A method for separating and detecting thiamethoxam and acetamiprid

Abstract

The present invention discloses a method for separating and detecting thiamethoxam and acetamiprid: streptavidin magnetic beads are co-incubated with biotinylated nucleic acid aptamers to form magnetic bead-aptamer complexes, and then mixed with gold nanoparticles to form a stable sensing system; when it is mixed with a test sample containing thiamethoxam or acetamiprid, thiamethoxam or acetamiprid in the test sample binds to the nucleic acid aptamer; then a cationic polymer is added, and the gold nanoparticles show different aggregation states under the action of the cationic polymer and the aptamer, resulting in a decrease or increase in the intensity of the ultraviolet absorption peak at different wavelengths, so as to indirectly obtain the contents of thiamethoxam and acetamiprid in the test sample by ultraviolet absorption spectrometry. At the same time, the target substance bound to the aptamer can also be separated from the solution by magnetic adsorption. The present invention can realize the separation and detection of thiamethoxam and acetamiprid in liquid samples, integrating separation and detection, and the detection process is convenient.

Description

Technical Field

[0001] The present invention relates to the technical field of analytical chemistry, and further relates to biosensing technologies based on nanomaterials and nucleic acid aptamers. Specifically, the present invention relates to a method for separating and detecting thiamethoxam and acetamiprid. Background Art

[0002] Neonicotinoid insecticides are the most widely used class of insecticides in the world. Their insecticidal mechanism is to selectively act on the nicotinic acetylcholine receptor on the postsynaptic membrane of the insect nervous system, interfere with the function of acetylcholine nerve signal transmission, and cause insects to become excited, paralyzed, and die. Some studies have found that neonicotinoid insecticides can trigger "colony collapse disorder", leading to a decline in the global bee population. Epidemiological studies have also found that exposure to neonicotinoid insecticides during pregnancy is associated with adverse developments such as neonatal anencephaly and finger tremors. Acetamiprid (ACE) and thiamethoxam (TMX) are two commonly used neonicotinoid insecticides and are two types of pesticide molecules that have received much attention among neonicotinoid insecticides. Currently, the detection of these two insecticides mostly uses complex analytical instruments such as high-performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC-MS), and gas chromatography (GC). Although they have high sensitivity and specificity, they have limitations in real-time, rapid, and visual detection. Therefore, low-cost, convenient, and rapid detection methods for such molecules have always been the focus of attention of relevant field personnel.

[0003] Nucleic acid aptamers refer to single-stranded oligonucleotide fragments screened from nucleic acid molecular libraries. They are a new type of molecular recognition element that can bind to target molecules with excellent affinity and specificity. In addition, they also have some unique characteristics, including easy synthesis and modification, excellent chemical stability, wide chemical applicability, and high flexibility. Compared with traditional recognition molecules (such as antibodies), nucleic acid aptamers are ideal molecular receptors and sensing elements for constructing sensing platforms. Their emergence provides a new high-efficiency and rapid recognition research platform for the fields of chemistry, biology, and medicine. Therefore, nucleic acid aptamers have great potential in applications such as biochemical analysis, environmental monitoring, and biomedical diagnosis.

[0004] Due to their excellent optical, electrical, chemical, and biocompatible properties, gold nanoparticles have been applied in analyses such as resonance scattering spectroscopy and ultraviolet absorption spectroscopy. Many studies have been based on nucleic acid aptamer-modified gold nanoparticles to achieve highly sensitive and selective detection of biological and chemical target molecules. Gold nanoparticle solutions exhibit a wine-red color. The presence of a small amount of salt ions can induce the aggregation of gold nanoparticles, and the solution color will change from wine-red to blue-violet, manifested as a decrease or increase in the absorption peak intensity at different wavelengths in the ultraviolet spectrum. Single-stranded nucleic acid aptamers with irregular structures can be non-specifically electrostatically adsorbed onto the surface of gold nanoparticles under salt conditions, effectively preventing the aggregation of gold nanoparticles in high-salt solutions. Therefore, a biochemical sensing system can be ingeniously designed using the coexistence system of aptamers and gold nanoparticles. Summary of the Invention

[0005] The object of the present invention is to provide a method for separating and detecting thiamethoxam and acetamiprid to achieve simple, rapid separation and visual detection of thiamethoxam and acetamiprid in solution.

[0006] The present invention aims to innovatively combine the highly specific binding ability of nucleic acid aptamers, the magnetic separation ability of magnetic beads, and the salt sensitivity of gold nanoparticles, and design a sensing system with thiamethoxam- and acetamiprid-specific aptamers as recognition units and gold nanoparticles as detection units. This sensing system provides a rapid separation and detection of acetamiprid and thiamethoxam in aqueous solution, can solve some defects of existing detection technologies, and creatively introduces a separation function to achieve integration of separation and detection.

[0007] To achieve the above object, the detection method of the present invention includes the following steps:

[0008] (1) Hybridize the acetamiprid nucleic acid aptamer modified at the 5'-end or 3'-end with the unmodified thiamethoxam nucleic acid aptamer molecule to obtain a double-stranded DNA molecule;

[0009] (2) Co-incubate the magnetic beads modified with streptavidin with the double-stranded DNA molecule obtained in step (1) to obtain a magnetic bead-aptamer complex;

[0010] (3) Co-incubate the magnetic bead-aptamer complex obtained in step (2) with gold nanoparticles to obtain a magnetic bead-aptamer-gold nanoparticle composite system;

[0011] (4) Add the sample solution to be tested to the magnetic bead-aptamer-gold nanoparticle composite system obtained in step (3), mix evenly, incubate, then add the cationic polymer solution, mix evenly, and continue to incubate to obtain a mixed solution;

[0012] (5) Magnetically attract the mixed solution obtained in step (4) to obtain the supernatant, and use ultraviolet absorption spectrometry to obtain the specific concentrations of acetamiprid and thiamethoxam in the sample solution to be measured;

[0013] Among them, in step (1), the DNA sequence of the 5'-end or 3'-end biotin-modified acetamiprid nucleic acid aptamer includes a transition sequence and an acetamiprid recognition sequence; the DNA sequence of the unmodified thiamethoxam nucleic acid aptamer includes a complementary sequence and a thiamethoxam recognition sequence, and the complementary sequence is complementary to the acetamiprid recognition sequence.

[0014] Preferably, the transition sequence is a random base sequence 6-15 bp in length; the acetamiprid recognition sequence is: 5'-CTGACACCATATTATGAAGA-3';

[0015] The complementary sequence is a base sequence 10-14 bp in length complementary to the acetamiprid recognition sequence; the thiamethoxam recognition sequence is: 5'-GACGGATCCACCGACCATGCAAAGATGCACAAAAACG-3'.

[0016] Preferably, in step (1) during molecular hybridization, the molar ratio of the 5'-end or 3'-end biotin-modified acetamiprid nucleic acid aptamer to the unmodified thiamethoxam nucleic acid aptamer is 1:1; the molecular hybridization conditions are: first incubate at 95 °C for 5-10 min, and then incubate at 4 °C for 20-40 min, which can ensure sufficient hybridization of the DNA double strands.

[0017] All nucleic acid strands in step (1) are synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. and purified by HPLC method.

[0018] Preferably, in step (2), the size of the streptavidin-modified magnetic beads is 100-1000 nm, the concentration is 1-10 mg / mL; the concentration of the double-stranded DNA molecule is 2-10 μM; the incubation time is 20-60 min. The liquid for washing the magnetic bead-aptamer complex is PBST buffer, and the number of washing times is 2-4 times.

[0019] Specifically, in step (3), the size of the nanogold is 13-15 nm, the ratio of the aptamer concentration to the nanogold concentration in the magnetic bead-aptamer complex is 1:25-55, and the incubation time is 20-60 min.

[0020] Preferably, in step (4), after incubating for 5-20 min to ensure sufficient binding of the target molecule to the nucleic acid aptamer, then add the cationic polymer solution. If the time is too short, it cannot ensure sufficient binding of the target to the aptamer.

[0021] Specifically, the cationic polymer solution in step (4) is an NaCl solution, CaCl2 Solution or MgCl 2 solution, with a final concentration of 50 - 120 mM; the incubation time is 5 - 30 min.

[0022] Preferably, the wavelengths for determination by ultraviolet absorption spectrometry in step (5) are 520 nm and 650 nm.

[0023] The present invention also provides a kit for separating and detecting thiamethoxam and acetamiprid, including a magnetic bead - aptamer - gold nanoparticle composite system, a cationic polymer solution, and an ultraviolet absorption spectrometry detection system;

[0024] The preparation method of the magnetic bead - aptamer - gold nanoparticle composite system is as follows:

[0025] S1. Hybridize the acetamiprid nucleic acid aptamer modified with biotin at the 5' - end or 3' - end with the unmodified thiamethoxam nucleic acid aptamer molecule to obtain a double - stranded DNA molecule;

[0026] S2. Co - incubate the streptavidin - modified magnetic beads with the double - stranded DNA molecule obtained in step S1 to obtain a magnetic bead - aptamer complex;

[0027] S3. Co - incubate the magnetic bead - aptamer complex obtained in step S2 with gold nanoparticles to obtain a magnetic bead - aptamer - gold nanoparticle composite system;

[0028] Among them, in step S1, the DNA sequence of the acetamiprid nucleic acid aptamer modified with biotin at the 5' - end or 3' - end includes a transition sequence and an acetamiprid recognition sequence; the DNA sequence of the unmodified thiamethoxam nucleic acid aptamer includes a complementary sequence and a thiamethoxam recognition sequence, and the complementary sequence is complementary to the acetamiprid recognition sequence;

[0029] The ultraviolet absorption spectrometry detection system is used to detect the specific concentrations of acetamiprid and thiamethoxam in the sample solution to be tested.

[0030] Specifically, the transition sequence is a random base sequence 6 - 15 bp in length; the acetamiprid recognition sequence is: 5'-CTGACACCATATTATGAAGA-3';

[0031] The complementary sequence is a base sequence 10 - 14 bp in length complementary to the acetamiprid recognition sequence; the thiamethoxam recognition sequence is: 5'-GACGGATCCACCGACCATGCAAAGATGCACAAAAACG-3'.

[0032] The principle involved in the technical solution of the present invention is that the nano-gold solution presents a wine red color, and the presence of a small amount of salt ions can induce the aggregation of gold nanoparticles, and the color of the solution will change from wine red to blue purple, which is manifested in the ultraviolet spectrum as a weakening or enhancement of the absorption peak intensity at different wavelengths. The single-stranded nucleic acid aptamer with an irregular structure can be non-specifically electrostatically adsorbed to the surface of the nano-gold under salt conditions, which can effectively prevent the aggregation of nano-gold particles in high-salt solutions.

[0033] Therefore, the present invention firstly pairs the aptamers of thiamethoxam and acetamiprid with partial sequence complementarity to form a double chain, and then loads them on the surface of magnetic beads to form a magnetic bead-aptamer complex, and adds nano-gold to form a stable sensing system. In a salt solution, the single-chain structure of the aptamer on the surface of the magnetic beads is adsorbed to the surface of the nano-gold, which prevents the nano-gold from agglomerating to a certain extent; when thiamethoxam is added to the system, it combines with one of the aptamers, resulting in a reduction of the single-chain structure on the surface of the magnetic beads, and in the salt solution, the nano-gold agglomerates seriously, and the intensity of the ultraviolet absorption peak changes; when acetamiprid is added to the system, it combines with another aptamer, resulting in an increase in the free single-chain structure in the system, and the nano-gold agglomeration is more effectively prevented in the salt solution, and the intensity of the ultraviolet absorption peak changes; therefore, the contents of thiamethoxam and acetamiprid in the sample to be tested are indirectly obtained by ultraviolet absorption spectroscopy, and the target object combined with the aptamer can also be separated from the solution by magnetic attraction.

[0034] Compared with the existing detection methods, the present invention has the following beneficial technical effects:

[0035] 1) The detection method of the present invention uses aptamers corresponding to acetamiprid and thiamethoxam as the recognition element, has no interfering substances, has specific recognition, and has high detection sensitivity.

[0036] 2) The detection method of the present invention realizes a method to detect two substances (thiamethoxam and acetamiprid), which is cleverly designed and convenient and fast;

[0037] 3) The detection method of the present invention creatively introduces magnetic beads, which can separate the detection substances through magnetic attraction, integrating separation and detection, and having more functions;

[0038] 4) The detection method of the present invention uses the aggregation of gold nanoparticles as the color development principle, has good visualization effect, and can be further designed to realize on-site detection;

[0039] 5) The detection method of the present invention can also provide a design idea for a sensing system, and the detection of other substances can be achieved by changing the aptamer element. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a schematic diagram of the principle of separation and detection of thiamethoxam and acetamiprid according to the present invention.

[0041] Figure 2 This is the ultraviolet spectrum diagram for verifying the detection principle of thiamethoxam and acetamiprid in the embodiments of the present invention.

[0042] Figure 3 This is the A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 ratio change diagram under different nano-gold concentrations in the embodiments of the present invention.

[0043] Figure 4 This is the A 650 / 520 / A 0650 / 520 or A 0 650 / 520 / A 650 / 520 ratio change diagram under different aptamer concentrations in the embodiments of the present invention.

[0044] Figure 5 This is the A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 ratio change diagram under different NaCl concentrations in the embodiments of the present invention.

[0045] Figure 6 This is the A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 ratio change diagram at different incubation times after adding NaCl in the embodiments of the present invention.

[0046] Figure 7 This is the ultraviolet absorption spectrum obtained by adding different concentrations of thiamethoxam and acetamiprid in the embodiments of the present invention.

[0047] Figure 8 This is the standard curve diagram for thiamethoxam detection obtained in the embodiments of the present invention.

[0048] Figure 9 This is the standard curve diagram for acetamiprid detection obtained in the embodiments of the present invention. Detailed implementation manners

[0049] Next, the technical solutions of the present invention will be described clearly and completely in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0050] Unless otherwise specified, the drugs and reagents used in the embodiments of the present invention are from regular and easily accessible channels. Among them, all nucleic acid strands are synthesized by Shanghai Sangon Biotech Co., Ltd. and subjected to corresponding modifications. The specific sequences are as follows:

[0051] Acetamiprid aptamer strand (5'-3'): CTGACACCATATTATGAAGATTTTTTTTTTTTTTT-biotin;

[0052] Thiamethoxam aptamer strand (5'-3'): TCATAATATGGTGACGGATCCACCGACCATGCAAAGATGCACAAAAACG.

[0053] Example 1: Construction of magnetic bead-aptamer-nanogold composite system

[0054] 1) Take 50 μL of streptavidin magnetic beads with a concentration of 10 mg / mL and a size of 200 nm, magnetically attract, discard the supernatant, add 100 μL of PBST solution, mix well, magnetically attract, discard the supernatant, repeat three times, discard the supernatant, and reserve the magnetic beads;

[0055] 2) Take 5 μL of 100 μM acetamiprid aptamer strand and 5 μL of 100 μM thiamethoxam aptamer strand, add them to 90 μL of PBS solution, mix evenly, incubate at 95 °C for 5 min, incubate at 4 °C for 20 min, add them to the streptavidin magnetic beads prepared in step 1), incubate with shaking at room temperature for 30 min, magnetically attract, discard the supernatant, add 100 μL of PBST solution, mix well, magnetically attract, discard the supernatant, repeat three times, discard the supernatant, and obtain the magnetic bead-aptamer complex for standby;

[0056] 3) Add 700 μL of nanogold solution (8 nM) to the magnetic bead-aptamer complex prepared in step 2), mix evenly, and incubate at room temperature for 30 min to obtain a stable magnetic bead-aptamer-nanogold composite system.

[0057] Example 2: Construction of magnetic bead-aptamer-nanogold composite system

[0058] 1) Take 50 μL of streptavidin magnetic beads with a concentration of 10 mg / mL and a size of 100 nm, magnetically attract, discard the supernatant, add 100 μL of PBST solution, mix well, magnetically attract, discard the supernatant, repeat three times, discard the supernatant, and reserve the magnetic beads;

[0059] 2) Take 2.5 μL of 100 μM acetamiprid aptamer strand and 2.5 μL of 100 μM thiamethoxam aptamer strand, add them to 95 μL of PBS solution, mix well, incubate at 95 °C for 5 min, incubate at 4 °C for 20 min, add them to the streptavidin magnetic beads prepared in step 1), incubate with shaking at room temperature for 30 min, magnetically separate, discard the supernatant, add 100 μL of PBST solution, mix well, magnetically separate, discard the supernatant, repeat three times, discard the supernatant, and obtain the magnetic bead-aptamer complex for standby;

[0060] 3) Take 560 μL of nano-gold solution (8 nM) and add it to the magnetic bead-aptamer complex prepared in step 2), mix well, incubate at room temperature for 30 min to obtain a stable magnetic bead-aptamer-nano-gold composite system.

[0061] Example 3: Construction of magnetic bead-aptamer-nano-gold composite system

[0062] 1) Take 50 μL of streptavidin magnetic beads with a concentration of 1 mg / mL and a size of 1000 nm, magnetically separate, discard the supernatant, add 100 μL of PBST solution, mix well, magnetically separate, discard the supernatant, repeat three times, discard the supernatant, and the magnetic beads are for standby;

[0063] 2) Take 1 μL of 100 μM acetamiprid aptamer strand and 1 μL of 100 μM thiamethoxam aptamer strand, add them to 98 μL of PBS solution, mix well, incubate at 95 °C for 5 min, incubate at 4 °C for 20 min, add them to the streptavidin magnetic beads prepared in step 1), incubate with shaking at room temperature for 30 min, magnetically separate, discard the supernatant, add 100 μL of PBST solution, mix well, magnetically separate, discard the supernatant, repeat three times, discard the supernatant, and obtain the magnetic bead-aptamer complex for standby;

[0064] 3) Take 500 μL of nano-gold solution (8 nM) and add it to the magnetic bead-aptamer complex prepared in step 2), mix well, incubate at room temperature for 30 min to obtain a stable magnetic bead-aptamer-nano-gold composite system.

[0065] Example 4: Verification of detection principle

[0066] Take 150 μL of the magnetic bead-aptamer-nano-gold composite system prepared in Example 1, divide it equally into three centrifuge tubes, 50 μL in each tube; add 10 μL of ultrapure water, 10 μL of thiamethoxam solution, and 10 μL of acetamiprid solution to the three tubes respectively, mix well, after incubating for 20 min, add 10 μL of 630 mM NaCl solution to each tube, continue to incubate for 10 min, then add 130 μL of ultrapure water to each tube, mix well, magnetically separate, and measure the ultraviolet spectrum of the supernatant.

[0067] From Figure 2It can be seen that under the same conditions, when thiamethoxam is added to the system, A 650 / A 520 increases, indicating that when thiamethoxam is added to the system, it binds to an aptamer, resulting in the inability of the system to maintain the stability of gold nanoparticles in a high-salt solution, and the aggregation of gold nanoparticles; under the same conditions, when acetamiprid is added to the system, A 650 / A 520 decreases, indicating that when acetamiprid is added to the system, it binds to another aptamer, resulting in an increase in the number of free single-stranded structures in the system, which more effectively prevents the aggregation of gold nanoparticle clusters in a salt solution.

[0068] Example 5: Optimization of the gold nanoparticle concentration in the detection conditions

[0069] Take the magnetic bead-aptamer complex prepared in step 2) of Example 1 and divide it equally into 18 centrifuge tubes, which are divided into three groups: the no-target group, the thiamethoxam group, and the acetamiprid group, with six tubes in each group. Add 50 μL of gold nanoparticle solutions with different concentrations to the centrifuge tubes in each group. Add 10 μL of ultrapure water to the no-target group, 10 μL of thiamethoxam solution to the thiamethoxam group, and 10 μL of acetamiprid solution to the acetamiprid group. Mix well. After incubating for 20 min, add 10 μL of 630 mM NaCl solution to each tube. After continuing to incubate for 10 min, add 130 μL of ultrapure water to each tube, mix well, perform magnetic separation, and measure the ultraviolet spectrum of the supernatant.

[0070] Design the gold nanoparticle concentration in the detection system (0.5, 1.0, 1.5, 2.0, 2.5, 3.0 nM). Use A and A 0 to represent the presence and absence of the target (thiamethoxam or acetamiprid) in the detection system, and record A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 ratio changes. The larger the A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 , the more obvious the experimental phenomenon, that is, the optimal detection conditions.

[0071] As Figure 3 shown, as the gold nanoparticle concentration in the detection system increases, A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 both increase first and then decrease. Too high or too low gold nanoparticle concentration will lead to unclear detection results, and the optimal gold nanoparticle concentration is 2.0 nM.

[0072] Example 6: Optimization of the aptamer concentration in the detection conditions

[0073] After the magnetic beads are connected to the aptamer, the concentration of the aptamer before and after incubation with the magnetic beads is detected by ultraviolet light, and the loading amount of the aptamer on the magnetic beads can be determined, that is, the content of the aptamer in the magnetic bead-aptamer complex prepared in step 2) of Example 1. According to the aptamer loading amount, different amounts of the magnetic bead-aptamer complex are distributed into 18 centrifuge tubes, which are divided into three groups: the no-target group, the thiamethoxam group, and the acetamiprid group. Each group has six tubes. 50 μL of 8 nM nanogold solution is added to each centrifuge tube in each group. 10 μL of ultrapure water is added to the no-target group, 10 μL of thiamethoxam solution is added to the thiamethoxam group, and 10 μL of acetamiprid solution is added to the acetamiprid group. After mixing evenly and incubating for 20 min, 10 μL of 630 mM NaCl solution is added to each tube. After continuing to incubate for 10 min, 130 μL of ultrapure water is added to each tube. After mixing evenly, magnetic absorption is performed, and the ultraviolet spectrum of the supernatant is measured.

[0074] Design the aptamer concentrations (30, 40, 50, 60, 70, 80 nM) in the detection system, and use A and A 0 to represent the presence and absence of the target (thiamethoxam or acetamiprid) in the detection system, respectively. Record A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 ratio changes at different aptamer concentrations. The larger the A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 , the more obvious the experimental phenomenon, that is, the optimal detection conditions.

[0075] As Figure 4 shown, as the aptamer concentration in the detection system increases, A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 both increase first and then decrease. Too high or too low aptamer concentration will lead to unclear detection results. The optimal aptamer concentration is 60 nM.

[0076] Example 7: Optimization of NaCl concentration in the detection conditions

[0077] Prepare 900 μL of the magnetic bead-aptamer-nanogold composite system according to the steps of Example 1, and evenly distribute it into 18 centrifuge tubes, which are divided into three groups: the no-target group, the thiamethoxam group, and the acetamiprid group. 10 μL of ultrapure water is added to the no-target group respectively, 10 μL of thiamethoxam solution is added to the thiamethoxam group respectively, and 10 μL of acetamiprid solution is added to the acetamiprid group respectively. After mixing evenly and incubating for 20 min, 10 μL of NaCl solution with different concentrations is added to each tube. After continuing to incubate for 10 min, 130 μL of ultrapure water is added to each tube. After mixing evenly, magnetic absorption is performed, and the ultraviolet spectrum of the supernatant is measured.

[0078] Design the NaCl concentration in the system after adding NaCl (60, 70, 80, 90, 100, 110 mM), and use A and A 0 to represent the presence and absence of the target substance (thiamethoxam or acetamiprid) in the detection system respectively, and record A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 ratio changes respectively under different NaCl concentrations. The larger the A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 , the more obvious the experimental phenomenon, that is, the optimal detection conditions.

[0079] As Figure 5 shown, as the NaCl concentration in the system increases, A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 both show a trend of first increasing and then decreasing. Too high or too low NaCl concentration will lead to unclear detection results. The optimal NaCl concentration is 90 mM.

[0080] Example 8: Optimization of the incubation time after adding NaCl solution in the detection conditions

[0081] Prepare 900 μL of the magnetic bead - aptamer - gold nanoparticle composite system according to the steps of Example 1, and divide it equally into 18 centrifuge tubes, which are divided into three groups: the group without target substance, the thiamethoxam group, and the acetamiprid group. The group without target substance is added with 10 μL of ultrapure water respectively, the thiamethoxam group is added with 10 μL of thiamethoxam solution respectively, and the acetamiprid group is added with 10 μL of acetamiprid solution respectively. After mixing evenly and incubating for 20 min, 10 μL of 630 mM NaCl solution is added to each tube. After continuing to incubate for different times, 130 μL of ultrapure water is added to each tube, mixed evenly, magnetically adsorbed, and the supernatant is measured for ultraviolet spectrum.

[0082] Design the incubation time after adding NaCl solution (5, 10, 15, 20, 25, 30 min), and use A and A 0 to represent the presence and absence of the target substance (thiamethoxam or acetamiprid) in the detection system respectively, and record A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 ratio changes respectively at different incubation times after adding NaCl solution. The larger the A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 , the more obvious the experimental phenomenon, that is, the optimal detection conditions.

[0083] AsFigure 6 As shown, as the incubation time lengthens after adding the NaCl solution, A 650 / 520 / A 0 650 / 520 or A 0 650 / 520 / A 650 / 520 generally shows a trend of first increasing and then decreasing. An overly long or short incubation time after adding the NaCl solution will lead to unclear detection results, and the optimal time is 15 min.

[0084] Example 9: Establishment of a standard curve

[0085] According to the optimized detection conditions in Examples 5 - 8, thiamethoxam solutions with different concentrations (0, 20, 40, 60, 80, 100, 120, 140, 200 nM) and acetamiprid solutions with different concentrations (0, 100, 200, 400, 600, 800, 1000, 1200, 2000 nM) were respectively prepared and detected using the magnetic bead - aptamer - gold nanoparticle composite system. The ultraviolet absorption spectra at each concentration were recorded using an ultraviolet spectrophotometer.

[0086] As Figure 7 , 8 , shown in 9, it can be obtained that within a certain concentration range, as the concentration of thiamethoxam or acetamiprid increases, A 650 / A 520 increases or decreases; for the detection of thiamethoxam, within the range of 20 - 140 nM, the linear regression equation is: y = 0.00229x + 0.28624, R 2 = 0.998; for the detection of acetamiprid, within the range of 200 - 1200 nM, the linear regression equation is: y = 0.31533 - 0.000128x, R 2 = 0.998.

Claims

1. A method for separating and detecting thiamethoxam and acetamiprid, characterized in that, it comprises the following steps: (1) Hybridize the acetamiprid nucleic acid aptamer modified with biotin at the 5'-end or 3'-end with the unmodified thiamethoxam nucleic acid aptamer molecule to obtain a double-stranded DNA molecule; (2) Co-incubate the streptavidin-modified magnetic beads with the double-stranded DNA molecule obtained in step (1) to obtain a magnetic bead-aptamer complex; (3) Co-incubate the magnetic bead-aptamer complex obtained in step (2) with gold nanoparticles to obtain a magnetic bead-aptamer-gold nanoparticle composite system; (4) Add the test sample solution to the magnetic bead-aptamer-gold nanoparticle composite system obtained in step (3), mix evenly, incubate, then add the cationic polymer solution, mix evenly, and continue incubating to obtain a mixed solution; (5) Magnetically separate the mixed solution obtained in step (4) to obtain the supernatant, and use ultraviolet absorption spectroscopy to obtain the specific concentrations of acetamiprid and thiamethoxam in the test sample solution; wherein, in step (1), the DNA sequence of the acetamiprid nucleic acid aptamer modified with biotin at the 5'-end or 3'-end includes a transition sequence and an acetamiprid recognition sequence; the DNA sequence of the unmodified thiamethoxam nucleic acid aptamer includes a complementary sequence and a thiamethoxam recognition sequence, and the complementary sequence is complementary to the acetamiprid recognition sequence; the transition sequence is a random base sequence 6-15 bp in length; the acetamiprid recognition sequence is: 5'-CTGACACCATATTATGAAGA-3'; the complementary sequence is a base sequence 10-14 bp in length complementary to the acetamiprid recognition sequence; the thiamethoxam recognition sequence is: 5'- GACGGATCCACCGACCATGCAAAGATGCACAAAAACG-3'.

2. The method for separating and detecting thiamethoxam and acetamiprid according to claim 1, characterized in that, in step (1) during molecular hybridization, the molar ratio of the acetamiprid nucleic acid aptamer modified with biotin at the 5'-end or 3'-end to the unmodified thiamethoxam nucleic acid aptamer molecule is 1:1; the molecular hybridization conditions are: first incubate at 95°C for 5-10 min, and then incubate at 4°C for 20-40 min.

3. The method for separating and detecting thiamethoxam and acetamiprid according to claim 1, characterized in that, in step (2), the size of the streptavidin-modified magnetic beads is 100-1000 nm, and the concentration is 1-10 mg / mL; the concentration of the double-stranded DNA molecule is 2-10 μM; the incubation time is 20-60 min.

4. The method for separating and detecting thiamethoxam and acetamiprid according to claim 1, characterized in that, in step (3), the size of the gold nanoparticles is 13-15 nm, and the ratio of the aptamer concentration to the gold nanoparticle concentration in the magnetic bead-aptamer complex is 1:25-55, and the incubation time is 20-60 min.

5. The method for separating and detecting thiamethoxam and acetamiprid according to claim 1, characterized in that, in step (4), add the cationic polymer solution after incubating for 5-20 min.

6. The method for separating and detecting thiamethoxam and acetamiprid according to claim 1, characterized in that, The cationic polymer solution described in step (4) is an NaCl solution, a CaCl 2 solution or an MgCl 2 solution, with a final concentration of 50 to 120 mM; the incubation time is 5 to 30 min.

7. The method for separating and detecting thiamethoxam and acetamiprid according to claim 1, characterized in that, in step (5), the determination wavelengths in the ultraviolet absorption spectrometry are 520 nm and 650 nm.

8. A kit for separating and detecting thiamethoxam and acetamiprid, characterized in that, it includes a magnetic bead-aptamer-nanogold composite system, a cationic polymer solution, and an ultraviolet absorption spectrometry detection system; the preparation method of the magnetic bead-aptamer-nanogold composite system is: S1. Hybridize the acetamiprid nucleic acid aptamer modified with biotin at the 5'-end or 3'-end with the unmodified thiamethoxam nucleic acid aptamer molecule to obtain a double-stranded DNA molecule; S2. Co-incubate the streptavidin-modified magnetic beads with the double-stranded DNA molecule obtained in step S1 to obtain a magnetic bead-aptamer complex; S3. Co-incubate the magnetic bead-aptamer complex obtained in step S2 with nanogold to obtain a magnetic bead-aptamer-nanogold composite system; wherein, in step S1, the DNA sequence of the acetamiprid nucleic acid aptamer modified with biotin at the 5'-end or 3'-end includes a transition sequence and an acetamiprid recognition sequence; the DNA sequence of the unmodified thiamethoxam nucleic acid aptamer includes a complementary sequence and a thiamethoxam recognition sequence, and the complementary sequence is complementary to the acetamiprid recognition sequence; the ultraviolet absorption spectrometry detection system is used to detect the specific concentrations of acetamiprid and thiamethoxam in the sample solution to be measured; the transition sequence is a random base sequence 6-15 bp in length; the acetamiprid recognition sequence is: 5'-CTGACACCATATTATGAAGA-3'; the complementary sequence is a base sequence 10-14 bp in length complementary to the acetamiprid recognition sequence; the thiamethoxam recognition sequence is: 5'- GACGGATCCACCGACCATGCAAAGATGCACAAAAACG-3'.

Images