Preparation method of salt-tolerant yeast infusion powder, product and application thereof

Abstract

The application discloses a preparation method of salt-tolerant yeast powder, a product and application of the salt-tolerant yeast powder. The preparation method comprises the following steps: (1) yeast culture: fermenting and culturing yeast with a salt tolerance of not less than 5% NaCl to obtain concentrated yeast emulsion through centrifugation; (2) yeast autolysis: sequentially performing autolysis on the salt-tolerant yeast emulsion by using potassium chloride, magnesium chloride and a cell wall breaking enzyme; (3) yeast enzymolysis and inactivation: adding yeast extraction enzyme to the autolysed yeast solution after being heated, and inactivating the enzyme after the enzymolysis is completed; and (4) concentration and drying: uniformly mixing the inactivated solution with modified starch, and obtaining the salt-tolerant yeast powder through spray drying. The salt-tolerant yeast powder prepared by the method can significantly improve the salt tolerance, salt shock resistance and pollutant degradation efficiency of microorganisms under high-salt conditions, and can be widely applied to the fields of salt-tolerant microorganism culture and high-salt wastewater treatment.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a preparation method of salt-tolerant yeast extract powder, the product and application thereof. BACKGROUND

[0002] Yeast extract powder is widely used in food additive, biological fermentation and biological pharmaceutical industries due to its rich nutrients such as protein, free amino acid, nucleotide, vitamin and trace element. The yeast extract powder is generally prepared by using high-protein yeast as raw material, and the main process flow is as follows: yeast→propagation→harvesting and washing→enzymolysis (15-16 h, 40-50℃)→separation→vacuum concentration→filtration and clarification→re-concentration→drying→yeast extract powder. The process flow is relatively complicated, and the cost is high when the yeast extract powder is used in large-scale application fields such as wastewater treatment.

[0003] When the yeast extract powder is applied to microbial culture or wastewater treatment, it is mainly used for supplementing the insufficient nutrients required by microorganisms or wastewater treatment microorganisms. High-salt environment has toxic effects on normal metabolism of microorganisms in conventional biological treatment system, mainly including: high osmotic pressure, hindering microbial growth and even causing death; metabolic enzyme activity of microorganisms is blocked; water density increases, affecting sludge settling effect, etc. Therefore, the effect is not very ideal when the yeast extract powder is applied to microbial culture or wastewater biochemical treatment under high-salt conditions.

[0004] Chinese patent application 201110000983.5 discloses a high-quality yeast extract powder for biological culture medium and a preparation method thereof. The yeast is subjected to enzymolysis and inactivation, and then subjected to solid-liquid separation. The obtained supernatant is subjected to decolorization and impurity removal by using an ultrafiltration membrane, desalination, concentration, vacuum concentration, and then the denatured starch is added to obtain the powdery high-quality yeast extract powder. The denatured starch is mixed to obtain the ordinary yeast extract powder.

[0005] There is still no report on the preparation of yeast extract powder by using salt-tolerant yeast in the prior art, and there is also no report on the application of salt-tolerant yeast extract powder to microbial culture and wastewater treatment under high-salt conditions. SUMMARY

[0006] In view of the deficiencies in the prior art, a first object of the present application is to provide a preparation method of salt-tolerant yeast extract powder. The present application realizes the low-cost and efficient obtaining of yeast extract powder by optimizing the preparation method of yeast extract powder and combining the high-salt wastewater treatment environment.

[0007] A second object of the present application is to provide a salt-tolerant yeast extract powder product prepared by the above method.

[0008] A third object of the present application is to provide the application of the above salt-tolerant yeast extract powder.

[0009] The present application is accomplished by the following technical solutions:

[0010] In a first aspect, the present application claims a method for preparing a salt-tolerant yeast extract, the method comprising the following steps:

[0011] (1) Yeast culture: fermenting and culturing a yeast with a salt tolerance of not less than 5% NaCl;

[0012] Preferably, the culture medium for the fermenting and culturing of the salt-tolerant yeast comprises, per 1000 parts by mass: 3-7 parts of proteose peptone, 2-4 parts of yeast extract, 1-3 parts of KH2PO4, 1-5 parts of KCl, 1-2 parts of MgSO4, 1-2 parts of (NH4)2SO4, 10-60 parts of a carbon source, 5-20 parts of glycerol, 50-100 parts of NaCl, and the balance being tap water.

[0013] Preferably, the fermenting and culturing conditions are as follows: the initial inoculation concentration of the yeast is 1 g / L, the water temperature is 28-35°C, the pH is 3.0-5.0, and the dissolved oxygen is 0.2-0.5 mg / L; the fermenting and culturing time is 48-72 h, and the dissolved oxygen at the end of the culturing is 0.8-2.0 mg / L; and the obtained salt-tolerant yeast culture is filtered or centrifuged to obtain the yeast cell bodies.

[0014] (2) Yeast autolysis: the salt-tolerant yeast cell bodies collected in step (1) are mixed with a 4.5% NaCl solution at a weight ratio of 1:2 to form a yeast solution, the pH is adjusted to 6-7, and 1% potassium chloride, 0.5% magnesium chloride, and 0.1% cell wall-breaking enzyme (enzyme activity: 800,000 U / g) are sequentially added to the yeast solution, and the autolysis is performed at 45-55°C for 12-24 h.

[0015] (3) Yeast enzymolysis and inactivation: the autolyzed yeast solution obtained in step (2) is warmed to 50-60°C, 0.2-0.3% yeast extract enzyme is added to the autolyzed yeast solution, and the enzymolysis is performed for 12-20 h, after which the temperature is raised to 75-85°C, and the enzyme is inactivated by maintaining the temperature for 30-60 min.

[0016] (4) Concentration and drying: the inactivated solution obtained in step (3) is mixed with denatured starch at a weight ratio of 2:1, and the mixture is uniformly sprayed and dried to obtain the salt-tolerant yeast extract.

[0017] In specific embodiments of the present application, the salt-tolerant yeast is selected from one or more of Candida prachuapensis, Candida aaseri, Rhodotorula mucilaginosa, and Rhodosporidium sphaerocarpum.

[0018] Preferably, the salt-tolerant yeast (Candida prachuapensi) is Candida prachuapensi LH-Y.0003, which is preserved in the China General Microbiological Culture Collection Center, with the preservation number of CGMCC No. 19111, and the preservation date of December 9, 2019, and the preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing.

[0019] Preferably, the Candida aaseri is Candida aaseri LH-Y.0004, which is preserved in the China General Microbiological Culture Collection Center, with the preservation number of CGMCC No. 19112, the preservation date of December 9, 2019, and the preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing.

[0020] Preferably, the Rhodotorula mucilaginosa is Rhodotorula mucilaginosa LH-Y.0007, which is preserved in the China General Microbiological Culture Collection Center, with the preservation number of CGMCC No. 19113, the preservation date of December 9, 2019, and the preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing.

[0021] Preferably, the Rhodosporidium sphaerocarpum is Rhodosporidium sphaerocarpum LH-Y.0008, which is preserved in the China General Microbiological Culture Collection Center, with the preservation number of CGMCC No. 19114, the preservation date of December 9, 2019, and the preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing.

[0022] In a second aspect, the present application also protects the salt-tolerant yeast powder obtained by the above preparation method.

[0023] The salt-tolerant yeast powder of the present application can significantly improve the salt tolerance, salt shock resistance and pollutant degradation efficiency of microorganisms under high salt conditions.

[0024] In specific embodiments, the salt-tolerant yeast powder can be further optimized by adding betaine, molasses dry powder and potassium chloride in a mass ratio of 2:1:1:(1-4).

[0025] In a third aspect, the present application also protects the use of the above-mentioned salt-tolerant yeast powder in the culture of salt-tolerant or halophilic microorganisms.

[0026] In a fourth aspect, the present application also protects the use of the salt-tolerant yeast powder as described above in the treatment of high-salt wastewater.

[0027] In a specific embodiment, when the salt concentration of the high-salt wastewater is 1% to 3%, and the suitable dosage concentration of the salt-tolerant yeast powder is 20 to 50 mg / L.

[0028] In a specific embodiment, when the salt concentration of the high-salt wastewater is 4% to 12%, and the suitable dosage concentration of the salt-tolerant yeast powder is 60 to 180 mg / L.

[0029] In a specific embodiment, when the salt concentration of the high-salt wastewater is 13% to 17%, and the suitable dosage concentration of the salt-tolerant yeast powder is 200 to 300 mg / L.

[0030] In a specific embodiment, when the salt concentration of the high-salt wastewater is 18% to 25%, and the suitable dosage concentration of the salt-tolerant yeast powder is 400 to 1000 mg / L.

[0031] The present application has the beneficial technical effects:

[0032] The present application selects a salt-tolerant yeast with a salt tolerance of not less than 5% NaCl, and the salt-tolerant yeast is cultured under a salt concentration of 3% to 10% to obtain a salt-tolerant yeast cell, and then the salt-tolerant yeast cell is prepared into a salt-tolerant yeast powder through a process of yeast autolysis, enzymatic hydrolysis, inactivation, concentration, and drying.

[0033] The salt-tolerant yeast powder prepared by the method of the present application contains not only the nutritional components such as proteins, amino acids, peptides, polypeptides, nucleic acids, vitamins, and trace elements contained in ordinary yeast powder, but also antagonistic beneficial components that can improve the salt tolerance of microorganisms.

[0034] The salt-tolerant yeast powder prepared by the method of the present application can be applied to the treatment of high-salt wastewater with a salt concentration of 1% to 3%, 4% to 12%, 13% to 17%, or 18% to 25%, and can significantly improve the stability and salt concentration impact resistance of the treatment effect of high-salt wastewater.

[0035] Deposit Description 1

[0036] Strain name: salt-tolerant yeast;

[0037] Latin name: Candida prachuapensis;

[0038] Strain number: LH-Y.0003;

[0039] Preservation agency: China General Microbiological Culture Collection Center; abbreviation of preservation agency: CGMCC;

[0040] Address of collection: No. 3, Beichen West Road, Chaoyang District, Beijing; date of collection: December 9, 2019;

[0041] Accession number of collection center: CGMCC NO. 19111.

[0042] Deposit Description 2

[0043] Strain name: Candida aaseri;

[0044] Latin name: Candida aaseri;

[0045] Strain number: LH-Y.0004;

[0046] Collection agency: China General Microbiological Culture Collection Center; Abbreviation of collection agency: CGMCC;

[0047] Address of collection: No. 3, Beichen West Road, Chaoyang District, Beijing; date of collection: December 9, 2019;

[0048] Accession number of collection center: CGMCC NO. 19112.

[0049] Deposit Description 3

[0050] Strain name: Candida prachuapensis;

[0051] Latin name: Candida prachuapensis;

[0052] Strain number: LH-Y.0007;

[0053] Collection agency: China General Microbiological Culture Collection Center; Abbreviation of collection agency: CGMCC;

[0054] Address of collection: No. 3, Beichen West Road, Chaoyang District, Beijing; date of collection: December 9, 2019;

[0055] Accession number of collection center: CGMCC NO. 19113.

[0056] Deposit Description 4

[0057] Strain name: Rhodosporidium sphaerocarpum;

[0058] Latin name: Rhodosporidium sphaerocarpum;

[0059] Strain number: LH-Y.0008;

[0060] Preservation agency: China General Microbiological Culture Collection Center; preservation agency abbreviation: CGMCC;

[0061] Preservation address: No. 3, Beichen West Road, Huayou District, Beijing;

[0062] Preservation date: December 9, 2019;

[0063] Preservation center registration number: CGMCC NO. 19114. BRIEF DESCRIPTION OF DRAWINGS

[0064] Figure 1 is the preparation process flow chart of the salt-tolerant yeast powder of the present application;

[0065] Figure 2 is the microscopic morphology of the salt-tolerant yeast used for preparing the yeast powder of the present application;

[0066] Figure 3 is the phylogenetic tree of the strain Candida prachuapensis;

[0067] Figure 4 is the phylogenetic tree of the strain Candida aaseri;

[0068] Figure 5 is the phylogenetic tree of the strain Rhodosporidium sphaerocarpum;

[0069] Figure 6 is the phylogenetic tree of the strain Rhodotorula mucilaginosa. DETAILED DESCRIPTION

[0070] The technical solutions of the present application are described below in combination with the above figures and examples, but the scope of protection does not limit to the above.

[0071] As shown in the figure, Figure 1 A preparation method of a salt-tolerant yeast powder, the preparation method comprising the following steps:

[0072] (1) Yeast culture: select a yeast with a salt tolerance of not less than 5% NaCl for fermentation culture; the culture medium for fermentation culture of the salt-tolerant yeast comprises, by mass, 3-7 parts of proteose peptone, 2-4 parts of yeast powder, 1-3 parts of KH2PO4, 1-5 parts of KCl, 1-2 parts of MgSO4, 1-2 parts of (NH4)2SO4, 10-60 parts of carbon source, 5-20 parts of glycerol, 30-100 parts of NaCl, and the rest is tap water, per 1000 parts;

[0073] The fermentation culture conditions are that the initial inoculation concentration of the yeast is 1 g / L, the water temperature is 28-35℃, the pH is 3.0-5.0, and the dissolved oxygen is 0.2-0.5 mg / L; the fermentation culture time is 48-72 h, and the dissolved oxygen at the end of culture is 0.8-2.0 mg / L; and the obtained salt-tolerant yeast culture liquid is filtered or centrifuged to obtain concentrated yeast milk;

[0074] (2) Yeast autolysis: the salt-tolerant yeast milk collected in step (1) is mixed with 4.5% NaCl solution at a weight ratio of 1:2 to form a yeast solution, the pH is adjusted to 6-7, 1% potassium chloride, 0.5% magnesium chloride and 0.1% cell wall breaking enzyme (enzyme activity 800,000 U / g) are sequentially added to the yeast solution, and autolysis is carried out at 45-55℃ for 12-24 h;

[0075] (3) Yeast enzymolysis and inactivation: the autolysed yeast solution obtained in step (2) is heated to 50-60℃, 0.2-0.3% yeast extract enzyme is added to the autolysed yeast solution, and enzymolysis is carried out for 12-20 h, then the temperature is raised to 75-85℃, and the enzyme is inactivated by keeping the temperature for 30-60 min;

[0076] (4) Concentration and drying: the weight ratio of the inactivated solution dry weight obtained in step (3) to modified starch is 2:1, and the mixture is uniformly mixed and then spray-dried to obtain salt-tolerant yeast powder.

[0077] The application will be further described in detail in combination with examples, but the embodiments of the application are not limited thereto. In the following examples, if not otherwise specified, the methods are conventional methods.

[0078] Example 1: Isolation and preservation of salt-tolerant yeast

[0079] The sample of the bacterial source is derived from the sediment of the Yellow Sea in Lianyungang, and the mixed bacterial solution obtained by aeration enrichment culture with a composite carbon source under 5-15% salt conditions is inoculated and cultured after gradient dilution under 5-15% salinity, the plate is sealed and placed at 30-32℃ for 24-72 h, the growth of the bacterial colonies is observed, and the next gradient purification is carried out according to the growth. After repeated isolation and purification, a single strain is obtained, and morphological characteristics and 26S rDNA D1 / D2 region sequence analysis are carried out for identification.

[0080] The single colony strain is inoculated into fermentation medium, and cultured at 30°C and 160 r / min for 2 days. The strain with the largest growth amount and the highest trehalose content is selected to prepare yeast powder, including the salt-tolerant yeast Candida prachuapensis with the preservation number CGMCC NO. 19111, the salt-tolerant yeast Candida aaseri with the preservation number CGMCC NO. 19112, the salt-tolerant yeast Rhodotorula mucilaginosa with the preservation number CGMCC No. 19113, and the salt-tolerant yeast Rhodosporidium sphaerocarpum with the preservation number CGMCC No. 19114.

[0081] The Candida prachuapensis LH-Y.0003 26S rDNA sequence is as follows:

[0082] GCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCA

[0083] AAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATC

[0084] TTTGGGCCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCC

[0085] CGTGCGATGAGATGACCCAGGTCTATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGG

[0086] AATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGAT

[0087] AGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAG

[0088] TACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGTTC

[0089] CCTCGGGGGCGGCCTCTGCGTTTTACCGGGCCAGCATCAGTTTGGGCGGTAGGACAATC

[0090] GCGCGGGAACGTGGCACGGCCTCGGCTGTGTGTTATAGCCCGTGTGGATACTGCCAGCC

[0091] TAGACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTC

[0092] T; as shown in SEQ ID No: 1.

[0093] The Candida aaseri LH-Y.0004 26S rDNA sequence is as follows:

[0094] CAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAAT

[0095] CTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGTTTTGGCCTTTGT

[0096] CTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGACAAGGTGCCC

[0097] AATTCCATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGG

[0098] TGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTG

[0099] AAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAA

[0100] AGGGAAGGGCTTGAGGTCAGACTTGGTTTTACCAGGCCAGCATCAGTTTGGATGGCAG

[0101] GATAATAGCTAAGAAAAGTGGCACAGCTTCGGTTGTGTGTTATAGTCTTGGTTGATACTG

[0102] CCTGTCCAGACTGAGGACTGCGTCTTTGACTAGGATGCTGGCATAATGACCTTAAGCCG

[0103] CCCG; as shown in SEQ ID No: 2.

[0104] The 26S rDNA sequence of Rhodosporidium sphaerocarpum LH-Y.0008 is:

[0105] AGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCGCATAAGTCTGTTGGAATACAGCGGCACAGTGGTGAGACCCCCGTATGTGGTGCGGACGCCCAGCGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGGGCAACCGGTTTGCAGGCCAGCATCAGTTTTCCGGGGTGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTACTGGATACACCTTGGGGGACTGAGGAACGCAGTGTGCCTTACGGCGGAGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGACCCGTCTTGA; as shown in SEQ ID No: 4.

[0106] The 26S rDNA sequence of Rhodotorula mucilaginosa LH-Y.0007 is:

[0107] GCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCTGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGACCCGTCTTGAAACACGGACC; as set forth in SEQ ID No: 3.

[0108] Example 2: Preparation of salt-tolerant yeast infusion powder

[0109] (1) Yeast culture: the salt-tolerant yeast Candida prachuapensis LH-Y.0003 selected in Example 1 is subjected to fermentation culture; the culture medium is composed of 1000 parts by mass of the following components: peptone 5 parts, yeast extract 4 parts, KH2PO4 2 parts, KCl 5 parts, MgSO4 1 part, (NH4)2SO4 2 parts, glucose carbon source 10 parts, glycerol 5 parts, NaCl 60 parts, and tap water; the fermentation culture conditions are as follows: the initial inoculation concentration of the yeast is 1 g / L, the water temperature is 28-35°C, the pH is 3.0-5.0, and the dissolved oxygen is 0.2-0.5 mg / L; the fermentation culture time is 72 h, and the dissolved oxygen at the end of the culture is 1.5-2.0 mg / L; the yeast wet weight reaches 150 g / L (under salt conditions, the supernatant is discarded after three washing and centrifugation steps to remove the salt for measurement) to achieve mature fermentation culture, and the obtained salt-tolerant yeast culture is filtered or centrifuged to obtain concentrated yeast milk;

[0110] (2) Yeast autolysis: the salt-tolerant yeast milk collected in step (1) is mixed with a 4.5% NaCl solution at a weight ratio of 1:2 to form a yeast solution, the pH is adjusted to 7, and 1% potassium chloride, 0.5% magnesium chloride, and 0.1% cell wall breaking enzyme (enzyme activity 800,000 U / g) are sequentially added to the yeast solution, and the autolysis is carried out at 45-55°C for 24 h;

[0111] (3) Yeast enzyme hydrolysis and inactivation: the autolysed yeast solution obtained in step (2) is heated to 50-60°C, 0.2% yeast extract enzyme is added to the autolysed yeast solution, and enzyme hydrolysis is carried out at 50-60°C for 12 h, then the temperature is raised to 75-85°C, and the enzyme is inactivated by keeping the temperature for 30-60 min;

[0112] (4) Concentration and drying: the inactivated solution obtained in step (3) is mixed with denatured starch at a weight ratio of 2:1, and then spray-dried to obtain salt-tolerant yeast extract powder.

[0113] Example 3: Preparation of salt-tolerant yeast extract powder

[0114] (1)Yeast culture: select the salt-tolerant yeast Rhodosporidium sphaerocarpum LH-Y.0008 screened in Example 1 to carry out fermentation culture; the culture medium for the fermentation culture of the salt-tolerant yeast has the following components by mass per 1000 parts: 6 parts of proteose peptone, 4 parts of yeast extract powder, 2 parts of KH2PO4, 5 parts of KCl, 2 parts of MgSO4, 2 parts of (NH4)2SO4, 60 parts of glucose, 20 parts of glycerol, 100 parts of NaCl, and the rest is tap water; the initial inoculation concentration of the yeast is 1 g / L, the water temperature is 32℃, the pH is 3.0-5.0, and the dissolved oxygen is 0.2-0.5 mg / L; the fermentation culture time is 48-72 h, and the dissolved oxygen at the end of the culture is 0.8-2.0 mg / L; the yeast wet weight reaches 150 g / L (under salt conditions, the supernatant is discarded after three washing centrifugations to remove the salt for determination) to reach the maturity of the fermentation culture, and the obtained salt-tolerant yeast culture is filtered or centrifuged to obtain a concentrated yeast milk;

[0115] (2) Yeast autolysis: the salt-tolerant yeast milk collected in step (1) is mixed with a 4.5% NaCl solution at a weight ratio of 1:2 to form a yeast solution, the pH is adjusted to 6-7, 2% of potassium chloride, 0.5% of magnesium chloride and 0.1% of a cell wall breaking enzyme (enzyme activity 800,000 U / g) are sequentially added to the yeast solution, and autolysis is carried out at 45-55℃ for 24 h;

[0116] (3) Yeast enzymolysis and inactivation: the autolysed yeast solution obtained in step (2) is warmed to 50-60℃, 0.3% of a yeast extract enzyme is added to the autolysed yeast solution, and enzymolysis is carried out for 24 h, then the temperature is raised to 75-85℃, and the enzyme is inactivated by keeping the temperature for 30-60 min;

[0117] The main index analysis results of the salt-tolerant yeast extract powder prepared in the example of the present application are as follows in Table 1:

[0118] Table 1 Indexes of yeast extract powder (%)

[0119] Test Items Color State Total Nitrogen Amino Acids Trehalose a-Amino Nitrogen Ash Example 2 Light yellow Powdered 11.8 6.5 18 2.5 5.2 Example 3 Light yellow Powdered 11.7 6.6 19.5 2.4 6.4

[0120] Example 4: Salt-tolerant yeast extract powder salt-tolerant test

[0121] The salt-tolerant yeast extract powder prepared in Example 2 and the ordinary yeast extract powder (Angel yeast extract powder purchased on the market) are taken, 1%, 3%, 5%, 8%, 10%, 15% and 20% NaCl solutions are respectively prepared in test tubes, 2% of the salt-tolerant yeast extract powder is added to each test tube, and after being fully stirred and dissolved, the experimental samples are prepared, and after being placed at room temperature for 48 h, the clarity of the solution is observed, and the situation in the test tube is judged.

[0122] Table 2 Clarity evaluation of salt-tolerant yeast extract powder in high-salt solution

[0123]

[0124] After 48h of standing, the salt-tolerant yeast extract powder added 2% in 1%-20% salt solution did not produce any precipitation or turbidity phenomenon, the solution was clear and transparent, indicating that compared with ordinary yeast extract powder, the salt-tolerant yeast extract powder prepared by the method of the application had significantly better solubility under high salt conditions.

[0125] Example 5:

[0126] The salt-tolerant yeast extract powder prepared in Example 2 and ordinary yeast extract powder (purchased Angel yeast extract powder) were respectively prepared into 2 bottles of NaCl solution with salinity of 1%, 3%, 5%, 8%, 10%, 15%, and then 1 mL of salt-tolerant nitrifying activated sludge and 50 mg / L of ammonia nitrogen were added; 1 g of salt-tolerant yeast extract powder was added to 1 bottle in each salinity, and 1 bottle of Angel yeast extract powder was added. Culturing was carried out on a constant temperature shaker, with temperature of 30-35℃, and shaking speed of 120 ppm; samples were taken at 24h and 48h to measure the concentration of NH3-N in the triangular flask. The test results are as shown in Table 3:

[0127] Table 3: Effluent NH3-N concentration of salt-tolerant yeast extract powder under different salinity (unit: mg / L)

[0128]

[0129] As can be seen from Table 3, high-salt denitrification under ≤5% salinity, denitrifying bacteria can still have obvious denitrification effect, but when the salinity exceeds 5%, it is obviously inhibited, but adding salt-tolerant yeast extract powder to the high-salt denitrification system above 3% can significantly improve the salt-tolerance of denitrifying bacteria, thereby improving the denitrification capacity of the system. It shows that the salt-tolerant yeast extract powder has a significant stress-resistant synergistic effect on denitrifying bacteria.

[0130] Example 6:

[0131] The salt-tolerant yeast extract powder prepared in Example 2 was added to the salt-tolerant nitrification experiment group of Example 5 in an amount of 50 mg / L, 100 mg / L, 150 mg / L, 200 mg / L, and 250 mg / L. The denitrification medium had a COD of 300 mg / L, NH3-N of 100 mg / L, NaCl of 6%, and a buffer was added to make the pH 7.5-8.9, and the temperature was set to 30℃, and the culture was carried out on a shaker with a rotation speed of 120 rpm. Control group and 5 experimental groups were set. The effect of different concentrations of 10% salinity yeast extract powder on the removal of NH3-N was investigated, and the test results are shown in Table 4:

[0132] Table 4: Effect of 10% salinity yeast extract powder on NH3-N removal rate (%)

[0133]

[0134] As shown in Table 4, under the condition of 10% salinity, the addition of the salt-tolerant yeast extract powder and the common yeast extract powder both promote the removal of NH3-N, and the higher the concentration of the yeast extract powder, the higher the removal rate of NH3-N; compared with the common yeast extract powder, the salt-tolerant yeast extract powder has a more significant promotion effect on the removal rate of NH3-N at the same concentration of the yeast extract powder.

[0135] Example 7

[0136] (1) Culture medium: acetic acid 2000 mg / L, salt-tolerant yeast extract powder of Example 2 50 mg / L, NO3-N 50 mg / L, NaCl concentration 1% to 15%, and buffer is added to make pH 7.5 to 8.0.

[0137] (2) Test design: the denitrification of NO3-N is carried out in a 500 mL triangular flask, 300 mL of culture medium is added, five salinity gradients are set, the salt content is 1%, 5%, 8%, 10%, 15%, and a blank group without salt and a common yeast extract powder (purchased Angel yeast extract powder) control test are set.

[0138] (3) Denitrification test: culture is carried out on a constant temperature shaker, the temperature is 30 to 35°C, the shaking speed is 10 ppm, and the NO3-N concentration in the triangular flask is determined after 24 h and 48 h. The test results are as follows:

[0139] Table 5 NO3-N concentration (unit: mg / L) of effluent of denitrification under different salt concentrations with the addition of salt-tolerant yeast extract powder

[0140]

[0141]

[0142] As shown in Table 5, with the increase of salinity, the NO3-N concentration of the effluent at 24 h and 48 h is increased, which indicates that the inhibition of the increase of salinity on denitrification is enhanced; when the salinity is more than 5%, the NO3-N concentration of the effluent with the addition of the salt-tolerant yeast extract powder is lower, which indicates that the salt-tolerant yeast extract powder can improve the salt-tolerant degradation ability of the denitrification bacteria agent to NO3-N under the condition of higher salinity.

[0143] Example 8

[0144] (1) Culture medium: acetic acid 2000 mg / L, salt-tolerant yeast extract powder of Example 2 50 mg / L, NO2-N 50 mg / L, NaCl concentration 1% to 15%, and buffer is added to make pH 7.5 to 8.0.

[0145] (2) Test design: the denitrification NO2-N test is carried out in 500 mL triangular bottles, 300 mL of culture medium is added into each triangular bottle, 5 salinity gradients are set, the salt content is 1%, 5%, 8%, 10%, 15% respectively, in addition, a blank group without salt and a common yeast powder control test are set.

[0146] (3) Denitrification test: the culture is carried out on a constant temperature shaker, the temperature is 30-35 DEG C, the shaking speed is 10 ppm respectively, the concentration of NO2-N in the triangular bottle is determined after 24 h and 48 h respectively.

[0147] Table 6 Test results of denitrification removal of NO2-N under different salt concentrations (unit: mg / L)

[0148]

[0149] As shown in Table 6, with the increase of salinity, the NO2-N concentration of effluent water at 24 h and 48 h is increased, which indicates that the inhibitory effect of the increase of salinity on the denitrification removal of NO2-N is enhanced; the addition of salt-tolerant yeast powder and common yeast powder promotes the degradation of NO2-N under high salinity conditions, when the salinity is less than or equal to 5%, the promotion effect of the salt-tolerant yeast powder and the common yeast powder on the degradation of NO2-N is not much different, when the salinity is increased to 8%, 10% and 15%, the NO2-N of the effluent water of the test group of the salt-tolerant yeast powder is lower, which indicates that the salt-tolerant yeast powder has a more significant improvement effect on the salt tolerance and salt degradation capacity of denitrifying bacteria under the condition that the salinity is higher than 5%.

[0150] The protection content of the present application is not limited to the above embodiments. Changes and advantages that can be thought of by those skilled in the art without departing from the spirit and scope of the present application are included in the present application, and the appended claims are protected.

Claims

1. A method for preparing a salt-tolerant yeast extract powder, characterized by, The method comprises the following steps: (1) yeast culture: fermenting and culturing yeast with salt tolerance of not less than 5% NaCl; (2) yeast autolysis: mixing the yeast cells collected in step (1) with 4.5% NaCl solution at a weight ratio of 1:2 to form a yeast solution, adjusting the pH to 6-7, and then adding potassium chloride, magnesium chloride and cell wall breaking enzyme accounting for 1%, 0.5% and 0.1% of the weight of the yeast solution respectively, and autolyzing at 45-55℃ for 12-24h; (3) yeast enzymolysis and inactivation: heating the autolyzed yeast solution obtained in step (2) to 50-60℃, adding yeast extract enzyme accounting for 0.2-0.3% of the mass of the autolyzed yeast solution, and then enzymolyzing for 12-20h, and then heating to 75-85℃ to inactivate the enzyme for 30-60min; (4) concentration and drying: mixing the inactivated solution in step (3) with denatured starch at a weight ratio of 2:1, and then spray drying to obtain salt-tolerant yeast powder. The salt-tolerant yeast is a salt-tolerant yeast (Saccharomyces cerevisiae) Candida prachuapensi ) LH-Y.0003 ， Preserved in China General Microbiological Culture Collection Center, preservation number is CGMCC NO. 19111, preservation date is December 9, 2019, and preservation address is No. 1, Xibanchengli, Beijing City, Chaoyang District, No.

3.

2. The process for the preparation of salt tolerant yeast infusion powder as claimed in claim 1, wherein, The culture medium for the fermentation culture of the salt-tolerant yeast comprises, per 1000 parts by mass: 3-7 parts of proteose peptone, 2-4 parts of yeast extract powder, 1-3 parts of KH2PO4, 1-5 parts of KCl, 1-2 parts of MgSO4, 1-2 parts of (NH4)2SO4, 10-60 parts of carbon source, 5-20 parts of glycerol, 50-100 parts of NaCl, and the rest is tap water.

3. The process for the preparation of salt tolerant yeast infusion powder as claimed in claim 1, wherein, The fermentation culture conditions are as follows: the initial inoculation concentration of the yeast is 1g / L, the water temperature is 28-35℃, the pH is 3.0-5.0, and the dissolved oxygen is 0.2-0.5mg / L; the fermentation culture time is 48-72h, and the dissolved oxygen at the end of the culture is 0.8-2.0mg / L; and the obtained salt-tolerant yeast culture solution is filtered or centrifuged to obtain the yeast cells.

4. The salt-tolerant yeast powder prepared by the method of any one of claims 1-3, wherein betaine, molasses dry powder and potassium chloride are added to the salt-tolerant yeast powder, and the mass ratio of the salt-tolerant yeast powder, betaine, molasses dry powder and potassium chloride is 2:1:1:1-4.

5. The salt-tolerant yeast powder according to claim 4 for use in the treatment of high-salt wastewater.

6. Use according to claim 5, characterized in that, When the salt concentration of the high-salt wastewater is 1%-3%, the dosage of the salt-tolerant yeast powder is 20-50mg / L.

7. Use according to claim 5, characterized in that, When the salt concentration of the high-salt wastewater is 4%-12%, the dosage of the salt-tolerant yeast powder is 60-180mg / L.

8. Use according to claim 5, characterized in that, When the salt concentration of the high-salt wastewater is 13%-17%, the dosage of the salt-tolerant yeast powder is 200-300mg / L.

Images