samples, a sample loading / recovery experiment was carried out in normal human serum using the efficient dynamic DNA nanosystem of Example 6. First, normal human serum was diluted 10 times with 10mM Tris-HCl buffer solution. Then, solutions containing 0.100, 1.000, 10.00, and 100.0fM KRAS were prepared using 10-fold diluted normal human serum, respectively, and detected by the proposed sensor. As shown in Table 1, the recovery rates were 98.95%, 99.39%, 99.56%, and 98.40%, respectively, and the RSD was less than 4.606%. The above results show that the efficient dynamic DNA nanosystem has excellent detection performance in complex biological samples and can be used as a potential tool for analyzing complex biological samples.

[0098] Table 1 The efficient dynamic DNA nanosystem of Example 6 detects KRAS in normal human serum

[0099]

[0100] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for preparing a double DNA walker, characterized in that: The following steps are involved: S1, mix the Tris-HCl buffer containing hairpin H with the Tris-HCl buffer containing tethered walking chain TW and closed chain B in a ratio of 1:1, heat and maintain, then cool to room temperature and maintain, to obtain a mixed solution for standby use; S2, the mixed solution obtained in step S1 is mixed and diluted with Tris-HCl buffer to disperse the activated MNPs, shaken overnight, and washed with Tris-HCl buffer to remove unbound DNA in the solution to obtain a double DNA walker; The nucleotide sequence of the hairpin H is: NH2-T (20) CTGGTGACGTAGCTCTTTTTCTTGCCTACGCCACCA GCTCCA; the nucleotide sequence of the tethered walking chain TW is: TGGAGCTGGTGGCGTAGGCAAGT (70) -NH2; The nucleotide sequence of the closed chain B is shown in SEQ ID No.

3.

2. The method for preparing the double DNA walker according to claim 1, characterized in that: The activation process of the activated MNPs comprises the following steps: The MNPs were diluted to 1 mg / mL with MEST buffer and washed thoroughly, and the supernatant was removed after magnetic separation. The MNPs were then dispersed with 0.1 M MES buffer containing 15-25 mg / mL NHS and 15-25 mg / mL EDC, activated by shaking at 25°C, and washed twice with MES buffer and Tris-HCl buffer respectively. The supernatant was removed after magnetic separation to obtain activated MNPs.

3. The method for preparing the double DNA walker according to claim 1, characterized in that: The concentration of hairpin H in the Tris-HCl buffer containing hairpin H in step S1 is 10-30 μM; The ratio of the concentration of the tethered walking chain TW in the Tris-HCl buffer containing the tethered walking chain TW and the closed chain B to the concentration of the hairpin H in the Tris-HCl buffer containing the hairpin H is 1:10-1:30; The concentration of the blocking chain B in the Tris-HCl buffer containing the tethered walking chain TW and the blocking chain B is 2-5 μM.

4. The method for preparing the double DNA walker according to claim 1, characterized in that: In step S1, the heating temperature is 85-95° C., the heating maintenance time is 10-30 minutes, and the cooling maintenance time is 2-12 hours.

5. The method for preparing the double DNA walker according to claim 1, characterized in that: In step S2, the shaking temperature is 25° C. and the shaking time is 12-24 h.

6. A dual DNA walker, characterized in that: The double DNA walker is prepared by the preparation method of any one of claims 1-5.

7. An efficient dynamic DNA nanosystem, characterized in that: It comprises the dual DNA walker, the sensing platform, ExoⅢ, the target and DNA-MB as described in claim 6; The nucleotide sequence of the DNA-MB is shown in SEQ ID No.4; The nucleotide sequence of the target is shown in SEQ ID No.9; The sensing platform is constructed by the following steps: TS reduced by TCEP was added dropwise to the surface of the activated gold electrode, incubated at 4°C overnight, washed, immersed in MCH, and finally a mixed solution containing 2 μM auxiliary chain A and 2 μM DNA-Fc was added dropwise to the washed electrode surface, incubated at room temperature, washed, and obtained a sensing platform; The nucleotide sequence of the auxiliary chain A is shown in SEQ ID No.5; the nucleotide sequence of the DNA-Fc is shown in SEQ ID No.6; and the nucleotide sequence of the TS is shown in SEQ ID No.

7.

8. The efficient dynamic DNA nanosystem according to claim 7, characterized in that: The concentration of TCEP is 5-15 nM, the concentration of TS is 0.5-1.5 nM, the reduction condition is room temperature in the dark, and the reduction time is 1-2 h; The concentration of the MCH solution is 1 mM, the immersion time is 0.5-1.5 h, and the incubation time at room temperature is 60-90 min.

9. Use of the dual DNA walker according to claim 6 and / or the efficient dynamic DNA nanosystem according to any one of claims 7 to 8 in the preparation of a nucleic acid detection kit.

10. Use of the efficient dynamic DNA nanosystem according to claim 9 in preparing a nucleic acid detection kit, characterized in that: The nucleic acid is a murine sarcoma viral oncogene.

Images