A 5' flap nuclease-mediated isothermal amplification method
The 5' flap endonuclease of Taq enzyme releases aptamer and isothermal amplification combined with exogenous circular plasmids, solving the problems of complex primer design and high false positive rate in existing isothermal amplification technologies, and achieving simplified design and high specificity and low false positive detection effects.
Patent Information
- Application Number
- CN202210813606.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-12
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2042-07-12
AI Technical Summary
The existing isothermal amplification technology has the problems of complex primer design and high false positive rate, which is difficult to meet the detection needs of specificity and sensitivity.
The 5' flap endonuclease (FEN1) of Taq enzyme was used to release complementary paired aptamers, and the gaps were filled with complementary amplification between aptamers, combined with exogenous circular plasmids for isothermal amplification. Two pairs of primers were designed to achieve detection of specificity and sensitivity.
The primer design is simplified, the false positive rate is reduced, the specificity and sensitivity of the detection are improved, and it is suitable for large-scale detection of different detection sites.
Smart Images

Figure CN116064745B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of nucleic acid isothermal amplification, and in particular to the field of 5' flap endonuclease isothermal amplification using Taq enzyme. Background Art
[0002] In recent years, molecular biology technology has developed rapidly. In order to adapt to the detection needs of different environments, different samples and different purposes, a variety of isothermal amplification methods have emerged. Among them, loop-mediated isothermal amplification (LAMP) and cross-priming isothermal amplification (CPA) are the two most widely used schemes. Figure 1 As shown; the specific CAP amplification process is as follows Figure 2 shown.
[0003] Currently, there are two problems with isothermal amplification technology: 1. Difficulty in primer design: The above method requires the design of at least three pairs of primers to complete amplification. Considering factors such as primer specificity, length, and Tm value, the design of primers for the above isothermal amplification method becomes more difficult. In addition, due to the presence of factors such as DNA repetitive sequences and regions with high GC content, not all sites can be amplified using the above two schemes. 2. High false positive rate: Due to the extremely high sensitivity of isothermal amplification, if there is contamination in the reaction environment or the primers have non-specific amplification, false positive results are very likely to occur, causing misjudgment of the test. Summary of the Invention
[0004] The purpose of the invention is to provide an isothermal amplification method with simple design, high specificity and sensitivity, and low false positive rate, so as to solve the problems of complex primer design and high false positive rate in the prior art.
[0005] Technical Solution: An isothermal amplification method utilizes the properties of the 5' flap endonuclease (FEN1) of the Taq enzyme to release complementary aptamers. The aptamers then amplify and fill the gap. The single strands of the melted full-length aptamers recognize the target region of the circular plasmid in the system and are amplified isothermally by the isothermal amplification enzyme.
[0006] The method includes a primer set, an adapter sequence, a probe sequence, and an exogenous circular plasmid; and the enzymes used include Taq enzyme, Bst enzyme, and the like.
[0007] The whole method steps are as follows:
[0008] Step A: Design primer set
[0009] Primers were designed for the target gene, and the primers included two pairs, A / B and C / D.
[0010] A / B are outer bidirectional primers with a length of 10-60 nt, preferably 18-24 nt, used to anchor the target gene. Amplicon length is not limited, but 100 bp to 1 kb is preferred. The A / B structure can be unmodified or modified to enhance specificity and stabilize the primer structure, such as phosphorothioate. The A / B primer sequences do not recognize regions specific to the exogenous plasmid.
[0011] C / D is an inner bidirectional primer. On the one hand, it further anchors the target gene to improve specificity. On the other hand, the 5' end of the C / D primer is the probe PC / PD sequence, which is used to release the probe to identify the exogenous plasmid; the 3' end is the target gene anchor primer C' and D', which are used to identify and anneal the target gene. In the actual reaction, the C / D primer can be a pair or multiple pairs. The C / D structure is shown in the figure below. Figure 3 shown.
[0012] The C' / D' recognition region is within the amplification range of the A / B primer pair, and the primer length is 10-60 nt, with an optimal range of 18-24 nt;
[0013] The C' / D' primer sequence has no recognition region with the exogenous plasmid, especially the 3' end;
[0014] C' / D' can be unmodified or partially modified to improve specificity and stabilize primer structure, such as thiolation.
[0015] The C' / D' can have 1-5 bases different from the target gene at the 3' end to block the extension, with 2-3 being the optimal.
[0016] C' / D' can be modified by adding dideoxycytosine at the 3' end to block extension;
[0017] Probe PC consists of two sequences: exogenous plasmid recognition sequence C1 and adapter sequence 1;
[0018] Probe PD consists of two sequences: exogenous plasmid recognition sequence D1 and adapter sequence 2;
[0019] C1 and D1 are exogenous plasmid recognition sequences, which recognize exogenous plasmid specific sequences. The length of the exogenous plasmid recognition sequence is 10-60nt, preferably 16-40nt, and most preferably 18-24nt.
[0020] Adaptor sequence 1 and adaptor sequence 2 are reverse complementary sequences, and their sequences have no recognition regions on the target gene and the exogenous plasmid. The length of the adaptor sequence is 10-60 nt, more preferably 16-40 nt, and most preferably 18-24 nt.
[0021] Selection of exogenous plasmid: Select a suitable circular plasmid as the exogenous plasmid for isothermal amplification.
[0022] Step B: Target gene identification and probe replacement and extension to form exogenous plasmid recognition structure
[0023] Obtain the sample DNA / RNA to be tested (hereinafter referred to as the target gene). DNA can be used directly for subsequent testing, while RNA needs to be subjected to a common reverse transcription step to obtain the corresponding cDNA for subsequent testing. Those skilled in the art are very familiar with this step and are not restricted here.
[0024] The A / B primer pair recognizes the target gene site and binds to the target gene, and amplification begins under the action of Taq enzyme. The enzyme here can be Taq enzyme or other DNA polymerases with 5' flap endonuclease activity.
[0025] The 3' end C' and D' sequences of the C / D primer pair recognize the target gene locus respectively. Due to the 5' flap endonuclease activity, the PC / PD sequences of the C / D primers are cleaved and released respectively.
[0026] The 3' ends of the PC / PD sequences are complementary and extended and filled in by the Taq enzyme to form a double-stranded DNA structure PCPD. The enzyme here can be Taq enzyme or other enzymes with DNA polymerase activity.
[0027] Step C: Probe identification and isothermal amplification
[0028] Double-stranded DNA structures, such as PCPD, are denatured to restore single-stranded PC / PD. Denaturation can be performed by heating to a high temperature followed by cooling, or using a denaturing agent such as sodium hydroxide buffer.
[0029] PC / PD anneal and recognize and bind to specific sites of the exogenous circular plasmid respectively. Here, the recognition site can be one or more.
[0030] Start circular isothermal amplification, where the enzyme can be Bst DNA Polymerase or other DNA polymerases with strand displacement activity.
[0031] The amplification results can be identified by fluorescence, turbidity meter, qPCR instrument, electrophoresis, etc.
[0032] Beneficial effects: The present invention realizes the conversion from the target detection fragment to circular amplification through the endonuclease action of the 5' flap nuclease, the exogenous DNA sequence designed on the probe primer, and the exogenous plasmid, thereby meeting the detection requirements of exponential amplification. At the same time, due to the presence of exogenous DNA and exogenous plasmid, only two pairs of nested primers need to be designed for the target gene to meet the detection requirements of high specificity and sensitivity, without the need to design cumbersome multiple primer pair amplification. In addition, by designing the structure of the exogenous DNA, its nonspecific amplification is reduced, thereby achieving the purpose of reducing false positives. The specific effects are described as follows:
[0033] 1. Reduce primer pairs and reduce design difficulty: The LAMP scheme requires the design of three pairs of primers when designing primers, and the position between the three pairs of primers, Tm value and compatibility with the stem-loop structure must also be considered. The process is relatively complicated and requires high design experience. The present invention does not need to design multiple pairs of primers. It is sufficient to design two or more pairs of similar nested amplification primer sets for the upstream and downstream of the target gene. The purpose of the primer set is not to complete the replacement and form a dumbbell-shaped structure like the primers of LAMP or CPA. It is basically equivalent to conventional amplification primers. It only needs to meet the following two requirements: (1) specific binding to the target gene sequence; (2) the sequence and the exogenous plasmid DNA sequence have no mismatch and cannot form a stable amplification structure, especially the several bases at the 3' end. The primer set in the present invention mainly plays the role of locating the target gene and carrying the probe. In the primer set, the outer bidirectional primers are anchored to the specific sites upstream and downstream of the target gene, and amplification begins under the action of DNA polymerase. The inner primers, however, anchor each strand of the double-stranded DNA and are located 3' downstream of primers A and B, respectively. The 3' end of the inner primer specifically binds to the target gene, while the 5' end carries the probe sequence. During subsequent amplification, the probe sequence is released only when both primers bind to the target gene; thus, specificity is higher than that of conventional qPCR. Furthermore, the introduction of the probe sequence into the inner primers facilitates the subsequent circularization of the endogenous and exogenous signals.
[0034] 2. High specificity and low false-positive rate: The 5' flap endonuclease of the Taq enzyme dissociates the probe portion of the inner primer pair from the target gene binding portion. The released probe portion can specifically bind to the exogenous plasmid, achieving signal conversion. Furthermore, due to the special design of the probe portion, the single-stranded probe released after enzyme cleavage is not amplified or extended, and cannot bind to the exogenous plasmid. Only after two different single-stranded probe portions complement each other and are extended can a sequence that recognizes the exogenous plasmid be obtained. This design prevents nonspecific recognition of the exogenous plasmid by the single-stranded probe, ensuring reaction specificity and reducing the probability of false positives.
[0035] 3. Simple design and scalable detection: By introducing an exogenous plasmid, the present invention reduces the difficulty and complexity of amplification primer design. For different detection sites, a pair of amplification primers and a pair of recognition primers are designed to convert endogenous signals into exogenous signals, achieving the purpose of site detection. The simple design can form a fixed system process, facilitating large-scale processing.
[0036] 4. Convenient to expand the scope of application: Based on the isothermal amplification scheme of exogenous plasmid recognition mediated by 5' flap endonuclease, targeted primers can be designed according to different analysis purposes to meet different qualitative and quantitative detection needs. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 LAMP method amplification flow chart;
[0038] Figure 2 CAP method amplification flow chart
[0039] Figure 3 C / D structure diagram
[0040] Figure 4 Flowchart of the present invention
[0041] Figure 5 Electrophoresis of Candida albicans amplification
[0042] Figure 6 Fluorescence signal of influenza A virus amplification DETAILED DESCRIPTION
[0043] Example 1 A method for detecting Candida albicans
[0044] 1. Design outer primer pairs for the Candida albicans specific region. The primer sequences are:
[0045] Candida albicans OF GATGAAGAACGCAGCGAAAT Candida albicans OR TAAGTTCAGCGGGTAGTCCT
[0046] Design inner primer pairs. The inner primer pair can be set as one pair, or multiple pairs can be set according to site specificity. This scheme designs one pair, and the primer sequences are:
[0047]
[0048] The underlined portions of the IF and IR are reverse complementary. The 5' and 5' italicized underlined sequences of the IF and IR serve as recognition probes. The 3' end of the IF and IR serves as the binding sequence for the target gene. The two bases at the 3' end are non-complementary to the target sequence to prevent sequence amplification.
[0049] 2. Sample extraction:
[0050] For the four samples A / B / C / D to be tested, the sample DNA is extracted according to conventional methods. A kit or a classic extraction method can be used. The method is not limited, as long as the sample DNA is obtained.
[0051] 3. Amplification:
[0052] ① Prepare the Taq enzyme reaction system according to the table below:
[0053]
[0054]
[0055] 65℃10-30min.
[0056] ②Add exogenous plasmid, 95℃5min, 60℃5min
[0057] ③Add the following reagents
[0058] Reagents Final concentration / volume μl Step ② product 20 μl Bst 2.0DNA Polymerase(10U / μl) 1 μl 10×Bst Buffer 5μl 100mM MgSO4 3 μl dNTP Mixture (10mM each) 6μl ddH2O Make up to 50 μl
[0059] 65℃ for 30-60min; inactivate at 85℃ for 5min.
[0060] 4. Identification:
[0061] Agarose electrophoresis detection:
[0062] Among them, NC represents negative control, M represents DNA ladder, and A / B / C / D represent four samples.
[0063] According to the test results, Figure 5 As shown, sample A was judged to be weakly positive, and sample B, C, and D were judged to be strongly positive, which was consistent with the results of the qPCR detection method.
[0064] Example 2 A method for detecting influenza A virus
[0065] 1. Design outer and inner primer pairs for the influenza A virus (hereinafter referred to as influenza A) region. The inner primer pair can be set to
[0066] It is one pair, and multiple pairs can be set according to site specificity. This scheme designs one pair, and the primer sequences are:
[0067]
[0068]
[0069] The underlined portions of the IF and IR are reverse complements. The 5'-end of the IF and IR are italicized, underlined sequences and the 5'-end of the IR are recognition probes. The 3'-end sequences of the IF and IR are binding sequences for the target gene. The two bases at the 3'-end are non-complementary to the target sequence to prevent sequence amplification.
[0070] 2. Sample extraction:
[0071] There are 4 samples in total, Sample 1-4. The sample RNA is extracted according to conventional methods. A kit or a classic extraction method can be used. There is no limitation on the method, as long as the purpose is to obtain the sample RNA.
[0072] At the same time, mNGS was sent for testing as a control.
[0073] 3. Amplification:
[0074] ① Reverse transcription
[0075] Reagents Final concentration / volume 10×One Step RNA PCR Buffer 1x dNTP (2.5 mM each) 0.2mM each RNase Inhibitor (40U / μL) 0.5 AMV RTase XL (5U / μL) 0.5 AMV-optimized Taq (5U / μL) 0.5 RNA template 10pg-1μg RNase-Free dH2O Add to 10μl Total volume 10 μl
[0076] 50℃ for 30 min, 94℃ for 2 min, and place on ice.
[0077] ② Prepare the Taq enzyme reaction system according to the table below:
[0078]
[0079]
[0080] 65℃10-30min.
[0081] ③Add exogenous plasmid, 95℃5min, 60℃5min
[0082] ④Add the following reagents
[0083] Reagents Final concentration / volume μl Step ② product 20 μl Bst 2.0DNA Polymerase(10U / μl) 1 μl 10×Bst Buffer 5μl 100mM MgSO4 3 μl dNTP Mixture (10mM each) 6μl SYBR Green I 6 μl ddH2O Make up to 50 μl
[0084] Place in a qPCR instrument and set the reaction conditions as follows: 65°C for 30 min; 85°C for 5 min for inactivation.
[0085] Fluorescence signals were collected throughout the whole process.
[0086] 4. Identification:
[0087] Check the results as Figure 6 As shown in the results, influenza A virus was detected in samples 4 and 1, but not in samples 2 and 3, which is consistent with the mNGS results.
Claims
1. A 5' flap nuclease-mediated isothermal amplification method utilizes the 5' flap endonuclease properties of Taq enzyme to release complementary aptamers; the aptamers complement each other and amplify to fill the gap; the single strand of the full-length aptamer melted can recognize the target region of the circular plasmid in the system, and isothermally amplified under the action of an isothermal amplification enzyme; the specific steps are as follows: Step A: Design primer set: a. Design primers for the target gene. The primers include two pairs: A / B and C / D. b. The A / B primers are bidirectional primers with a length of 10-60 nt. The A / B primer sequences have no recognition region with the exogenous plasmid; the amplicon length is not limited. c. The C / D is an inner bidirectional primer, the 5' end of the C / D primer is the probe PC / PD sequence respectively; the 3' end is the target gene anchor primer C 'and D '; C / D primer is greater than or equal to 1 pair; The 1-5 bases at the 3' end of the C' / D' are different from those of the target gene, thereby blocking the extension; The probe PC includes two sequences: the exogenous plasmid recognition sequence C1 and the adapter sequence 1; The probe PD includes two sequences, an exogenous plasmid recognition sequence D1 and an adapter sequence 2; The C1 and D1 are exogenous plasmid recognition sequences that recognize exogenous plasmid specific sequences. The length of the exogenous plasmid recognition sequence is 10-60 nt. Adaptor sequence 1 and adaptor sequence 2 are reverse complementary sequences, and their sequences have no recognition regions on the target gene and exogenous plasmid, and the sequence length is 10-60 nt; d. Exogenous plasmid selection: Select a suitable circular plasmid as the exogenous plasmid for isothermal amplification Step B: Target gene identification and probe replacement and extension to form exogenous plasmid recognition structure a. Obtain the DNA / RNA sample required for subsequent testing; b A / B primer pair recognizes the target gene site and binds to the target gene, and begins amplification under the action of Taq enzyme, which is a DNA polymerase with 5' flap endonuclease activity; c. The 3'-end C' and D' sequences of the C / D primer pair recognize the target gene locus, and the PC / PD sequences of the C / D primers are cleaved and released respectively; The C / D recognition region is located within the amplification range of the A / B primer pair, and the 5' side sequence of the C / D recognition region specifically binds to the target sequence; d. The 3' ends of the PC / PD sequences are complementary and extended and filled in by Taq enzyme to form a double-stranded DNA structure PCPD; Step C: Probe identification and isothermal amplification a. Double-stranded DNA structure PCPD double-strand denaturation recovery single-stranded PC / PD; b. PC / PD anneal and recognize and bind to specific sites of exogenous circular plasmids; c. Rolling circle amplification; d. Identify the amplification results.
2. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The length of the A / B primer is 18-24 nt, and the length of the amplicon is 100 bp-1 Kb.
3. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The A / B structure is modified with thiolation.
4. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The C' / D' recognition region is located within the amplification range of the A / B primer pair, and the primer length is 10-60 nt.
5. The 5' flap nuclease-mediated isothermal amplification method according to claim 4, characterized in that: The length of the C' / D' primer is 18-24 nt.
6. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The C' / D' primer sequence has no recognition region with the exogenous plasmid.
7. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The C' / D' is modified with thiolation to achieve the purpose of improving specificity and stabilizing the primer structure.
8. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The 2-3 bases at the 3' end of the C' / D' are different from those of the target gene.
9. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The C' / D' 3' end is modified by adding dideoxycytosine.
10. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The length of the exogenous plasmid recognition sequence is 16-40nt.
11. The 5' flap nuclease-mediated isothermal amplification method according to claim 10, characterized in that: The length of the exogenous plasmid recognition sequence is 18-24 nt.
12. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The length of the aptamer sequence 1 and the aptamer sequence 2 is 16-40 nt.
13. The 5' flap nuclease-mediated isothermal amplification method according to claim 12, characterized in that: The length of the aptamer sequence 1 and the aptamer sequence 2 is 18-24 nt.
14. The 5' flap nuclease-mediated isothermal amplification method according to claim 1, characterized in that: The final concentration of the TaqDNA polymerase was 1.25 U, and the final concentrations of the inner primer and the outer primer were both 0.8 μM.
Citation Information
Patent Citations
Exponential base-3 nucleic acid amplification with reduced amplification time using nested overlapping primers
CN113227398A
Snapback oligonucleotide probe
US20070020656A1