Alfalfa MsASG166 gene and its use in improving plant drought tolerance

Abstract

The invention discloses an alfalfa MsASG166 gene and an application of the gene in improving plant drought resistance. The invention identifies alfalfa-specific gene for the first time, analyzes the physiological and molecular functions of MsASG166 in response to drought stress, and provides MsASG166 gene and protein thereof, which are positioned on cell membrane and cytoplasm, expressed under the induction of mannitol, salt and ABA, and can improve plant drought resistance. The DNA sequence of the stress resistance-related protein and the encoded protein of the invention are enhanced in stress resistance (especially drought resistance) compared with the original protein and the encoding gene sequence thereof, and provide a theoretical basis for artificially controlling the expression of stress resistance-related genes, which is beneficial to the cultivation of plant varieties with stronger stress resistance or the transformation of stress resistance of other plants.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the use of alfalfa MsASG166 gene in improving plant drought resistance. Background Art

[0002] Drought is the main limiting factor for crop growth and yield in agricultural systems. With the rapid growth of population and the sharp increase in water demand, agriculture faces the dual challenge of increasing food and feed production. In order to resist drought stress in nature, plants have gradually evolved a variety of coping strategies in the long process of evolution. In recent years, scholars have conducted in-depth research on the physiological, biochemical and genetic basis of plant drought adaptability, and found that plants can limit water transpiration loss by closing stomata and rolling leaves, thereby quickly responding to drought at the physiological level, and ultimately regulating the physiological and developmental processes of drought through the reprogramming of gene expression and metabolism.

[0003] Alfalfa (Medicago sativa), as the most important legume forage in the world, has the characteristics of high yield, rich nutrition, strong adaptability and water and soil conservation, and plays an important role in the pastoral ecosystem. Alfalfa is often exposed to adverse growth conditions, such as drought in Argentina and northern China, low temperature in Russia and Canada, and saline-alkali land in California and Australia, which seriously affect the yield and quality of alfalfa. During the long-term domestication of alfalfa, the emphasis on high-yield related traits has indirectly led to a decrease in alfalfa's tolerance to adverse environments. Therefore, it is increasingly important to create and breed high-tolerance alfalfa germplasm. As a high-water-consuming crop, water is an important factor affecting its distribution and growth and development. Cultivating and planting highly drought-resistant alfalfa varieties is an effective way to increase and stabilize its yield. Due to the complex characteristics of alfalfa such as polyploid inheritance, inbreeding depression, cross-pollination, and self-incompatibility, it has been hindered to a certain extent to clarify the analysis of its gene functions and molecular regulatory mechanisms in response to drought stress from the perspective of genetics and genome. With the publication of the genome of the cultivated alfalfa variety "Zhongmu No. 1" in 2020, the foundation has been laid for analyzing the molecular mechanism of alfalfa's response to drought stress at the genome level.

[0004] Lineage-specific genes are special genes that exist only in a certain species lineage and have no homologous genes in other species lineages. Due to the species specificity of lineage-specific genes, their biological functions are closely related to species-specific stress response processes and developmental mechanisms, which are of great significance for clarifying the evolutionary process of species and analyzing species-specific molecular regulatory mechanisms. Lineage-specific genes have the characteristics of short length, small number of introns and exons, and low tissue expression level; but they are more preferentially expressed when stimulated by the external environment. With the successive deciphering of tetraploid and diploid alfalfa genomes, it is time to identify and study the functions of alfalfa-specific genes at the whole genome level. Therefore, exploring the lineage-specific genes of alfalfa that respond to drought and analyzing their molecular regulatory mechanisms can provide new ideas and new gene resources for enriching the drought resistance theory of alfalfa and creating highly drought-resistant alfalfa germplasm through genetic engineering technology. Summary of the invention

[0005] One of the purposes of the present invention is to provide alfalfa MsASG166 gene, which is a lineage-specific gene.

[0006] The second object of the present invention is to provide the use of the above-mentioned alfalfa MsASG166 gene. By analyzing the physiological and molecular functions of MsASG166 in response to drought stress, the provided MsASG166 gene and the protein of the recombinant MsASG166 gene are localized on the cell membrane and cytoplasm, expressed under the induction of mannitol, salt and ABA, and can improve the drought resistance of plants.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] The nucleotide sequence of the alfalfa MsASG166 gene is shown in SEQ ID NO.1.

[0009] The forward primer sequence for amplifying the MsASG166 gene is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4.

[0010] The protein encoded by the above-mentioned alfalfa MsASG166 gene is selected from:

[0011] (1) Its amino acid sequence is shown in SEQ ID NO.2;

[0012] (2) a protein derived from (1) which is obtained by replacing, deleting or adding one or more (e.g., 1-30; preferably 1-20; more preferably 1-10; such as 5, 3) amino acid residues of the amino acid sequence of SEQ ID NO: 2 and has the function of the protein of (1); or

[0013] (3) A protein derived from (1) that has 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology with the protein sequence defined in (1) and has the function of the protein of (1).

[0014] Among them, the CDS sequence of SEQ ID NO.1 in the sequence is 210bp in length and encodes 69 amino acids in total. Its amino acid sequence is shown in SEQ ID NO.2.

[0015] The expression cassette, transgenic cell line, recombinant bacteria, recombinant virus, recombinant vector, expression vector and host cell containing the expression vector and the construction method thereof containing the above-mentioned gene also fall within the protection scope of the present invention.

[0016] The main purpose of the present invention is to clone and identify the alfalfa MsASG166 gene at the molecular level, so as to analyze the physiological and molecular functions in response to drought stress.

[0017] The invention also discloses the use of the alfalfa MsASG166 gene.

[0018] The provided MsASG166 gene and the protein of the recombinant MsASG166 gene are positioned on the cell membrane and cytoplasm, expressed under the induction of mannitol, salt and ABA, and can improve the drought resistance of plants.

[0019] The invention also discloses a method for cultivating transgenic plants, wherein the MsASG166 gene is introduced into a target plant to obtain a transgenic plant, wherein the drought resistance of the transgenic plant is stronger than that of the target plant.

[0020] Specifically, the MsASG166 gene can be introduced into the target plant through the recombinant expression vector. In the method, the recombinant expression vector can be used to transform plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants.

[0021] Specifically, in order to improve the excellent traits of plants, the present invention also protects a new plant breeding method, comprising the following steps (1) and / or (2):

[0022] (1) By increasing the activity of MsASG166 protein in the target plant, a plant with stronger drought tolerance than the target plant is obtained; (2) By promoting the expression of MsASG166 gene in the target plant, a plant with stronger drought tolerance than the target plant is obtained;

[0023] The implementation method of "promoting the expression of MsASG166 gene in target plants" can be as follows (1) or (2) or (3):

[0024] (1) Introducing the MsASG166 gene into target plants;

[0025] (2) introduction of strong promoters and / or enhancers;

[0026] (3) Other common methods in this field.

[0027] In the present invention, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants, or forestry plants, etc. The plants can be, for example (but not limited to): dicotyledons, monocotyledons or gymnosperms.

[0028] As a preferred method, the "plant" includes but is not limited to: alfalfa, Arabidopsis, and any plant having the gene or a homologous gene thereof is applicable. It is particularly suitable for plants that need to improve drought tolerance. In actual application, for plants that need to improve drought tolerance, strains with the gene can be cultivated by genetically modifying the plant.

[0029] The "plant" mentioned in the present invention includes the whole plant, its parent and progeny plants and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues and organs, and these different parts all have our target gene or nucleic acid. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristem regions, gametophytes, sporophytes, pollen and microspores, and similarly, each of the aforementioned objects contains the target gene / nucleic acid.

[0030] The present invention includes any plant cell, or any plant obtained or obtainable by the method therein, and all plant parts and propagules thereof. This patent also includes transfected cells, tissues, organs or whole plants obtained by any of the aforementioned methods. The only requirement is that the offspring exhibit the same genotypic or phenotypic characteristics, and the offspring obtained using the method in this patent have the same characteristics.

[0031] The invention also extends to the harvestable parts of the plants as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It also further relates to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starch or proteins. The invention also relates to foods or food additives obtained from the relevant plants.

[0032] The present invention has the following advantages:

[0033] The present invention identifies alfalfa-specific genes for the first time, and analyzes the physiological and molecular functions of MsASG166 in response to drought stress. The provided MsASG166 gene and its protein are located on the cell membrane and cytoplasm, expressed under the induction of mannitol, salt and ABA, and can improve the drought resistance of plants. The DNA sequence of the stress resistance-related protein of the present invention and the protein encoded by the protein are enhanced in stress resistance (especially drought resistance) compared with the original protein and its encoding gene sequence, providing a theoretical basis for artificially controlling the expression of stress resistance-related genes, which is beneficial to the cultivation of plant varieties with stronger stress resistance or the transformation of the stress resistance of other plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the subcellular localization map of MsASG166 gene in onion epidermis;

[0035] In the figure, from left to right are the green fluorescent protein of the target gene, bright field and superimposed photos of three channels, and the GFP empty vector is used as a control. The scale bar in the figure is 30μm.

[0036] Figure 2 This is the PCR test result of MsASG166 transgenic Arabidopsis positive plants;

[0037] In the figure, M is a 2000 bp marker, 1-16 are 16 overexpression strains of transgenic Arabidopsis, WT is wild-type Arabidopsis, - is a negative control, and Plasmid is an empty plasmid.

[0038] Figure 3 It is the identification of the expression level of MsASG166 transgenic Arabidopsis thaliana; Note: * represents P < 0.05.

[0039] Figure 4 It is the evaluation of the root length phenotype of MsASG166 transgenic Arabidopsis thaliana on flat plates;

[0040] In the figure, A. Root length phenotype of MsASG166 transgenic Arabidopsis on plates with different concentrations of mannitol and ABA; B. Root length statistics of MsASG166 transgenic Arabidopsis on plates with different concentrations of mannitol and ABA, and the error bars represent the standard error of 4 biological replicates.

[0041] Figure 5 This is a diagram of the soil drought phenotype of transgenic Arabidopsis thaliana overexpressing MsASG166. DETAILED DESCRIPTION

[0042] The present invention will be described in detail below through specific embodiments. These embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0043] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained through commercial channels.

[0044] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0045] Unless otherwise specified, the implementation of the present invention will use conventional botanical techniques, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination and bioinformatics techniques that are obvious to those skilled in the art. These techniques are fully explained in the published literature. In addition, the methods of DNA extraction, construction of phylogenetic trees, gene editing methods, construction of gene editing vectors, and obtaining gene-edited plants used in the present invention can be achieved by using methods already disclosed in existing literature, except for the methods used in the following examples.

[0046] The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences and regulatory sequences of non-coding regions, but are not limited to these. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include a coding sequence in a cDNA, and / or include a cDNA and its regulatory sequences. In specific embodiments, such as with respect to an isolated nucleic acid sequence, it is preferably assumed to be cDNA.

[0047] In addition, in order to have a more intuitive understanding of the technical solution of the present invention, some professional terms involved in the present invention are explained as follows:

[0048] "Expression vectors" refers to a vector that adds expression elements (such as promoter, RBS, terminator, etc.) to the basic skeleton of a cloning vector to enable the expression of the target gene.

[0049] "Agrobacterium-mediated transformation" refers to the technology of inserting the target gene into the modified T-DNA region, using the infection of Agrobacterium to achieve the transfer and integration of foreign genes into plant cells, and then regenerating transgenic plants through cell and tissue culture technology.

[0050] Target plant: target plant. The target plant described in the present invention is soybean.

[0051] Target gene: target gene, also known as target gene, is a gene used for gene recombination, changing the characteristics of receptor cells and obtaining the expected expression product in genetic engineering design and operation. It can be from the organism itself or from a different organism.

[0052] Example

[0053] A lucerne MsASG166 gene was screened using a variety of technical means such as transcriptomics and metabolomics. The full-length coding frame nucleotide sequence of the gene is 210bp long and consists of 69 amino acids. After sequencing, its nucleotide sequence is shown in SEQ ID NO.1, and its protein sequence is shown in SEQ ID NO.2.

[0054] 1. Cloning and vector construction of MsASG166

[0055] According to the MsASG166 gene, DNAMAN was used to design and clone the full-length specific primers with restriction sites, wherein the forward primer sequence is: ACCAGTCTCTCTCTCAAG CTTATGTCTACTCCTCCTCCTACTG (SEQ ID NO.3), and the reverse primer sequence is: ACGGGTCATGAGCTCCTGCAGATCACCAACCACCATCTTCCAGA (SEQ ID NO.4). The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and the HAP purification method was selected.

[0056] The reaction system for cloning DNA sequence: cDNA 2μL, kod DNA polymerase 0.5μL, forward primer / 10μM 0.8μL, reverse primer / 10μM 0.8μL, 2mM dNTPs 2μL, 10× buffer 2μL, DMSO 1μL, ddH2O 10.9μL, total volume 20μL.

[0057] PCR amplification reaction program: 94°C for 4 min; 94°C for 30 s, 60°C for 30 s, 68°C for 45 s, 40 cycles; 68°C for 8 min.

[0058] Add an appropriate amount of 10× loading buffer to each reaction tube and perform electrophoresis on a 1.5% agarose gel. Perform electrophoresis at 5-10V / cm in 0.5×TBE buffer, end the electrophoresis, and take pictures in a gel imaging system. Use the agarose gel DNA recovery kit (GK2042) of Jierui Biotechnology to recover the target fragment: carefully cut off the DNA target band and put it into a 1.5ml EP tube. Add 400μl of banding B to the tube and put it in a 70℃ water bath until the gel is completely dissolved. Add 100μl of isopropanol to the tube, let it stand at room temperature for 1min, and centrifuge it at 5000rpm for 1min to pass through the column. Repeat step 3. Add 500μl washbuffer 12000rmp to wash twice, and centrifuge it at 10000rmp for 1min. Add 40μl of double distilled water to the column, let it stand at 37℃ for 2min, and centrifuge it at 12000rmp for 1min to collect. The purified target fragment and PHG vector were digested with single enzymes to obtain the target fragment and vector fragment with the same enzyme cutting site. Hind III / PST I 6μL, 10× enzyme digestion buffer 4μL, 10× BSA 4μL, plasmid template amount ≤1ng, ddH 2 O was diluted to 40 μL, and the entire system was PCR reacted at 37°C for 1 hour. After the PC fragment was recovered by agarose gel, it was mixed with the empty vector recovered by enzyme digestion and added to the EasyGenoDNA recombination system for connection. The 10μl recombination system is as follows: 2×EasyGeno Assembly Mix 5μL, enzyme-cut vector DNA 2.5μL, fragment DNA 2.5μL. Add the reaction system to a 250μl EP tube, place it in a 50°C water bath for 30 minutes, and then transform the E. coli plate. After placing it in a 37°C incubator for 16 hours, pick the bacteria and send them for sequencing. The correctly sequenced plasmids were stored at -20°C for a long time. 2. Agrobacterium transformation and subcellular localization of onion epidermal cells

[0059] The plasmid sequenced correctly in the previous step was transformed into Agrobacterium tumefaciens GV3101 cells by electroporation. The instruments used were Olympus laser confocal microscope, Thermo Sorvall ST16R centrifuge, HH-S3 digital constant temperature water bath, and DYY-8D constant voltage and constant current electrophoresis instrument.

[0060] (1) Onion epidermal cell transient transformation protocol:

[0061] a. Pre-culture of onion epidermis: Use tweezers to tear off 1 cm of the inner epidermis of the onion 2 The small pieces were placed on MS medium and pre-cultured at 28°C for 5 h.

[0062] b. Preparation of infection solution: Add the bacterial solution to LB medium containing antibiotics and culture overnight, centrifuge at 5000 rpm for 5 minutes, collect the bacteria, resuspend in LB culture medium, measure the concentration of the bacterial solution with a spectrophotometer, and adjust the concentration to about OD=1.

[0063] c. Dip: Pour the above bacterial solution into the pre-culture medium and soak for 30 minutes, shaking several times during the period. Pour off the bacterial solution, place the onion epidermis on sterile filter paper to absorb the surface bacterial solution. Inoculate it into the co-culture medium (MS medium plus AS), culture it in the dark at 28℃ for 2 days and observe.

[0064] (2) Confocal microscopy observation:

[0065] a. Turn on your computer.

[0066] b. Turn on the laser.

[0067] c. Turn on the power switch of the mercury lamp.

[0068] d. Open the software.

[0069] e. Turn on the white light switch, place the label, and adjust the focus.

[0070] f. Turn on the laser light switch and click the photo button to take a photo.

[0071] g. Add a ruler and export a .tif image.

[0072] In order to explore the subcellular localization and potential role of the MsASG166 gene, the coding sequence of MsASG166 was fused with the enhanced GFP gene to form the MsASG166::eGFP vector under the control of the constitutive CaMV35S promoter, which was transiently transformed into onion epidermal cells by Agrobacterium-mediated method, and the empty vector PHG-eGFP was used as a control. Confocal microscopy showed that the eGFP fluorescence signal in the empty cells was distributed in the cell wall, cytoplasm and nucleus, while the eGFP fluorescence signal fused to MsASG166 was mainly distributed in the cytoplasm and intercellular space ( Figure 1 ), but no distribution was found in the nucleus, indicating that MsASG166 was localized in the cytoplasm and intercellular space.

[0073] 3. Functional identification of MsASG166 gene

[0074] 1. Genetic Transformation of Arabidopsis thaliana by Floral Dipping

[0075] Heat shock method for transformation and identification of Agrobacterium tumefaciens. Take the competent state of Agrobacterium stored at -80℃ and place it at room temperature or in the palm of your hand for a while until it partially melts. Insert it into ice when it is in an ice-water mixture state. Add 0.1μg (volume not more than 10μl) plasmid DNA for every 100μl competent state, stir the bottom of the tube by hand to mix, and let it stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37℃ water bath for 5 minutes, and ice bath for 5 minutes. Add 700μl LB liquid culture medium without antibiotics and culture at 28℃ and 200rpm for 2 to 3 hours. Centrifuge at 6000rpm for one minute to collect the bacteria, keep about 100μl of supernatant, gently blow and resuspend the bacteria block, apply it on the LB plate containing 50μg / ml kanamycin, and invert it in a 28℃ incubator for 2-3 days. Randomly select a single colony, do colony PCR, identify the correct Agrobacterium monoclone and mark it for use. Use a sterile pipette to pick up the marked Agrobacterium monoclone and inoculate it into 1.5 ml LB liquid medium containing the corresponding antibiotics and shake it at 30°C, 200 rpm for 24 hours. Inoculate the Agrobacterium culture with a small shake ratio into 100 ml LB liquid medium containing antibiotics at 1%, shake it at 30°C until OD600 = 1.0; centrifuge at 20°C, 4000 rpm for 15 minutes to collect the cells; blow the cells evenly with the transformation buffer and resuspend them to about OD600 = 1.0. Planting of Arabidopsis thaliana.

[0076] Preparation of culture medium: The culture medium for Arabidopsis thaliana is 1 / 2MS (0.8% agar powder, 1% sucrose, pH = 5.8). Seed disinfection: Disinfect with 1 ml of 7% sodium hypochlorite solution, mix evenly for 15 minutes, and then rinse upside down with sterile water 5 times. After the disinfected seeds are divided into packages, mix evenly with 40-50°C culture medium, pour into the plate, and evenly cover a layer (a small culture dish requires about 4-5 ml of culture medium). Seal the plate, vernalize in a 4°C refrigerator for 2-3 days, and place it in an artificial climate chamber to begin germination and growth. The plant growth environment is 60% relative humidity; constant temperature 21-23°C; photoperiod is 16h light and 8h dark.

[0077] Preparation of planting soil: Mix peat soil and vermiculite at a ratio of 2:1 and set aside for later use. Soil soaking: Put the soil into the planting pot to about 1 cm from the pot mouth, and use Huawuque compound fertilizer (N, P, K = 20%, 20%, 20%) to completely soak it. Transplanting: 7 to 12 days after germination, select healthy and uniformly growing seedlings and transplant them into the culture soil that has been soaked with Huawuque in advance, cover it with plastic wrap, and remove it after the seedlings grow vigorously.

[0078] For Arabidopsis transformation, water the plants that are currently sprouting and flowering one day in advance. Invert the small pot and place all the inflorescences in the bacterial solution previously suspended in the transformation buffer for about 30 seconds. Repeat the transformation once after 7 days. After 2-3 weeks, water as little nutrient solution as possible to accelerate aging. Collect the mature seeds in a paper bag and dry them for 7 days.

[0079] 2. Detection of positive transgenic Arabidopsis plants

[0080] When the transgenic Arabidopsis matures, the T0 generation seeds are harvested and spread on plates containing HYB (50 μg / mL) resistance for screening. The seedlings with HYB activity are transplanted into pots, and the T1 generation seeds are harvested. Resistance screening continues until the seeds of the T2 generation homozygous strains are obtained. After obtaining the homozygous transgenic strains, DNA from the leaves of the Col-0 wild type and transgenic Arabidopsis of different strains is extracted by using the SDS method, and the positive plants are detected by using the two pairs of primers 35S-F and MsASG166-R, as well as HPT-F and HPT-R, and 2×Taq Master Mix enzyme amplification.

[0081] HPT-F:GGTCGCCGGAGGCTATGGATGC;

[0082] HPT-R:GCTTCTGCGGGCGATTTGTGT;

[0083] 35S-F: GGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTG; MsASG166-R: ACGGGTCATGAGCTCCTGCAGATCACCAACCACCATCTTCCAGA; reaction system: cDNA 2μL, 2×Taq Master Mix 10μL, forward primer / 10μM 0.8μL, reverse primer / 10μM 0.8μL, ddH 2 O 6.4μL, total volume 20μL. PCR amplification reaction program: 94℃3min; 94℃30s, 60℃30s, 72℃1min, 35 cycles; 72℃5min.

[0084] After overexpressing the MsASG166 gene in Arabidopsis, a total of 20 transgenic lines were obtained. After PCR identification, a total of 16 lines contained the hygromycin resistance gene HPT amplified by HPT-F / HPT-R with a length of 598 bp and a 560 bp fragment containing the target gene amplified by 35S-F / MsASG166-R chimeric primers ( Figure 2), and then qPCR was used to detect the expression of MsASG166 in these 16 transgenic lines. The results showed that the expression level of MsASG166 in the 16 transgenic lines was higher than that in the wild type ( Figure 3 ), the smallest expression level was in strain 1, and the largest expression level was in strain 9, which was 28 times that of strain 1. The expression levels of strains 2, 6, 7, 8, 9, 11, and 16 were all above 500.

[0085] 3. Determination of drought resistance evaluation indexes of transgenic Arabidopsis

[0086] In order to analyze the stress resistance characteristics of transgenic Arabidopsis, the root length of the obtained transgenic Arabidopsis was evaluated under 1 / 2MS plate simulated drought stress. The root length swing experiment was carried out in a clean bench. One-week-old seedlings were transferred to 1 / 2MS plates with 100mM, 200mM, 300mM mannitol, and 30μM ABA and control plates. The control was 1 / 2MS medium without other additions. Col-0 Arabidopsis and transgenic strains were spread on the same plate at the same time. Each dish contained 4 strains including wild-type Arabidopsis, and each strain contained 4 replicates. After the root length swing was completed, it was immediately moved into a walk-in incubator, 16h light / 8h dark, 22℃ conditions for germination and growth for about 7d, and the seedling phenotype was photographed and the absolute root length of each seedling was measured. R language was used to draw the picture, and SPSS20 was used to analyze the significance.

[0087] According to the results of the qPCR experiment, the seedlings of the three homozygous transgenic lines with the highest expression levels were selected, namely OE-2, 0E-8, and OE-9, to verify whether they are more drought-resistant than wild-type Arabidopsis. Arabidopsis seeds were germinated on 1 / 2MS medium. When the root length of the seedlings grew to about 1 cm, wild-type and transgenic seedlings with consistent root length were selected and moved to the same 1 / 2MS medium. 0mM, 100mM, 200mM, 300mM mannitol and 30μM ABA were added to the medium, and the growth trend was observed. The main root length ( Figure 4 ). On the medium without stress, the growth of the wild type and MsASG166 transgenic lines was relatively consistent, with no significant difference; with the increase of mannitol concentration, the growth of both the wild type and transgenic lines was inhibited to a certain extent, but compared with the wild type WT, under low concentration (100mM) of mannitol stress, the root length of the MsASG166 transgenic line was significantly longer than that of the wild type, and compared with the unstressed culture medium, the MsASG166 transgenic line also increased to a certain extent.

[0088] With the increase of mannitol concentration, under 200mM mannitol stress, the leaves of both the wild type and transgenic lines showed a certain degree of curling and wilting, but the curling and wilting degree of the leaves of the transgenic lines was lower than that of the wild type WT. From the perspective of root system comparison, the root system of the MsASG166 transgenic line was significantly longer than that of the wild type; under 300mM mannitol stress, the wild type and MsASG166 transgenic seedlings grew the worst, the leaves shrank and turned yellow, and the taproot grew slowly, but the taproot length of the MsASG166 transgenic line was longer than that of the wild type; under 30μM ABA stress, the growth of the wild type and transgenic lines was also inhibited, both the leaves and roots curled, the leaves were light green and grew well, but the root growth was significantly inhibited, indicating that the root system was under more severe stress than the leaves. However, compared with the wild type, the root length of the transgenic strain was longer than that of the wild type. These results indicate that under mannitol or ABA stress, the root system of the MsASG166 transgenic strain is longer than that of the wild type. Therefore, the MsASG166 transgenic strain has higher drought resistance.

[0089] From the perspective of plant growth phenotype ( Figure 5 ), after 30 days of watering cessation, the wild-type WT was almost killed by drought, while the leaves of the highly expressed MsASG166 transgenic lines OE-8 and OE-9 curled and wilted to a certain extent, but their growth was significantly better than that of the wild type. After rehydration, the wild-type WT did not survive, while the MsASG166 transgenic lines OE-8 and OE-9 almost recovered to their original growth state. It can be seen that the seedlings of MsASG166 transgenic Arabidopsis have stronger drought tolerance than wild-type Arabidopsis.

[0090] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. Alfalfa MsASG166 A gene characterized by Said MsASG166 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The method according to claim 1 MsASG166 The protein encoded by the gene is characterized in that MsASG166 The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. Alfalfa according to claim 1 MsASG166 A gene characterized by Said MsASG166 The forward primer sequence of the gene is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.

4.

4. The method according to claim 1 MsASG166 Use of the gene or the protein according to claim 2 in improving the drought resistance of Arabidopsis thaliana.

5. A method for cultivating transgenic plants, characterized in that: The claim 1 MsASG166 The gene is introduced into a target plant to obtain a transgenic plant, wherein the transgenic plant has a stronger drought resistance than the target plant, and the target plant is Arabidopsis thaliana.

Images