A phytosphingosine-producing yeast strain

Abstract

The invention provides a saccharomyces cerevisiae strain with high phytosphingosine production. On the basis of the saccharomyces cerevisiae strain with high phytosphingosine production, the invention constructs an engineering saccharomyces cerevisiae strain for efficiently synthesizing phytosphingosine, reduces the expression of proteins encoded by LCB4, SHM2, CHA1, ORM2, ELO3 and SHM1 genes, and increases the expression of proteins encoded by TSC10, SYR2 and LCB2 genes by using a constitutive promoter, and the phytosphingosine shake flask amount reaches 9.52 mg / g dry weight, and then increases the expression of proteins encoded by the HAC1 gene by using a constitutive promoter, and the phytosphingosine shake flask amount is further increased by 4.34 times to 41.33 mg / g dry weight, and the phytosphingosine production reaches the highest production of shake flask fermentation reported so far. The production of phytosphingosine produced by fermentation in a 5L fermenter reaches 150.54 mg / g dry weight, and the titer is 2817 mg / L.

Description

(I) Technical field

[0001] The present invention relates to a method for increasing the yield of phytosphingosine in brewer's yeast. Phytosphingosine is widely used in industry as a component of medicines, cosmetics and the like. (II) Background technology

[0002] Saccharomyces cerevisiae has the advantages of easy genetic manipulation, high biosafety and stable fermentation, and is a widely used biological cell factory. Phytosphingosine is a sphingosine compound. It is not only the simplest sphingolipid compound, but also the backbone (long-chain base part) of other sphingolipid compounds, and is the characteristic structure of sphingolipid compounds. When used in cosmetics, phytosphingosine can not only improve the skin permeability function of double-chain multi-lipid layer cells located in the human body and other skin tissues, but also directly form a hydrophilic barrier on the hydrophilic layer, which plays an important role in protecting the human body and retaining water in the skin.

[0003] At present, the main ways to obtain sphingolipids are synthesis and microbial fermentation. The ceramide content of konjac in plants is more than ten times that of other plants. However, the plant extraction method is limited by the growth cycle and season of plants, and the yield is low. In animals, it comes from the brain of animals with pathogenic risks, so it cannot be used in cosmetics. The chemical synthesis is mainly pseudoceramide, which has a similar structure and function to ceramide and can be used in cosmetics. At present, a variety of pseudoceramides have been successfully synthesized. AmorePacific has currently produced a new type of pseudoceramide, which improves its solubility and stability. Its technical route is to dissolve trishydroxymethylaminomethane in dimethyl formaldehyde (DMF), then dissolve in triethylamine (Et3N), add palmitoyl chloride after 30 minutes, and then introduce fatty acids through a series of reactions. However, because the plant sphingosine used in cosmetics is mainly extracted from animals and plants. Obviously, it is a very costly method at the industrial level. The chemical synthesis method is difficult to achieve industrial production due to its shortcomings such as cumbersome steps, more by-products, and low synthesis rate. The biological fermentation method has fewer external interference factors, can be mass-produced and reduce the price of phytosphingosine, which is more conducive to its widespread application in products.

[0004] Microbial fermentation is a commonly used method for preparing ceramide in recent years, that is, using Pichia yeast (Pichiaciferrii) or Saccharomyces cerevisiae to ferment under certain conditions to obtain tetraacetyl phytosphingosine (Schorsch, et al. (2012) Metabolic Engineering. 14 (2) 172-184) and then deacetylate it to obtain phytosphingosine (Kim, et al. (2010) Journal of Microbiology and Biotechnology. 20 (2) 356-62). Markus Schwab et al. synthesized phytosphingosine in Saccharomyces cerevisiae, and the shake flask yield reached 70 mg / L (US2018-0179562).

[0005] The present invention takes the synthesis of phytosphingosine in yeast engineering bacteria as an example, transforms the metabolic pathway of sphingolipids, and innovatively finds that enhancing the transcription factor HAC1 can significantly increase the phytosphingosine production of yeast by 434%, providing a simple and effective method for increasing the production of yeast sphingolipids. (III) Summary of the invention

[0006] The purpose of the present invention is to provide a method for increasing the production of phytosphingosine in brewer's yeast. According to the known metabolic pathway for producing phytosphingosine, the gene of the product of the branch metabolic pathway is knocked out, and a strong promoter is fused to the target site of the knocked-out gene to enhance the gene expression of the target product, and the coding gene of the transcription factor HAC1 is highly expressed, so as to further improve the synthesis of yeast phytosphingosine.

[0007] The specific technical solution adopted by the present invention is:

[0008] In a first aspect, the present invention provides a phytosphingosine-producing Saccharomyces cerevisiae strain, wherein the phytosphingosine-producing Saccharomyces cerevisiae strain is obtained by using Saccharomyces cerevisiae CEN.PK2-1D as a starting strain and performing the following transformations: knocking out the LCB4 (sphingosine base kinase) gene, the SHM2 (serine hydroxymethyltransferase) gene and the CHA1 (L-serine deaminase) gene, inserting an expression cassette of the 3-dehydrodihydrosphingosine reductase (TSC10) gene into the ORM2 (membrane protein regulating the activity of serine palmitoyltransferase) gene site, inserting an expression cassette of the sphingosine hydroxylase (SYR2) gene into the ELO3 (fatty acid elongase III) gene site, inserting an expression cassette of the serine palmitoyltransferase (LCB2) gene into the SHM1 (serine hydroxymethyltransferase) gene site, and inserting an expression cassette of the transcription factor HAC1 gene into the delta 22 site of the phytosphingosine-producing Saccharomyces cerevisiae strain PT06, to obtain the phytosphingosine-producing Saccharomyces cerevisiae strain.

[0009] In one embodiment of the present invention, the expression cassette of the 3-dehydrosphingosine reductase (TSC10) gene comprises a TDH3 promoter and a 3-dehydrosphingosine reductase (TSC10) gene, and the nucleotide sequence of the TDH3 promoter is shown in SEQ ID NO:1.

[0010] Furthermore, the nucleotide sequence of the 3-dehydrosphingosine reductase (TSC10) gene is shown in SEQ ID NO:3.

[0011] In one embodiment of the present invention, the expression cassette of the sphingosine hydroxylase (SYR2) gene comprises a TDH3 promoter and a sphingosine hydroxylase (SYR2) gene, and the nucleotide sequence of the TDH3 promoter is shown in SEQ ID NO:1.

[0012] Furthermore, the nucleotide sequence of the sphingosine hydroxylase (SYR2) gene is shown in SEQ ID NO:4.

[0013] In one embodiment of the present invention, the expression cassette of the serine palmitoyltransferase (LCB2) gene comprises a TDH3 promoter and a serine palmitoyltransferase (LCB2) gene, and the nucleotide sequence of the TDH3 promoter is shown in SEQ ID NO:1.

[0014] Furthermore, the nucleotide sequence of the serine palmitoyltransferase (LCB2) gene is shown in SEQ ID NO:5.

[0015] In one embodiment of the present invention, the expression cassette of the transcription factor HAC1 gene comprises a TDH3 promoter and a transcription factor HAC1 gene, and the nucleotide sequence of the TDH3 promoter is shown in SEQ ID NO:1.

[0016] Furthermore, the nucleotide sequence of the transcription factor HAC1 gene is shown in SEQ ID NO:6.

[0017] Further, the transformation is completed by CRISPR-Cas9 yeast genome editing method. Using the gRNA expression cassette, homologous recombination occurs in yeast with another complete starting vector transformed at the same time, after knocking out the LCB4 (sphingosine base kinase) gene, SHM2 (serine hydroxymethyltransferase) gene, and CHA1 (L-serine deaminase) gene, the TSC10 (3-dehydrodihydrosphingosine reductase) gene driven by the strong promoter TDH3 is inserted into the ORM2 (membrane protein with serine palmitoyltransferase activity) gene site; the SYR2 (sphingosine hydroxylase) gene driven by the strong promoter TDH3 is inserted into the ELO3 (fatty acid elongase III) gene site; the LCB2 (serine palmitoyltransferase) gene driven by the strong promoter TDH3 is inserted into the SHM1 (serine hydroxymethyltransferase) gene site, and the HAC1 gene is highly expressed using the strong promoter TDH3 at the dleta 22 site of the genome, and the phytosphingosine production is significantly improved.

[0018] Furthermore, the gRNA expression cassette is composed of an upstream homology arm, a target sequence, a gRNA Scaffold fragment and a downstream homology arm in sequence; the upstream homology arm and the downstream homology arm have more than 60bp of identical sequences with the starting vector respectively; the target sequence is a 20bp target sequence designed based on the target site gene on the Saccharomyces cerevisiae genome using the chopchop website.

[0019] Furthermore, there are 7 gRNA target expression boxes.

[0020] Furthermore, the nucleotide sequence of the gRNA Scaffold fragment is shown in SEQ ID NO: 2.

[0021] Furthermore, the target sites include LCB4, SHM2, CHA1, ORM2, ELO3, SHM1, and delta22.

[0022] The target sequence of the target site LCB4 is: TTATAGAAGACCCGACAGAG;

[0023] The target sequence of the target site SHM2 is: GGTCTATACCTACCAGATGG;

[0024] The target sequence of the target site CHA1 is: GTAGATAAAATCAGGAACAC;

[0025] The target sequence of target site ORM2 is: TCCCAACATGAACGCTACGT;

[0026] The target sequence of target site ELO3 is: ATCCAATCTTACAAGAAAGG;

[0027] The target sequence of the target site SHM1 is: TACTCCGCTATCATGAACGT;

[0028] The target sequence of target site delta22 is: TGTTAATTCCTACATACTCG.

[0029] The Saccharomyces cerevisiae gene editing method is to knock out three target sites of phytosphingosine metabolism-related genes LCB4, SHM2, and CHA1, and simultaneously insert ORM2, ELO3, and SHM1 into three target sites of TSC10, SYR2, and LCB2 encoding genes in the Saccharomyces cerevisiae genome, thereby gradually enhancing the phytosphingosine synthesis pathway.

[0030] Further, the method is: first, gRNA expression boxes of target sites LCB4, SHM2, CHA1, ORM2, ELO3, SHM1, and delta22 are constructed respectively, together with the starting vector and donor DNA fragment, and the unmodified Cas9 plasmid is transformed at the same time.

[0031] Furthermore, the starting vector is p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene company #43803), referred to as p426 vector.

[0032] The overexpression of the HAC1 gene is performed as follows: inserting the HAC1 gene driven by the promoter TDH3 into the genomic delta 22 site.

[0033] In addition, the present invention also provides a use of the above-mentioned phytosphingosine-producing Saccharomyces cerevisiae strain in fermentation to prepare phytosphingosine.

[0034] The fermentation conditions are: temperature 30°C, time 48-120h (preferably 96h-120h, rotation speed 200rpm.

[0035] Furthermore, the fermentation is carried out in a YPD liquid culture medium, which consists of the following components in the following concentrations: 10 g / L yeast powder, 20 g / L peptone, and 20 g / L glucose, the solvent is deionized water, and the pH is natural.

[0036] The brewer's yeast is yeast CEN.PK2-1D (EUROSCARF, Germany).

[0037] In addition, the fermentation can also be carried out using a fermenter.

[0038] In order to increase the yield of phytosphingosine, the present invention firstly selects the cerevisiae yeast strain CEN.PK2-1D which produces the most phytosphingosine as the original strain.

[0039] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in that: on the basis of the phytosphingosine-producing saccharomyces cerevisiae, the present invention constructs an engineering strain of saccharomyces cerevisiae for efficiently synthesizing phytosphingosine, reduces the expression of proteins encoded by LCB4, SHM2, CHA1, ORM2, ELO3, and SHM1 genes, and uses a constitutive promoter to increase the expression of proteins encoded by TSC10, SYR2, and LCB2 genes, and the phytosphingosine shake flask amount reaches 9.52 mg / g dry weight, and then increases the expression of proteins encoded by the HAC1 gene by a constitutive promoter, and the phytosphingosine shake flask amount is further increased by 4.34 times to 41.33 mg / g dry weight, and the phytosphingosine yield reaches the highest yield of shake flask fermentation reported so far. The yield of phytosphingosine produced by fermentation in a 5L fermenter reaches 150.54 mg / g dry weight, and the titer is 2817 mg / L. (IV) Description of the drawings

[0040] Figure 1 Pathway for the biosynthesis of phytosphingosine in Saccharomyces cerevisiae.

[0041] Figure 2 The phytosphingosine production of the starting strain CEN.PK2-1D and different metabolically modified strains after 96 hours of fermentation in YPD medium.

[0042] Figure 3 The phytosphingosine production of yeast strains PT06 and PT07 after fermentation in YPD medium for 96 hours.

[0043] Figure 4 The yield of phytosphingosine fermented by yeast strain PT07 in a 5L fermenter. (V) Specific implementation methods

[0044] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution of the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the described embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. Unless otherwise defined, the technical terms or scientific terms used in this patent disclosure should be the common meaning understood by people with general skills in the field to which the present invention belongs.

[0045] The YPD liquid culture medium in the embodiment consists of 10 g / L yeast powder, 20 g / L peptone, and 20 g / L glucose, the solvent is deionized water, and the pH is natural.

[0046] The SGD ID numbers of the nucleotide sequences of the target sites and target sequences in the embodiments of the present invention are provided by https: / / yeastgenome.org:

[0047] The SGD ID of the nucleotide sequence of LCB4 is S000005697.

[0048] The SGD ID of the nucleotide sequence of SHM2 is S000004048.

[0049] The SGD ID of the nucleotide sequence of CHA1 is S000000569.

[0050] The SGD ID of the nucleotide sequence of ORM2 is S000004342.

[0051] The SGD ID of the nucleotide sequence of ELO3 is S000004342.

[0052] The SGD ID of the nucleotide sequence of SHM1 is S000000467.

[0053] The SGD ID of the nucleotide sequence of delta22 is S000007175.

[0054] The nucleotide sequence of TSC10 is shown in SEQ ID NO:3.

[0055] The nucleotide sequence of SYR2 is shown in SEQ ID NO:4.

[0056] The nucleotide sequence of LCB2 is shown in SEQ ID NO:5.

[0057] The nucleotide sequence of HAC1 is shown in SEQ ID NO:6.

[0058] Example 1 Construction of a phytosphingosine-producing Saccharomyces cerevisiae strain

[0059] like Figure 1 As shown, according to the biosynthesis pathway of phytosphingosine in Saccharomyces cerevisiae, the activity of proteins encoded by related genes is reduced or enhanced.

[0060] (1) Genes and sources

[0061] The related genes and homologous arm fragments encoded by the metabolic pathways used in strain construction were amplified from the genomic DNA of yeast CEN.PK2-1D (EUROSCARF, Germany) unless otherwise specified. At the same time, all gene sequences in the strain construction process were obtained by querying the Saccharomyces cerevisiae genome database (www.yeastgenome.org).

[0062] (2) Strain construction

[0063] Construction of strain PT01:

[0064] The target sequence was designed using the chopchop website according to the target site LCB4 gene (Saccharomyces Genome Database YOR171C), and the target sequence is as follows:

[0065] LCB4 target sequence: TTATAGAAGACCCGACAGAG.

[0066] Using Addgene's commercial plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t as a template, primers P1 / P2 were used to amplify the p426 vector fragment, which contained a 20bp target sequence at the LCB4 site. The p426 vector fragment was then transformed into the competent E. coli DH5α. Positive transformants were selected and colony PCR was performed using primers P3 / P4 to verify the strain, which was recorded as p426-gRNA-LCB4. The plasmid was then extracted and stored at -20°C for subsequent integration of the yeast CRISPR-Cas9 system into the LCB4 site and transformation of the target gene.

[0067] Using Saccharomyces cerevisiae CEN.PK2-1D as the host bacteria and the genome of Saccharomyces cerevisiae CEN.PK2-1D as the template, i.e., the template listed in Table 2, primers P5 / P6 were used to amplify the upstream homology arm of the integration site LCB4 (SEQ ID NO: 7, fragment 1), and P7 / P8 was used to amplify the downstream homology arm of the integration site LCB4 (SEQ ID NO: 8, fragment 2). The DNA splicing method was based on the method of the literature (Modular pathway engineering of diterpenoid synthases and the mevalonic acid pathway for miltiradiene production, J. Am. Chem. Soc. (2012) 134: 3234-3241), and overlap extension PCR was used to splice these DNA fragments into long fragments with overlapping regions. The fragments obtained after PCR need to be recovered by DNA agarose gel (operated according to the instructions of the corresponding kit), and the overlap extension PCR method can be used for fragment connection after quantification. Fragment 1 and fragment 2 are fused using primers P5 / P8 using overlap extension PCR to obtain fragment 3. According to the DNA assembly method in the literature (DNAassembler, an in vivo genetic method for rapid construction of biochemical pathways, Nucleic. Acid.s Res. (2009) 37: 16), the fragment 3 and p426-gRNA-LCB4 plasmid with homology arms and overlapping regions were integrated into the Saccharomyces cerevisiae CEN.PK2-1D genome by lithium acetate chemical transformation (Gietz et al. Method. Enzymol. 2002, 350, 87-96). After 3 days of yeast transformation and culture, 10 colonies were selected from the plate and inoculated into a 1.5mL EP tube containing 1mL YPD medium and cultured for 8h. 1μL was taken into a 1.5mL EP tube containing 30μL of freshly prepared 20mM NaOH, and the tube was vortexed for 10s after boiling water bath for 10min, and immediately placed in liquid nitrogen for freezing. The operation was repeated three times to obtain the template. Colony PCR was performed using verification primers P9 / P10 to screen positive transformants.The positive transformants were cultured in 5 mL YPD liquid medium at 30 ° C in a shaker until the logarithmic growth phase, 5 μL of bacterial solution was transferred to 5 mL YPD liquid medium, and culture was continued for 12 h. After repeating the above operation four times, 100 μL of culture was centrifuged and washed with sterile water, and then spread on YND medium (2% glucose, 0.17% yeast nitrogen base, 0.5% ammonium sulfate) containing 1 mg / mL 5-fluoroorotic acid. After 2-3 days, the single colony grown on the plate was gently spotted in the control medium without uracil (added with a final concentration of 100 mg / L leucine, 20 mg / L tryptophan, and 20 mg / L histidine). If the single colony did not grow in the control medium and was verified to be correct by colony PCR, it was the strain PT01 with the uracil selection marker removed.

[0068] The lithium acetate chemical conversion method is as follows:

[0069] 1. Preparation of competent cells of Saccharomyces cerevisiae:

[0070] First, a single colony of Saccharomyces cerevisiae was inoculated into 3 mL YPD liquid medium and cultured overnight in a shaker at 30°C. Then 0.5 mL of overnight culture solution was transferred into fresh 30 mL YPD liquid medium to a concentration of OD 600 =0.2, followed by shaking culture at 30°C for about 4 h. 600 =0.5, pour the bacterial solution into a sterilized 50mL centrifuge tube, then centrifuge at 4500rpm for 4min in a 4℃ refrigerated centrifuge, discard the supernatant, and collect the bacteria. Pipette 900μL of pre-cooled sterile water and 100μL of 10×LiAc to resuspend the bacteria and transfer them to a 2mL centrifuge tube, centrifuge at 4500rpm for 1min in a 4℃ refrigerated centrifuge, and repeat once. Finally, discard most of the supernatant, keep 80μL of supernatant to gently resuspend the bacteria, and place the centrifuge tube on ice to obtain Saccharomyces cerevisiae competent cells.

[0071] 2. Saccharomyces cerevisiae competent transformation:

[0072] Prepare the transformation system in a 2 mL sterile EP tube as shown in Table 1:

[0073] Table 1 Yeast transformation system

[0074]

[0075] First, add 30 μL of yeast competent cells to the above transformation system, mix gently and vortex at high speed for 10 seconds. Then incubate in a 30℃ incubator for 30 minutes, add 36 μL of dimethyl sulfoxide, vortex at high speed for 15 seconds, and then heat shock in a 42℃ water bath for 15 minutes. After the heat shock, take out, centrifuge at 4500rpm for 1 minute in a 4℃ refrigerated centrifuge, pour out the supernatant, and then add 1mL of sterile YPD liquid culture medium to the centrifuge tube, and incubate at 30℃ shaking for 1 hour. After the incubation, centrifuge at 4500rpm for 1 minute in a 4℃ refrigerated centrifuge, pour out the supernatant, then add 1mL of sterile water to wash the cells, continue to centrifuge at 4500rpm for 1 minute, and aspirate 900μL of supernatant. Finally, resuspend the cells with 100μL of sterile water, apply it on YND selection medium, and invert and culture at 30℃ for 2-3 days.

[0076] The PCR amplification system is 50 μL: Prime STAR Max Premix (2×) 25 μL, upstream primer 1 μL at a concentration of 10 μmol / L, downstream primer 1 μL at a concentration of 10 μmol / L, template 1 μL, and ddH2O is used to make up to 50 μL.

[0077] The PCR amplification program is as follows: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 30 sec, annealing at 63-58°C (0.5°C reduction per cycle) for 10 sec, extension at 72°C for 1 min, 10 cycles; denaturation at 98°C for 30 sec, annealing at 58°C for 10 sec, extension at 72°C for 1 min, 25 cycles; full extension at 72°C for 10 min, and storage at -20°C.

[0078] Construction of strain PT02:

[0079] The target sequence was designed using the chopchop website according to the target site SHM2 gene (Saccharomyces Genome Database YLR058C), and the target sequence is as follows:

[0080] SHM2 target sequence: GGTCTATACCTACCAGATGG.

[0081] Using Addgene's commercial plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t as a template, primers P11 / P12 were used to PCR amplify the upstream homology arm fragment of the gRNA expression cassette of the target site SHM2 (SEQ ID NO: 9, recorded as fragment 4); primers P13 / P14 were used to PCR amplify the downstream homology arm fragment of the gRNA expression cassette of the target site SHM2 (SEQ ID NO: 10, recorded as fragment 5). The DNA splicing method is as described above. Fragment 4 and fragment 5 were fused using primers P11 / P14 overlap extension PCR method to obtain fragment 6, and the gRNA expression cassette targeting the SHM2 site was obtained.

[0082] The genome of Saccharomyces cerevisiae CEN.PK2-1D was used as a template, and the primers and templates listed in Table 2 were used to amplify the upstream homology arm of the integration site SHM2 (SEQ ID NO: 11, fragment 7) using primers P15 / P16, and the downstream homology arm of the integration site SHM2 (SEQ ID NO: 12, fragment 8) using primers P17 / P18, and the gRNA expression cassette targeting the SHM2 site (fragment 6). The DNA splicing method is as described above. Fragments 7 and 8 were fused to obtain a large fragment using the primer P15 / P18 overlap extension PCR method. PT01 was used as the host bacteria, and the transformation method and the method for removing the screening marker ura3 were as described above. The DNA fragment of the gRNA expression cassette of SHM2 was homologously recombined with the p426 vector in the yeast body. With the assistance of the Cas9 protein, the SHM2 gene was located by its gRNA, and the knockout of the SHM2 gene in the yeast genome was achieved, and the recombinant Saccharomyces cerevisiae strain PT02 was obtained.

[0083] The PCR amplification system and PCR amplification procedure are as described above.

[0084] Construction of strain PT03:

[0085] The target sequence was designed using the chopchop website according to the target site CHA1 gene (Saccharomyces Genome Database YCL064C), and the target sequence is as follows:

[0086] CHA1 target sequence: GTAGATAAAATCAGGAACAC.

[0087] Using Addgene's commercial plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t as a template, primers P11 / P21 were used to PCR amplify the upstream homology arm fragment of the gRNA expression cassette of the target site CHA1 (SEQ ID NO: 13, recorded as fragment 9); primers P22 / P14 were used to PCR amplify the downstream homology arm fragment of the gRNA expression cassette of the target site CHA1 (SEQ ID NO: 14, recorded as fragment 10). The DNA splicing method is as described above. Fragment 9 and fragment 10 were fused using primers P11 / P14 overlap extension PCR method to obtain fragment 11, and the gRNA expression cassette targeting the CHA1 site was obtained.

[0088] The genome of Saccharomyces cerevisiae CEN.PK2-1D was used as a template, and the primers and templates listed in Table 2 were used to amplify the upstream homology arm of the integration site CHA1 (SEQ ID NO: 15, fragment 12) using primers P23 / P24, and the downstream homology arm of the integration site CHA1 (SEQ ID NO: 16, fragment 13) using primers P25 / P26, as well as the gRNA expression cassette targeting the CHA1 site (fragment 11). The DNA splicing method is as described above. Fragments 21 and 22 were fused to obtain a large fragment using the primer P13 / P26 overlap extension PCR method. Using strain PT02 as the host bacteria, the transformation method and the method for removing the screening marker ura3 were as described above. The DNA fragment of the gRNA expression cassette of CHA1 was homologously recombined with the p426 vector in the yeast body. With the assistance of the Cas9 protein, the CHA1 gene was positioned by its gRNA, and the knockout of the CHA1 gene in the yeast genome was achieved, and the recombinant Saccharomyces cerevisiae strain PT03 was obtained.

[0089] The PCR amplification system and PCR amplification procedure are as described above.

[0090] Construction of strain PT04:

[0091] The target sequence was designed using the chopchop website according to the target site ORM2 gene (Saccharomyces Genome Database YLR350W), and the target sequence is as follows:

[0092] ORM2 target sequence: TCCCAACATGAACGCTACGT.

[0093] Using Addgene's commercial plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t as a template, primers P11 / P29 were used to PCR amplify the upstream homology arm fragment of the gRNA expression cassette of the target site ORM2 (SEQ ID NO: 17, recorded as fragment 14); primers P30 / P14 were used to PCR amplify the downstream homology arm fragment of the gRNA expression cassette of the target site ORM2 (SEQID NO: 18, recorded as fragment 15). The DNA splicing method is as described above. Fragment 14 and fragment 15 were fused using primers P11 / P14 overlap extension PCR method to obtain fragment 16, and the gRNA expression cassette targeting the ORM2 site was obtained.

[0094] The genome of Saccharomyces cerevisiae CEN.PK2-1D was used as a template, and the primers and templates listed in Table 2 were used to amplify the upstream homology arm of the integration site ORM2 (SEQ ID NO: 19, fragment 17) using primers P31 / P32, the TDH3 promoter sequence (fragment 18) using primers P33 / P34, the 3-dehydrosphingosine reductase gene TSC10 (fragment 19) using primers P35 / P36, and the integration site ORM2 downstream homology arm (SEQ ID NO: 20, fragment 20) and the gRNA expression cassette targeting the ORM2 site (fragment 16) using primers P37 / P38. The DNA splicing method is as described above. Fragments 17, 18, 19, and 20 were fused to obtain a large fragment using primer P31 / P38 overlap extension PCR method. The strain PT03 was used as the host bacteria, and the transformation method and the method for removing the selection marker ura3 were as described above. The DNA fragment of the gRNA expression box of ORM2 underwent homologous recombination with the p426 vector in the yeast. With the assistance of Cas9 protein, the ORM2 gene was located by its gRNA, thereby achieving the knockout of the ORM2 gene in the yeast genome and the introduction of the TSC10 gene, and obtaining the recombinant Saccharomyces cerevisiae strain PT04.

[0095] The PCR amplification system and PCR amplification procedure are as described above.

[0096] Construction of strain PT05:

[0097] The target sequence was designed using the chopchop website according to the target site ELO3 gene (Saccharomyces Genome Database YLR372W), and the target sequence is as follows:

[0098] ELO3 target sequence: ATCCAATCTTACAAGAAAGG.

[0099] Using Addgene's commercial plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t (referred to as p426) as a template, primers P11 / P43 were used to PCR amplify the upstream homology arm fragment of the gRNA expression cassette of the target site ELO3 (SEQ ID NO: 21, recorded as fragment 21); primers P44 / P14 were used to PCR amplify the downstream homology arm fragment of the gRNA expression cassette of the target site ELO3 (SEQ ID NO: 22, recorded as fragment 22). The DNA splicing method is as described above. Fragment 21 and fragment 22 were fused using primers P11 / P14 overlap extension PCR method to obtain fragment 23, and the gRNA expression cassette targeting the ELO3 site was obtained.

[0100] The genome of Saccharomyces cerevisiae CEN.PK2-1D was used as a template, and the primers and templates listed in Table 2 were used to amplify the upstream homology arm of the integration site ELO3 (SEQ ID NO: 23, fragment 24), the TDH3 promoter sequence (fragment 25) was amplified using primers P47 / P48, the sphingosine hydroxylase gene SYR2 (fragment 26) was amplified using primers P49 / P50, and the integration site ELO3 downstream homology arm (SEQ ID NO: 24, fragment 27) and the gRNA expression cassette targeting the ELO3 site (fragment 23) were amplified using primers P51 / P52. The DNA splicing method is as described above. Fragment 24, fragment 25, fragment 26 and fragment 27 were fused to obtain a large fragment using the primer P45 / P52 overlap extension PCR method. The strain PT04 was used as the host bacteria, and the transformation method and the method for removing the selection marker ura3 were as described above. The DNA fragment of the gRNA expression box of ELO3 underwent homologous recombination with the p426 vector in the yeast. With the assistance of Cas9 protein, the ELO3 gene was located by its gRNA, achieving the knockout of the ELO3 gene in the yeast genome and the introduction of the SYR2 gene, thereby obtaining the recombinant Saccharomyces cerevisiae strain PT05.

[0101] The PCR amplification system and PCR amplification procedure are as described above.

[0102] Construction of strain PT06:

[0103] The target sequence was designed using the chopchop website according to the target site SHM1 gene (Saccharomyces Genome Database YBR263W), and the target sequence is as follows:

[0104] SHM1 target sequence: TACTCCGCTATCATGAACGT.

[0105] Using Addgene's commercial plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t as a template, primers P11 / P57 were used to PCR amplify the upstream homology arm fragment of the gRNA expression cassette of the target site SHM1 (SEQ ID NO: 25, recorded as fragment 28); primers P58 / P14 were used to PCR amplify the downstream homology arm fragment of the gRNA expression cassette of the target site SHM1 (SEQID NO: 26, recorded as fragment 29). The DNA splicing method is as described above. Fragment 28 and fragment 29 were fused using primers P11 / P14 overlap extension PCR method to obtain fragment 30, and the gRNA expression cassette targeting the SHM1 site was obtained.

[0106] The genome of Saccharomyces cerevisiae CEN.PK2-1D was used as a template, and the primers and templates listed in Table 2 were used to amplify the upstream homology arm of the integration site SHM1 (SEQ ID NO: 27, fragment 31) using primers P59 / P60, the TDH3 promoter sequence (denoted as fragment 32) using primers P61 / P62, the serine palmitoyltransferase gene LCB2 (fragment 33) using primers P63 / P64, and the downstream homology arm of the integration site SHM1 (SEQ ID NO: 28, fragment 34) using primers P65 / P66, and the gRNA expression cassette targeting the ORM2 site (fragment 30). The DNA splicing method is as described above. Fragments 31, 32, 33, and 34 were fused to obtain a large fragment using the primer P59 / P66 overlap extension PCR method. The strain PT05 was used as the host bacteria, and the transformation method and the method for removing the selection marker ura3 were as described above. The DNA fragment of the gRNA expression box of SHM1 underwent homologous recombination with the p426 vector in the yeast. With the assistance of Cas9 protein, the SHM1 gene was located by its gRNA, and the knockout of the SHM1 gene in the yeast genome and the introduction of the LCB2 gene were achieved, thereby obtaining the recombinant Saccharomyces cerevisiae strain PT06.

[0107] The genotypes of the above strains are shown in Table 3.

[0108] Table 2 Primers used in Example 1

[0109]

[0110]

[0111]

[0112]

[0113] Note: The underlined sequences in the primer sequences are overlapping sequences with adjacent fragments to facilitate overlap extension PCR.

[0114] Table 3 The strains involved in the present invention

[0115]

[0116] Example 2 Determination of phytosphingosine production

[0117] The strains constructed in Example 1 were streaked and activated on YND solid medium, cultured in an incubator at 30°C for 72 h, and single colonies were inoculated into YPD medium at 30°C and 200 rpm for overnight culture as seed liquid; the seed liquid was inoculated into 30 mL of YPD medium at a volume concentration of 2% at a culture temperature of 30°C and a shaking flask speed of 200 rpm. After 96 h of culture, the culture was centrifuged to collect the precipitate.

[0118] The conditions for the HPLC determination of phytosphingosine were as follows: the determination was performed using an Agilent waters system, the mobile phase was an acetonitrile-water solution (80% acetonitrile, 20% (0.1% phosphoric acid-water)) (ultrasound was required for 30 min after filtration through a 0.22 μm water filter), the chromatographic column was a ZORBAX SB-C8 (4.6 mm X 150 mm, 3.5 mm; Agilent), the flow rate was set to 1 mL / min, the column oven temperature was 25°C, the injection volume was set to 10 μL, the detector was an ultraviolet detector, and the absorbance was set to 230 nm.

[0119] Drawing of the standard curve of phytosphingosine: Use phytosphingosine solid (analytical grade) to dissolve in methanol to prepare 2 mg / mL phytosphingosine mother solution, add methanol to dilute to 0.2 mg / mL, 0.5 mg / mL, 1 mg / mL and 1.5 mg / mL, add 1:1 o-phthalaldehyde derivatization reagent (weigh 50 micrograms of o-phthalaldehyde (OPA) and dissolve in 2 mL of methanol, add 100 μL of 2-mercaptoethanol, and then dilute to 10 mL with boric acid buffer solution, pH 10.5 and mix well), incubate at room temperature in the dark for 30 minutes, and the final standard concentration is 0.1 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 0.75 mg / mL and 1 mg / mL. The standard sample is filtered through a 0.22 μm filter membrane and then tested by HPLC. By analyzing the different concentrations of phytosphingosine standards, the standard curve is drawn with the ordinate as the phytosphingosine concentration and the abscissa as the peak area.

[0120] Prepare sorbitol buffer (10 mL): 1.82 g sorbitol and 0.042 g sodium citrate were dissolved in 10 mL pH 5.8 potassium phosphate buffer, vortexed to mix, and sterilized by filter in a clean bench.

[0121] Preparation of snail enzyme solution: Take 5mL of sorbitol buffer and add it to a brown bottle containing 1g of snail enzyme (manufacturer: Solebo, CAS: 9032-75-1). Gently shake to mix and make sure that the snail enzyme is completely dissolved. Before use, use a gun tip to pick up the bottom of the bottle to see if there is any undissolved enzyme. If there is precipitation, continue to shake or blow with the gun tip to dissolve it. The resulting solution is a snail enzyme solution with a concentration of 200mg / mL.

[0122] Sample treatment: weigh an empty 2mL centrifuge tube in advance, take 4mL of yeast fermentation broth (YPD liquid medium), centrifuge at room temperature at 10000rpm for 1min, weigh the yeast cells and centrifuge tube, then wash the bacteria with 200μL sterile water (resuspend by suction), centrifuge at room temperature at 10000rpm for 1min, and discard the supernatant. Repeat the wash 2-3 times. Resuspend the yeast cells in 500μL of thiol compound, bathe at 32℃ for 15-30min, gently invert the centrifuge tube two or three times during the period, centrifuge at room temperature at 10000rpm for 1min, and discard the supernatant. Resuspend the precipitate in 500uL sorbitol buffer. According to the ratio of adding 40mg of snail enzyme per gram of yeast cells, add an appropriate volume of the prepared snail enzyme solution to the yeast cell solution, and keep it at 37℃ for 1h. Centrifuge at room temperature at 10000rpm for 1min, and discard the supernatant. The precipitate obtained by centrifugation is extracted twice with 2ml of ether / water (volume ratio of 8:3), and the extracts are combined. The upper ether phase was collected, dried under vacuum, dissolved in 500uL methanol, and 500uL o-phthalaldehyde derivatization reagent was added in a 1:1 ratio. The mixture was vortexed for 10s and incubated at room temperature in the dark for 30min. The sample was filtered through a 0.22μm filter membrane and then tested by HPLC.

[0123] The system of the thiol compound (30 mL): 2.4 mL of 0.5 M EDTA, 294 μL of mercaptoethanol, and 27.3 mL of sterile water.

[0124] like Figure 2 As shown, after 96 hours of fermentation in YPD medium, the production of phytosphingosine in the metabolically modified strains was higher than that of the starting strain CEN.PK2-1D, and the strain PT06 had the highest production of 9.52 mg / g dry weight.

[0125] Example 3 Overexpression of transcription factor HAC1 promotes phytosphingosine synthesis

[0126] The primers and templates used in this example are listed in Table 2.

[0127] Construction of p426-gRNA-delta22 plasmid: Commercial plasmid from Addgene

[0128] p426-SNR52p-gRNA.CAN1.Y-SUP4t was used as a template, and the primers listed in Table 2 were used to amplify the p426 vector fragment using primers P71 / P72, which contained a 20 bp target sequence at the delta22 site. The fragment was then transformed into E. coli DH5α competent cells. Positive transformants were selected and colony PCR was performed using primers P73 / P74 to verify the strain. The obtained strain was recorded as p426-gRNA-delta22, and the plasmid was then extracted using a kit. Using the genome of Saccharomyces cerevisiae CEN.PK2-1D as a template, primers P75 / P76 listed in Table 2 were used to amplify the TDH3 promoter sequence (denoted as fragment 35), P77 / P78 was used to amplify the upstream homology arm of the integration site delta22 (SEQ ID NO: 29, fragment 36), P79 / P80 was used to amplify the HAC1 fragment (fragment 37), and P81 / P82 was used to amplify the downstream homology arm of the integration site delta22 (SEQ ID NO: 30, fragment 38). The DNA splicing method was as described above. Fragments 35, 36, 37 and 38 were fused using the overlap extension PCR method with primers P77 / P82 to obtain a large fragment. Using PT06 as the host bacteria, the transformation method was as described above to obtain the recombinant Saccharomyces cerevisiae strain PT07.

[0129] The strain culture method and phytosphingosine determination method in Example 2 were used to evaluate the phytosphingosine synthesis ability of the above strains.

[0130] like Figure 2 As shown, compared with strain PT06, the phytosphingosine production of strain PT07, which constitutively overexpresses HAC1, increased by 4.34 times to 41.33 mg / g dry weight. Therefore, overexpression of HAC1 can further increase phytosphingosine production.

[0131] Example 4 Synthesis of phytosphingosine by high-density fermentation of strains in a 5L fermenter

[0132] The fermentation basal medium was YPD medium (1% yeast powder, 2% peptone, 2% glucose) with an initial glucose concentration of 20 g / L. A fed-batch fermentation experiment was carried out on the strain PT07 in a 5 L fermenter in the laboratory.

[0133] Feed medium for fermenter: accurately weigh 500g glucose, 2.5g magnesium sulfate, 3.5g potassium sulfate, 0.28g sodium sulfate, 9g potassium dihydrogen phosphate, dilute to 1L with a volumetric flask, and sterilize with high pressure steam at 115℃ for 30min. Then add 10mL of the prepared trace element solution and 12mL of the vitamin solution.

[0134] The trace element solution: accurately weigh 5.8 g zinc sulfate, 0.3 g manganese chloride, 0.3 g anhydrous copper sulfate, 0.5 g cobalt chloride, 0.5 g sodium molybdate, 2.9 g calcium chloride, 2.8 g ferrous sulfate, 0.5 M EDTA 80 mL, dilute to 1 L with a volumetric flask, filter and sterilize with a 0.22 μm water filter membrane, and then store in a 4° C. refrigerator for use.

[0135] The vitamin solution: weigh 0.05 g biotin, 1 g nicotinic acid, 25 g inositol, 1 g calcium pantothenate, 1 g pyridoxine, 0.2 g p-aminobenzoic acid, 1 g thiamine hydrochloride, and dilute to volume with 1 L ddH2O. Filter and sterilize using a 0.22 μm water filter membrane, and then store in a 4°C refrigerator for later use.

[0136] Primary seed culture: Take 200 μL of PT07 glycerol bacteria and inoculate it into a test tube containing 3 mL of YPD seed medium, and culture at 30°C and 200 rpm until OD 600 =6-7.

[0137] Secondary seed culture: The primary seeds were transferred to 250 mL shake flasks (five shake flasks at the same time) with 50 mL YPD medium at a 2% inoculum, and cultured at 30°C and 200 rpm until the mid-logarithmic growth period (OD 600 =5-6).

[0138] Fermenter inoculation: 10% inoculum (250 mL of secondary seeds, initial OD 600 About 0.5) The secondary seeds were transferred to a 5 L fermentation tank filled with 2.5 L fermentation medium to start fermentation. The initial liquid volume of the fermentation tank was 2.5 L, and the initial medium was YPD containing 2% glucose.

[0139] Fermentation tank parameter settings: fermentation temperature is 30 ° C, pH is controlled at 5.8 (adjusted by 0.5M HCl and 5M NH4OH), ventilation is set to 2.5vvm, DO (dissolved oxygen concentration) is 20%, speed range is 400-600rpm and stirring is linked to DO, during which feeding is carried out according to the content of glucose in the culture medium and the dissolved oxygen of the fermentation liquid, and the dissolved oxygen is controlled at about 20%. Within a period of about 120h, samples are collected and phytosphingosine is quantified using the phytosphingosine determination method in Example 2.

[0140] like Figure 3 As shown, compared with the PT07 shake flask fermentation, the maximum yield of phytosphingosine produced by 5L fermentor increased by 3.64 times, reaching 150.54 mg / g dry weight, and the titer was 2817 mg / L.

[0141] The above embodiments are only used to help understand the method of the present invention and its core concept. It should be noted that, for those skilled in the art, without departing from the principles of the present invention, several improvements and modifications may be made to the present invention, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. A phytosphingosine-producing yeast strain, characterized in that The phytosphingosine-producing Saccharomyces cerevisiae strain is obtained by using Saccharomyces cerevisiae CEN.PK2-1D as a starting strain and performing the following transformations: knocking out the sphingosine base kinase LCB4 gene, the serine hydroxymethyltransferase SHM2 gene and the L-serine deaminase CHA1 gene, inserting an expression cassette of the 3-dehydrodihydrosphingosine reductase gene at the gene site of the membrane protein ORM2 that regulates the activity of serine palmitoyltransferase, inserting an expression cassette of the sphingosine hydroxylase gene at the gene site of the fatty acid elongase III ELO3, inserting an expression cassette of the serine palmitoyltransferase gene at the site of the SHM1 gene to obtain the Saccharomyces cerevisiae strain PT06, and inserting an expression cassette of the transcription factor HAC1 gene at the delta 22 site of the Saccharomyces cerevisiae strain PT06 to obtain the Saccharomyces cerevisiae strain producing phytosphingosine; The expression cassette of the 3-dehydrosphingosine reductase gene comprises a TDH3 promoter and a 3-dehydrosphingosine reductase gene; The nucleotide sequence of the 3-dehydrosphingosine reductase gene is shown in SEQ ID NO: 3; The expression cassette of the sphingosine hydroxylase gene comprises a TDH3 promoter and a sphingosine hydroxylase gene; the nucleotide sequence of the sphingosine hydroxylase gene is shown in SEQ ID NO: 4; The expression cassette of the serine palmitoyltransferase gene comprises a TDH3 promoter and a serine palmitoyltransferase gene; The nucleotide sequence of the serine palmitoyltransferase gene is shown in SEQ ID NO: 5; The expression cassette of the transcription factor HAC1 gene includes a TDH3 promoter and a transcription factor HAC1 gene; The nucleotide sequence of the transcription factor HAC1 gene is shown in SEQ ID NO: 6; The nucleotide sequence of the TDH3 promoter is shown in SEQ ID NO:

1.

2. The phytosphingosine-producing Saccharomyces cerevisiae strain according to claim 1, characterized in that: The transformation was accomplished using the CRISPR-Cas9 yeast genome editing method.

Images