Salt-tolerant yeast and application thereof

The salt-tolerant yeast Candida prachuapensis LH-Y.0003, obtained through isolation and domestication, solved the problem of insufficient yeast application in high-salt wastewater treatment, and enhanced the pollutant degradation capacity of the biochemical system in a high-salt environment, thereby improving the system's salt tolerance and degradation efficiency.

CN116064256BActive Publication Date: 2025-12-09BLUESTAR LEHIGH ENG INST CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202211660360.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-23
Publication Date
2025-12-09
Estimated Expiration
2042-12-23

AI Technical Summary

Technical Problem

In the existing technology, the application of salt-tolerant yeast in the treatment of high-salt wastewater is limited, especially when the salinity exceeds 5%. There are almost no cases of using it to bio-enhance the biochemical system of high-salt wastewater, and the existing yeast has insufficient degradation ability in high-salt environments.

Method used

A salt-tolerant yeast, Candida prachuapensis LH-Y.0003, is provided. It is obtained by isolating and domesticating high-salt epichlorohydrin production wastewater. It can grow in a salt concentration range of 0-20% and is prepared into yeast extract powder for use in high-salt wastewater treatment, thereby enhancing the salt tolerance and degradation capacity of the biochemical system.

Benefits of technology

It significantly improves the biochemical system's ability to degrade pollutants in high-salt environments, enhances the system's salt tolerance and resistance to salt shock, and is suitable for treating high-salt wastewater with a salinity of 1-25%, thus enhancing the degradation effect on toxic pollutants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004013566180000061
    Figure BDA0004013566180000061
  • Figure BDA0004013566180000081
    Figure BDA0004013566180000081
  • Figure BDA0004013566180000091
    Figure BDA0004013566180000091
Patent Text Reader

Abstract

The application discloses a salt-tolerant yeast and application thereof. Candida prachuapensis ) LH-Y.0003, which is preserved in the China General Microbiological Culture Collection Center, has a preservation number of CGMCC NO.19111 and a preservation date of December 9, 2019, and is located at No.3, Xili Beichen, Chaoyang District, Beijing. The salt-tolerant yeast can be applied to preparation of a salt-tolerant microbial agent and salt-tolerant yeast powder, and is used for intensified biological treatment of high-salinity wastewater with a salinity of 1-25%, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to a salt-tolerant yeast and application thereof. BACKGROUND

[0002] High-salinity wastewater generally refers to wastewater with a total salt content of at least 1%. Salt water generated in the manufacturing process of chemical industry, coking, petrochemical industry, new energy industry, etc. sometimes has a salt content as high as 15-25%. For example, the CaCl2 content of propylene oxide production wastewater is as high as 3-5%; the salt content of coking wastewater RO concentrated salt water is 1%-3%; the salt content of lithium battery disassembly production wastewater is 3%-15%; and the Na2SO4 content of sebacic acid production wastewater is 8%-12%. It is of great application value to treat high-salinity wastewater by using a microbial method, but there are few cases of stable operation of engineering.

[0003] High-salinity environment has an inhibitory effect on the metabolism of ordinary microorganisms, and even causes the death of microorganisms. The addition of salt-tolerant or halophilic microorganisms to a biochemical system can strengthen its salt tolerance and degradation capacity. Salt-tolerant or halophilic microorganisms can secrete and release compensatory solutes such as tetrahydropyrimidine, betaine, glycerol and trehalose under high-salinity environmental stress, thereby improving their salt tolerance and pollutant degradation capacity under high-salinity conditions. When salt-tolerant microorganisms are used to treat high-salinity wastewater, the salt tolerance of the biochemical system needs to be maintained. Studies have shown that salt-tolerant yeast has good salt tolerance and can be used for the intensified treatment of a biochemical system.

[0004] Liao Yan (Liao Yan. Screening of Dominant Functional Bacteria in High-salinity Pharmaceutical and Chemical Wastewater and Study on Salt Tolerance Mechanism. Jiangxi Normal University, Master's Thesis, 2019) obtained a strain of Meyerozyma guilliermondii W2 with a salt tolerance of not less than 18%. When it is used for the treatment of wastewater by aerobic denitrification, the aerobic denitrification rate can be significantly improved.

[0005] Song Li (Song Li. Biological Intensification of MBR for Treatment of High-salinity Azo Dye Wastewater by Using Efficient Salt-tolerant Fungi. Liaoning Normal University, Master's Thesis, 2018) screened a Pichia occidentalis G1, and the optimal growth and decolorization salinity was 3%. The decolorization rate and COD removal rate of the MBR biologically intensified by the yeast were 94% and 88%, respectively. Meanwhile, the intensified system showed better stability, impact load resistance and ability to remove wastewater toxicity.

[0006] The salt-tolerant yeasts in the prior art are mostly used for soy sauce brewing, such as Chinese patent application 202110593290.5, 202210108961.9 and 202110542623.1, and there are few reports on their application in the degradation of COD and ammonia nitrogen in high-salinity wastewater. There are almost no cases of using salt-tolerant yeast to biologically intensify the biochemical system of high-salinity wastewater when the salinity is higher than 5%.

[0007] The application of Candida prachuapensis salt-tolerant yeast in the field of environmental protection has not been reported so far. SUMMARY

[0008] In view of the deficiencies of the prior art, the purpose of the present application is to provide a salt-tolerant yeast and its application; the salt-tolerant yeast provided by the present application has a salt tolerance of more than 5%.

[0009] The technical solution adopted by the present application to solve its technical problems is:

[0010] In a first aspect, the present application claims a salt-tolerant yeast (Candida prachuapensis) LH-Y.0003, which is preserved in the China General Microbiological Culture Collection Center, with a preservation number of CGMCC NO.19111 and a preservation date of December 09, 2019, and a preservation address of No.3, Beichen West Road, Chaoyang District, Beijing.

[0011] The salt-tolerant yeast of the present application is isolated from a domestication system of 5-20% high-salt epichlorohydrin production wastewater, and is identified as Candida prachuapensis through 26S rDNA D1 / D2 region sequence alignment; the salt-tolerant yeast of the present application can grow and metabolize with epichlorohydrin, amines, phenols, glycerol, etc. as carbon sources, and with ammonia nitrogen and organic nitrogen as nitrogen sources.

[0012] The salt-tolerant yeast LH-Y.0003 of the present application can grow in a salt concentration of 0%-20%, a pH of 4.0-9.0, and a temperature of 15-45℃; the optimal salt concentration for growth is 0%-15%, which belongs to the category of salt-tolerant bacteria; the optimal pH for growth is 5-8.0, and the optimal temperature for growth is 20-35℃.

[0013] In a second aspect, the present application claims a microbial agent containing the salt-tolerant yeast described above or a culture containing the aforementioned salt-tolerant yeast.

[0014] The term "culture" refers to a general term for liquid or solid products that have grown microbial populations after artificial inoculation and cultivation. That is, the product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites or other components produced during the cultivation process.

[0015] In specific embodiments, the microbial agent can be a single salt-tolerant yeast agent, or a complex yeast agent containing multiple salt-tolerant yeasts, or a complex salt-tolerant microbial agent containing salt-tolerant bacteria, halophilic bacteria, salt-tolerant archaea, halophilic archaea and other salt-tolerant microorganisms together.

[0016] In a specific embodiment, the present application claims a yeast extract powder containing the salt-tolerant yeast Candida prachuapensis LH-Y.0003 described above.

[0017] The salt-tolerant yeast extract powder is processed by fermentation culture, autolysis, enzyme hydrolysis, inactivation, solid-liquid separation, vacuum concentration, spray drying, and other processes of the salt-tolerant yeast Candida prachuapensis LH-Y.0003.

[0018] In a third aspect, the present application also protects the use of the salt-tolerant yeast Candida prachuapensis LH-Y.0003 described above, the microbial agent described above, or the yeast extract powder described above in the treatment of high-salt wastewater.

[0019] The salt concentration of the high-salt wastewater is 1% to 25%. The high-salt wastewater can be propylene oxide wastewater, epichlorohydrin chloropropane wastewater, coking wastewater RO concentrated brine, sebacic acid wastewater, monosodium glutamate wastewater, lithium battery disassembly and recycling wastewater, or other high-salt industrial wastewater.

[0020] In a fourth aspect, the present application also protects the use of the salt-tolerant yeast Candida prachuapensis LH-Y.0003 described above, the microbial agent described above, or the yeast extract powder described above in the preparation of a product for treating high-salt wastewater.

[0021] In a fifth aspect, the present application also protects a method for treating high-salt wastewater, which specifically involves adding the salt-tolerant yeast Candida prachuapensis LH-Y.0003 described above, the microbial agent described above, or the yeast extract powder described above to the high-salt wastewater.

[0022] Compared with the prior art, the present application has the following beneficial technical effects:

[0023] (1) The yeast Candida prachuapensis LH-Y.0003 disclosed in the present application has a salt tolerance range of 0 to 20% and an optimal salt growth range of 1% to 15%, and can degrade toxic pollutants under a high-salt concentration of 5% to 15%. When it is added to a biochemical system of high-salt wastewater with a salt concentration of 1% to 15%, it can enhance the salt tolerance and salt shock resistance of the biochemical system.

[0024] (2) The salt-tolerant yeast Candida prachuapensis LH-Y.0003 disclosed in the application can be used for the intensified biological treatment of 1-25% high-salinity wastewater, and can improve the salt tolerance, salt shock resistance and pollutant degradation activity of the salt-tolerance domesticated biochemical system and the halophilic biochemical system, and can be widely applied to the biochemical treatment of various wastewaters.

[0025] DEPOSIT DESCRIPTION

[0026] Strain name: salt-tolerant yeast;

[0027] Latin name: Candida prachuapensis;

[0028] Strain number: LH-Y.0003;

[0029] Preservation agency: China General Microbiological Culture Collection Center;

[0030] Abbreviation of the preservation agency: CGMCC;

[0031] Preservation address: No. 3, Beichen West Road, Chaoyang District, Beijing;

[0032] Preservation date: December 9, 2019;

[0033] Preservation center registration number: CGMCC NO. 19111. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 Figure 1 is a colony diagram of the salt-tolerant yeast Candida prachuapensis LH-Y.0003 cultured at 25℃ for 7 days on CMA medium.

[0035] Figure 2 Figure 2 is a microscopic morphology diagram of the salt-tolerant yeast Candida prachuapensis LH-Y.0003 cultured at 25℃ for 3 days on YMA medium.

[0036] Figure 3 Figure 3 is a phylogenetic tree of the 26S rDNA D1 / D2 region sequence of the salt-tolerant yeast Candida prachuapensis LH-Y.0003 and the sequences of the published model strains of similar species of the Candida genus. DETAILED DESCRIPTION

[0037] The application will be further described below in combination with specific embodiments, but the application is not limited to the following embodiments.

[0038] Example 1: Isolation and preservation of salt-tolerant yeast

[0039] The salt-tolerant yeast LH-Y.0003 is isolated from a domestication system of sediment from the Yellow Sea Lianyungang coast, which is domesticated by 20% high-salt wastewater containing high concentration of epichlorohydrin.

[0040] The domestication culture solution with NaCl concentration of 5%, 10% and 20% respectively is prepared, containing 500 ml of epichlorohydrin wastewater (COD 5000 mg / L) per liter, and adding glycerol 250 mg, grape 250 mg, methanol 50 mg, aniline 50 mg, and phenol 100 mg. The sediment sample is enriched and cultured at 30°C for one week, and the suspension is further subcultured for one week. The continuous domestication culture is carried out for one month, and the bacterial sludge is obtained by full sedimentation or centrifugation. The enriched bacterial sludge is separated by using solid culture medium. 1L of culture medium contains the following components: epichlorohydrin wastewater (COD 5000 mg / L) 200 ml, glucose 0.5 g, glycerol 2 mL, phenol 0.2 g, aniline 0.1 g, peptone 1 g, dipotassium hydrogen phosphate 0.35 g, potassium dihydrogen phosphate 0.1 g, ammonium sulfate 0.25 g, ammonium chloride 0.25 g, MgSO4 0.5 g, NaCl 100 g; trace element solution 10 mL, pH 6-7; agar 2%.

[0041] Trace element solution (1000 mL): MnCl2·7H2O 0.03 g, H3BO3 0.03 g, CoCl2·6H2O 0.20 g, CuCl2·6H2O, NiCl2·6H2O 0.02 g, Na2Mo4·2H2O 0.03 g

[0042] The single colonies are obtained by repeated separation and purification under the conditions of 5%, 10%, and 20% salt concentration. The strains that can normally metabolize under the conditions of three salt concentrations are morphologically characterized and identified. The LH-Y.003 is cultured on corn meal agar CMA medium at 25°C for 7 days, and the colony is creamy, white and transparent, with raised colony and mycelial edge. Pseudomycelium is produced. The colony characteristics are shown in Figure 1 ; the cells are observed under microscope on yeast mannitol agar YMA medium at 25°C for 3 days, which are spheroidal to oval, with size of (3-6) μm x (3-12) μm, single or in chains. The microscopic characteristics are shown in Figure 2 . The 26S rDNA D1 / D2 region sequence analysis identifies it as Candida prachuapensis (as follows).

[0043] GCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCAGGTCTATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGTTCCCTCGGGGGCGGCCTCTGCGTTTTACCGGGCCAGCATCAGTTTGGGCGGTAGGACAATCGCGCGGGAACGTGGCACGGCCTCGGCTGTGTGTTATAGCCCGTGTGGATACTGCCAGCCTAGACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCT; as shown in SEQ ID No: 1.

[0044] Candida prachuapensis LH-Y.0003, deposited in China General Microbiological Culture Collection Center on December 09, 2019, with the accession number of CGMCC NO.19111.

[0045] Example 2: Fermentation culture test of Candida prachuapensis LH-Y.0003

[0046] (1) Seed activation culture solution: peptone 0.35%, yeast extract 0.3%, KH2PO4 0.2%, MgSO4 0.1%, (NH4)2SO4 0.1%, malt extract (12-14 0 Bx) 4.0%, molasses (75-80 0Bx) 1%, glycerol 1%, glucose 1%, trace elements 10 ml / L, pH 4.8-5.2, sterilized at 115°C for 20 min and ready for use. Fermentation medium: molasses (about 80 0 Bx) 5%, glycerol 1%, peptone 0.1%, MgSO4 0.2%, urea 0.25%; KH2PO4 0.2%, NaCl 0%, 1%, 5%, 8%, 10%, 12%, 15%, trace elements 10 ml / L, pH 4.8-6 adjusted with 10% H2SO4, sterilized at 121°C for 20 min and ready for use. The slant seed is first activated in the seed activation medium for 24 h, and then observed under a microscope and counted with a hemocytometer to determine the number of yeast and the budding rate. The number of yeast in the culture medium should be more than 5 billion / ml and the budding rate should be more than 20% for the seed activation culture to be completed.

[0047] (2) The fermentation culture is carried out in a 20 L fermentation tank. The fermentation medium is used, and 500 ml of the seed culture is transferred to the fermentation medium. The stirring speed is 100 r / min, the aeration is controlled to maintain the dissolved oxygen at 2-4 mg / L, and the culture is carried out for 24-35 h. After 24 h, samples are taken every two hours for observation of cell morphology, contamination, cell number, budding rate and mortality under a microscope, and determination of yeast wet weight. The cell number is more than 30 billion, 30 billion, 28 billion, 28 billion, 25 billion, 22 billion and 20 billion under 0%, 1%, 5%, 8%, 10%, 12% and 15% salinity, respectively, the budding rate is less than 10%, the mortality is less than 5%, and the yeast wet weight is 160 g / L, 160 g / L, 150 g / L, 150 g / L, 140 g / L, 120 g / L and 100 g / L, respectively. (The salt content needs to be removed by three times of washing and centrifugation to remove the supernatant for determination.) The fermentation culture reaches the mature tank discharge condition. The set different salinity conditions within 35 h can all reach the above-mentioned fermentation culture mature tank discharge condition. The obtained culture medium is centrifuged to obtain a 5-fold concentrated yeast milk for functional test.

[0048] (3) The test results show that Candida prachuapensis LH-Y.0003 can quickly carry out fermentation culture and scale-up, which indicates that LH-Y.0003 has the potential for large-scale engineering application.

[0049] Example 3: Salt tolerance test of Candida prachuapensis LH-Y.0003

[0050] (1) The medium composition is peptone 0.35%, yeast extract 0.3%, KH2PO4 0.2%, MgSO4 0.1%, (NH4)2SO4 0.1%, malt extract (12-14 0 Bx) 4.0%, molasses (75-80 0Bx) 1%, glycerol 2%, glucose 2%, trace elements 10 ml / L, pH 4.8-5.2, agar 2%.

[0051] (2) The strain is activated using fresh culture medium described above, and cultured for 48 h until the mycelium is richly grown and ready for use.

[0052] (3) Salinity gradient setting: According to the culture conditions of Candida prachuapensis LH-Y.0003 strain, the salinity gradient of the culture medium is set to 0%, 0.5%, 1%, 2%, 3%, 5%, 8%, 10%, 12%, 15%, 18%, 20%, 21%, 22%, and 25%, respectively.

[0053] (4) Preparation of solid culture medium: The culture medium is prepared according to the set formula. The culture medium with high salinity is melted in hot water and sterilized. Add 5 ml of evaporated water to each bottle. Add the volatile medium components after sterilization and shake well. Cool to about 60°C, and pour into a flat dish.

[0054] (5) Inoculation and culture: Under sterile conditions, pick a ring of fresh mycelium and inoculate each salinity medium. Transfer from low salinity to high salinity gradient. Culture at 30-32°C for 3-7 days, and observe the growth of the strain.

[0055] (6) Test results: Candida prachuapensis LH-Y.0003 strain has a salt tolerance range of 0-20%. Candida prachuapensis LH-Y.0003 strain can grow new mycelium within three days in 0-15% salinity medium. The lower the salinity, the faster the growth. In 15-20% salinity medium, mycelium can grow within 7 days, but in 21% salinity medium, no obvious mycelium growth is observed after 7 days. This indicates that Candida prachuapensis LH-Y.0003 strain can rapidly multiply and achieve mass production in a salinity range of 0-15%.

[0056] Table 1 Candida prachuapensis LH-Y.0003 salt-tolerant growth

[0057]

[0058] Example 4: Strengthening the salt tolerance of Candida prachuapensis LH-Y.0003

[0059] (1) 200 ml of sludge from the aerobic tank operation system of a low-salinity urban sewage treatment plant was divided into 500 ml Erlenmeyer flasks and 200 ml of culture medium was added. The culture medium was the water from the equalization tank of the sewage treatment plant, with COD of 4000 mg / L, TN of 80 mg / L, TP of 25 mg / L, TDS of 1000 mg / L, and COD biochemical removal rate of over 95%. The experiment set up control groups with different salinities of 0%, 1%, 5%, 8%, 10%, and 15%, and experimental groups with Candida prachuapensis LH-Y.0003 added at each salinity. The addition amount was 1 ml of the concentrated 5-fold yeast milk obtained in Example 2. 1 ml was added each time the water was changed. The mixture was cultured in a shaker at 30℃ and 160 r / min for 48 h. The culture was repeated 3 times with water changes in the same manner.

[0060] (2) Microbial salt tolerance: The number of surviving microorganisms at various salinities was obtained by colony counting to evaluate changes in the salt tolerance of the microbial community. Candida prachuapensis LH-Y.0003 was added, and the added yeast was removed during counting based on the colony characteristics or microscopic features of Candida prachuapensis LH-Y.0003. Nutrient agar medium was used for counting, with additional sodium chloride added to each of the salinity gradients. The plates were then sterilized and poured for later use.

[0061] (3) Viable cell count determination: After homogenizing the systems cultured at each salinity, samples were taken and serially diluted 10 μL with sterile physiological saline. 8 ~10 12 Take 1 mL of the diluted sample and inject it into the counting plate. Immediately shake the plate to mix the bacterial solution with the culture medium thoroughly. Incubate at 35-37℃ for 24 hours and then count.

[0062] (4) Experimental Results: The total colony count data are shown in Table 2. In the control group where salinity was increased, the total colony count decreased significantly, decreasing by 99.8% when the salinity was increased to 15%. However, in the experimental group, the addition of Candida prachuapensis LH-Y.0003 resulted in a relatively stable total colony count, which did not decrease significantly with increasing salinity. This indicates that Candida prachuapensis LH-Y.0003 improved the salt tolerance of the microorganisms in this common biochemical system. This invented strain can be applied to salinity shock or salinity acclimatization and enhancement in biochemical systems.

[0063] Table 2. Candida prachuapensis LH-Y.0003 enhances the salt tolerance of common microorganisms (unit: 100 million CFU / ml)

[0064] Salinity 0.1% 1% 5% 8% 10% 15% Total number of colonies in the control group 32 38 15 5.8 0.2 0.05 Total number of colonies in the test group 25 30 42 22 28 24

[0065] Example 5: Candida prachuapensis LH-Y.0003 enhances the degradation ability of high-salinity wastewater

[0066] The test wastewater was the same as in Example 4, with a COD of 4000 mg / L, a TN of 80 mg / L, a TP of 25 mg / L, and a TDS of 1000 mg / L. After adding NaCl, the water in the biochemical system was replaced and the test was continued according to the test groups in Example 4 at 0%, 1%, 5%, 8%, 10%, and 15%. The test was conducted at 30°C and 160 r / min on a shaking table for 48 h. The system was continuously cultured for 3 cycles, and the TOC values of the influent and effluent were measured after removing the bacteria and SS using a microporous filter. The effect of Candida prachuapensis LH-Y.0003 on the degradation ability of the biochemical system was evaluated.

[0067] Table 3: Effect of Candida prachuapensis LH-Y.0003 on the TOC degradation ability of ordinary activated sludge under high-salinity conditions

[0068] Salinity 0.1% 1% 5% 8% 10% 15% TOC removal rate (%) in the control group 96.1 93.8 68.4 45.8 30.2 25.2 TOC removal rate (%) in the test group 96.3 95.2 94.3 94.1 93.8 91.6

[0069] The test results show that the addition of salt-tolerant yeast Candida prachuapensis LH-Y.0003 significantly improves the TOC / COD degradation ability of ordinary biochemical systems under high-salinity conditions.

[0070] Example 6: Candida prachuapensis LH-Y.0003 applied to high-salinity coking wastewater treatment

[0071] The TOC of a certain coking wastewater is about 2000-2300 mg / L, the COD is about 7500-8000 mg / L, the organic nitrogen is 200-250 mg / L, the ammonia nitrogen is 150 ng / L, the TN is 350-400 mg / L, and the salinity is 1-1.5%. The biochemical system uses the "A 2 / O-Secondary Sedimentation Tank ①-Secondary A / O-Secondary Sedimentation Tank ②" process, and the daily operation of the secondary sedimentation tank ② produces effluent with a COD of 1000-1200 mg / L, an ammonia nitrogen of 250-300 mg / L, and a total nitrogen of 350-380 mg / L.

[0072] For this coking wastewater treatment system, two sets of two-stage A / O pilot test devices, A and B, were built, with a scale of 50 L / d and process parameters identical to those of the coking wastewater: 18 h of anaerobic HRT, 32 h of anoxic, and 56 h of aerobic HRT for the first-stage A / O; 12 h of anoxic and 24 h of aerobic for the second-stage A / O. The activated sludge used in each process section of the pilot test device was taken from the corresponding process section of the coking wastewater biochemical system: the first-stage A 2MLSS of 4500 mg / L, and the secondary A / O sludge concentration MLSS of 3600 mg / L; the primary A 2 The sludge reflux ratio of the primary A / O was 200%, and the nitrification liquid reflux ratio was 400%; the sludge reflux ratio of the secondary A / O was 150%, and the nitrification liquid reflux ratio was 200%; the pH was maintained at 7.5-8.2 by adding alkali, and other process parameters were consistent with those of the biochemical system of the sewage station.

[0073] The two sets of small-scale devices A and B were operated according to the influent water quality and process parameters of the biochemical system of the coking wastewater, device A was used as a control, and device B was used as a test group. 2 The yeast fermentation liquid obtained in Example 2 was added to the primary A / O at 0.5% of the influent amount and to the secondary A / O at 0.5% of the influent amount, and the devices were continuously operated for 6 weeks. The effects of adding the yeast fermentation liquid are shown in the following table:

[0074] Table 4. Improvement of COD treatment efficiency of Candida prachuapensis LH-Y.0003 fermentation broth on coking wastewater

[0075] Time Week 0 Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 COD of effluent from device A (mg / L) 1208 1156 1105 1058 1045 1122 1038 COD of effluent from device B (mg / L) 1208 980 792 556 480 385 360

[0076] As shown in Table 4, the effluent COD of the biochemical device of device B to which the yeast fermentation liquid was added gradually decreased, and the COD decreased to below 400 mg / L at the 5th week, while the effluent COD of the control device A remained between 1000-1200 mg / L. The test results showed that after the salt-tolerant yeast fermentation liquid Candida prachuapensis LH-Y.0003 was added to the biochemical system of the coking wastewater, the COD degradation capacity of the activated sludge under the conditions of high salt 1-1.5% and high toxicity was significantly improved.

[0077] Table 5. Improvement of NH3-N treatment efficiency of Candida prachuapensis LH-Y.0003 fermentation broth on coking wastewater

[0078] Time Week 0 Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Device effluent NH3-N (mg / L) 260 265 270 262 255 269 270 B device effluent NH3-N (mg / L) 260 280 315 369 385 390 395

[0079] As shown in Table 5, the effluent NH3-N of the biochemical device of device B to which the yeast fermentation liquid was added gradually increased, and the effluent NH3-N increased to 385 mg / L at the 4th week, indicating that the ammonification of the biochemical system of the coking wastewater was significantly enhanced after the yeast fermentation liquid was added.

[0080] The effluent NH3-N of device B was still relatively high, indicating that the nitrification of NH3-N in the biochemical system was still relatively weak. The Candida prachuapensis LH-Y.0003 fermentation broth was continuously added to device B, and the effluent NH3-N decreased to below 5 mg / L at the 12th week.

[0081] Table 6. Improvement of NH3-N treatment efficiency in coking wastewater by fermentation broth of Candida prachuapensis LH-Y.0003

[0082]

[0083]

[0084] Example 7: Enhanced denitrification of coking wastewater by extracting Candida prachuapensis LH-Y.0003 yeast powder

[0085] Example 2: Fermentation broth of salt-tolerant yeast Candida prachuapensis LH-Y.0003 was prepared by referring to the preparation method of patent application CN2011100008835, through autolysis, enzymatic hydrolysis, inactivation, solid-liquid separation, vacuum concentration and spray drying.

[0086] Example 6 describes the coking wastewater A and B test apparatus, with a capacity of 50 L / d. The process parameters are the same as those for the coking wastewater: primary A / O anaerobic HRT 18h, anoxic 32h, aerobic HRT 56h; secondary A / O anoxic tank 12h, aerobic 24h; the activated sludge used in each process section of the pilot unit is taken from the corresponding process section of the coking wastewater biochemical system: primary A... 2 The MLSS concentration of the secondary A / O sludge was 4500 mg / L, and the MLSS concentration of the secondary A / O sludge was 3600 mg / L; the primary A / O sludge concentration was... 2 The A / O sludge return ratio is 200%, and the nitrification liquor return ratio is 400%; the secondary A / O sludge return ratio is 150%, and the nitrification liquor return ratio is 200%; other process parameters are consistent with those of the wastewater treatment plant's biological system.

[0087] Experimental apparatus A served as the control group, and experimental apparatus B served as the experimental group. Experimental apparatus B was treated with salt-tolerant yeast extract prepared using the above method, in group A. 2 The yeast extract concentrations added to the A / O and secondary A / O tanks were 50 mg / L and 30 mg / L, respectively. The experiment was run continuously for 90 days. After 90 days, the experimental results are as follows:

[0088] (1) The COD of the biochemical effluent from device A is maintained at 1000-1200 mg / L, the NH3-N in the effluent is maintained at 250-300 mg / L, and the TN in the effluent is maintained at 330-380 mg / L.

[0089] (2) Device B biochemical water COD from 1000 ~ 1200mg / L gradually reduced to 350 ~ 400mg / L, biochemical water NH3-N from 180-240mg / L first to 300-400mg / L, then gradually reduced to 5mg / L, biochemical water TN from 350 ~ 380mg / L stable at 350 ~ 380mg / L about 40d, with the effluent ammonia nitrogen decreased effluent TN gradually reduced to 50 ~ 100mg / L.

[0090] Example 8: Candida prachuapensis LH-Y.0003 yeast powder to strengthen the high salt nitrification ability

[0091] (1) culture medium: sodium acetate 300mg / L, ammonium chloride 380mg / L (NH3-N about 100mg / L), NaCl 1% ~ 15%, trace element solution 10ml, add buffer to pH 8 ~ 8.5.

[0092] (2) test design: nitrification test group in 1L aerobic device, while setting no adding salt-tolerant yeast control and Candida prachuapensis LH-Y.0003 nitrification test group, each add culture medium 800mL, nitrification test group and control group each inoculated with 1% salinity of activated sludge 200ml to make the system sludge concentration MLSS to 3000mg / L, set 7 salinity gradient, salt content is 1%, 3%, 5%, 6%, 8%, 10%, 12%, 15%. According to the salinity gradient gradually improve the salinity of the test system.

[0093] (3) nitrification test: nitrification test group inoculated with salt-tolerant yeast powder prepared in example 7, the dosage concentration is 100mg / L; salt water to 1L system; control group without inoculation of salt-tolerant yeast powder, at room temperature 25-30℃, aeration culture, control dissolved oxygen 2-6mg / L, respectively, 24h sampling to determine the concentration of NH3-N in the system. The test results are shown in table 7.

[0094] (4) test results: salinity <5% when nitrification is less affected by salinity, salinity increased to 5% and above, ammonia nitrogen removal effect is obviously weakened, to no ammonia nitrogen removal effect, while the salinity of the system inoculated with yeast powder to 15%, there is obvious ammonia nitrogen removal effect, therefore, in the high salt system of salinity ≥5% salt-tolerant yeast powder to nitrification system shows obvious strengthening synergistic effect.

[0095] Table 7 Candida prachuapensis LH-Y.0003 yeast powder to strengthen the high salt nitrification ability test (unit: mg / L)

[0096]

[0097] The scope of protection of the present application is not limited to the above embodiments. Variations and improvements based on the spirit of the present application, which can be conceived by those skilled in the art, are included in the present application and are protected by the scope of the appended claims.

Claims

1. A salt-tolerant yeast (Saccharomyces sp. Candida prachuapensis ) LH-Y.0003, deposited with the China General Microbiological Culture Collection Center on December 9, 2019, and assigned accession number CGMCC NO. 19111, address: No. 1, Xili Beichen, Chaoyang District, Beijing.

2. An inoculant characterized in that, The salt-tolerant yeast LH-Y.0003 according to claim 1 or a culture containing the salt-tolerant yeast LH-Y.0003 according to claim 1.

3. A yeast extract characterized in that, The salt-tolerant yeast LH-Y.0003 according to claim 1.

4. The salt-tolerant yeast as described in claim 1 ( Candida prachuapensis The application of LH-Y.0003 or the bacterial agent of claim 2 or the yeast extract powder of claim 3 in the treatment of high-salt wastewater, wherein the salt concentration of the high-salt wastewater is 1%~15%.

5. The salt-tolerant yeast of claim 1, Candida prachuapensis ) LH-Y.0003 or the microbial inoculum of claim 2 or the yeast extract of claim 3 for use in the preparation of a product for treating high-salinity wastewater, the high-salinity wastewater having a salt concentration of 1% to 15%.

6. Use according to claim 5, characterized in that, The concentration of the yeast extract is 20-1000 mg / L.

7. A method of treating high-salinity wastewater, characterized by, adding the salt-tolerant yeast (Saccharomyces cerevisiae) of claim 1 into high-salt wastewater Candida prachuapensis ) LH-Y.0003 or the microbial agent of claim 2 or the yeast infusion powder of claim 3, wherein the salt concentration of the high-salt wastewater is 1% to 15%.

Citation Information

Patent Citations

  • Salt-tolerant saccharomycetes strain for increasing Sotolone content in soy sauce and application of salt-tolerant saccharomycetes strain

    CN113322193A

  • Salt-tolerant saccharomycetes for increasing content of ethyl ester compounds in soy sauce and application of salt-tolerant saccharomycetes

    CN113462585A

  • Salt-tolerant saccharomycetes for increasing content of pyrazine compounds in soy sauce and application of salt-tolerant saccharomycetes

    CN114480150A

  • Use of candidaversitijis for removing aflatoxin B1 in high salinity environment

    CN102197861A

  • Candida tropicalis capable of treating high-salinity organic chemical wastewater, and application of candida tropicalis

    CN104560746A