An eccDNA marker related to Hu sheep weight and its detection primer and application

Abstract

The present invention discloses an eccDNA marker related to the weight of Hu sheep and its detection primer and application. The eccDNA marker refers to the extrachromosomal circular DNA produced in the Hu sheep genome region chr19:22919317-22919972. The Hu sheep genome DNA is used as a template, and a "back-to-back" primer is used to amplify a partial DNA fragment containing an eccNDA joint by PCR, and the PCR product amplified by the "head-to-head" primer is used as a control. According to the agarose gel electrophoresis results, the Hu sheep individuals are divided into an increase type or a deletion type, wherein the increase type of Hu sheep weight is significantly higher than the deletion type. The present invention detects an eccDNA molecular marker closely related to the weight of Hu sheep at the DNA level, and is applied to the marker-assisted selection of Hu sheep to accelerate the genetic breeding process of Hu sheep.

Description

Technical Field

[0001] The invention belongs to the field of livestock molecular biology detection, and specifically relates to an eccDNA marker related to Hu sheep weight, a detection primer and an application thereof. Background Art

[0002] At present, the mutton sheep industry is in a critical stage of transformation and upgrading, but the mutton sheep breeding system is not sound, there is a lack of specialized mutton sheep breeds, and the selection and breeding of high-quality mutton sheep lags behind, which seriously restricts the healthy development of the mutton sheep industry. Huyang is a world-famous multi-lamb sheep breed with strong adaptability, large numbers and wide distribution. It is a first-class protected local livestock and poultry breed in my country and one of the ideal mothers for the creation of new mutton sheep breeds.

[0003] Therefore, accelerating the molecular breeding of Hu sheep for meat is of great significance to promoting the healthy development of my country's meat sheep industry.

[0004] Molecular breeding of livestock mainly refers to the use of molecular markers that regulate individual growth and development, such as single nucleotide polymorphisms (SNPs), insertions / deletions (Indels), copy number variations (CNVs), non-coding RNAs (ncRNAs), etc., to perform genotyping or expression identification on the molecular markers of the tested individuals using molecular biological techniques, and select the best individuals based on different genotypes or expression levels, so as to achieve the purpose of early selection and improve the accuracy of breeding values, and accelerate the progress of genetic breeding of livestock and poultry.

[0005] Extrachromosomal circular DNA (eccDNA) refers to double-stranded circular DNA molecules that are derived from eukaryotic genomic DNA and are free from chromosomes. It lacks centromeres and telomeres, can replicate itself, and is randomly distributed to daughter cells during mitosis and meiosis. Some eccDNA can be reintegrated into the genome. In addition, eccDNA has a high degree of chromatin openness, which makes the regulatory elements on eccDNA interact more strongly with target genes and the gene expression level is higher. Large eccDNA can usually carry complete proto-oncogenes, which significantly reduces the survival rate of tumor patients carrying eccDNA. In animals and plants, large eccDNA can also carry complete genes, such as KIT and EPSPS, which play an important role in cattle hair color variation and glyphosate resistance in Palmer amaranth, and these phenotypes can be stably passed on to the next generation. In addition, the study found that meat pigeon breeds are significantly enriched with eccDNA containing the key gene AGRIN for muscle development.

[0006] MicroDNA is an important form of eccDNA, but its length is less than 1kb. Studies have shown that microDNA can produce miRNA and carry regulatory elements (mobile enhancers), and this small molecule eccDNA can be released from other tissues into the blood circulation system, which greatly facilitates sample collection. These results show that eccDNA can be used for molecular marker-assisted selection, but related research has not yet been reported. Summary of the invention

[0007] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0008] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0009] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide an eccDNA marker related to the weight of Hu sheep, wherein the eccDNA marker is an extrachromosomal circular DNA, i.e., an eccDNA marker, produced by the Hu sheep genome fragment chr19:22919317-22919972;

[0010] Among them, the nucleotide sequence of the Hu sheep genome fragment chr19:22919317-22919972 is shown in SEQ ID NO.1, and the eccDNA marker is shown in SEQ ID NO.2.

[0011] Another object of the present invention is to overcome the deficiencies in the prior art and provide an application of an eccDNA marker in molecular marker-assisted selection breeding of Hu sheep.

[0012] In order to solve the above technical problems, the present invention provides the following technical solution: application of an eccDNA marker in molecular marker-assisted selection breeding of Hu sheep.

[0013] As a preferred solution of the application of the present invention, it includes:

[0014] The sheep genome region chr19:22919317-22919972 was used as the candidate region for eccDNA detection. The PCR technology was used to detect the variation of eccDNA at this site in the Hu sheep population and associate it with body weight.

[0015] As a preferred solution of the application of the present invention, it includes:

[0016] The Hu sheep genome fragment chr19:22919317-22919972 can generate extrachromosomal circular DNA, i.e., eccDNA. The Hu sheep genome DNA to be tested is used as a template, and a DNA fragment containing an eccNDA linker is amplified by PCR using "back-to-back" primers, wherein the sequence of the DNA fragment containing the eccNDA linker is shown in SEQ ID NO.3;

[0017] The "head-to-head" primers were used to amplify the DNA fragment of the linear genomic region chr19:22919317-22919972, and the product was used as a control, wherein the sequence of the DNA fragment of the linear genomic region chr19:22919317-22919972 is shown in SEQ ID NO.4;

[0018] The amplified products were subjected to agarose gel electrophoresis, and the eccDNA genotype of the Hu sheep to be tested was identified based on the results of agarose gel electrophoresis.

[0019] As a preferred embodiment of the application of the present invention, the amplification primers of the "back-to-back" PCR are:

[0020] The nucleotide sequence of the upstream primer is shown in SEQ ID NO.5;

[0021] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.6.

[0022] As a preferred embodiment of the application of the present invention, the amplification primers of the "head-to-head" PCR are:

[0023] The nucleotide sequence of the upstream primer is shown in SEQ ID NO.7;

[0024] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.8.

[0025] As a preferred embodiment of the application of the present invention, the PCR amplification system includes 100 ng / μL template DNA, 1.0 μL and 1 μL of each of the upstream and downstream primers at 10 pmol / L.

[0026] As a preferred embodiment of the application of the present invention, the amplification reaction procedure of the PCR is as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 65°C for 30 s, and extension at 72°C for 30 s, for a total of 15 cycles, with the annealing temperature decreasing by 1°C in each cycle;

[0027] Denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 30 s were performed for a total of 20 cycles.

[0028] As a preferred solution of the application of the present invention, the agarose gel electrophoresis uses agarose gel with a mass concentration of 3%.

[0029] As a preferred embodiment of the application of the present invention, the eccDNA genotype of the Hu sheep is: the increased type is expressed as two bands of 102bp and 228bp; the deleted type is expressed as a band of 102bp; the weight of individuals with the increased eccDNA genotype is significantly better than that of individuals with the deleted type; the weight refers to the birth weight and the weight at 6 months of age.

[0030] Beneficial effects of the present invention:

[0031] (1) The present invention uses the sheep genome region chr19:22919317-22919972 as a candidate region for eccDNA detection, detects the variation of eccDNA at this site in the Hu sheep population through PCR technology, and associates it with body weight; individuals with increased eccDNA are superior to individuals with deleted eccDNA in terms of birth weight and weight at 6 months of age. The eccDNA in this region is studied and associated with the weight of Hu sheep. It can be used for molecular marker-assisted selection of Hu sheep, thereby accelerating the genetic breeding process of meat Hu sheep and quickly establishing a Hu sheep population with excellent genetic resources.

[0032] (2) The present invention provides a new type of molecular marker, namely, an eccDNA marker, which can be used for early selection of ewes, even right after birth; the method for verifying the eccDNA marker produced by the chr19:22919317-22919972 genome region of Hu sheep is accurate, reliable, simple to operate, and low in cost; the identification of eccDNA markers can provide a scientific basis for the breeding of Hu sheep for meat. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0034] Figure 1 Schematic diagram of primer design in the embodiment of the present invention.

[0035] Figure 2 It is an agarose gel electrophoresis diagram of the PCR amplification product in the embodiment of the present invention. DETAILED DESCRIPTION

[0036] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0037] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0038] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0039] The PCR technology involved in the present invention for detecting eccDNA markers refers to the eccDNA genotype variation or polymorphism within the Hu sheep genome fragment chr19:22919317-22919972 (reference genome Oar_rambouillet_v1.0). The Hu sheep genome DNA to be tested is used as a template, and "back-to-back" primers are used to amplify a partial DNA fragment containing the eccDNA linker through PCR. The PCR product amplified by "head-to-head" primers is used as a control, and the amplified product is subjected to agarose gel electrophoresis. The increase type is manifested as two bands of 102bp and 228bp; the deletion type is manifested as a band of 102bp. According to the typing results, the eccDNA increase type individual is selected as the dominant individual and kept for breeding.

[0040] The linear genome sequence for generating eccDNA in the present invention refers to the genome version Oar_rambouillet_v1.0, the position of the Huyang genome fragment is: chr19:22919317-22919972, and the nucleic acid sequence is shown in SEQ ID NO.1.

[0041] The eccDNA nucleic acid sequence in the present invention is shown as SEQ ID NO.2, and the bases at the head and tail ends of the linear genomic fragment SEQ ID NO.1 are connected through a cyclization mechanism to form a linear molecule into a ring, and part of the DNA fragments of the eccDNA linker (the bases at the head and tail ends) are located at the 188th and 189th bases in the nucleic acid sequence such as SEQ ID NO.2.

[0042] Circularization does not refer to obtaining eccDNA through artificial means, but refers to the fact that under natural physiological conditions, certain circularization mechanisms within the cell cause linear DNA regions to circularize. The purpose of the present invention is to detect which individuals / cells have circularized in specific genomic regions and produced eccDNA.

[0043] Example 1

[0044] 1. Collection of Lake Sheep Samples

[0045] Taking Hu sheep as the test object, 50 Hu sheep jugular vein blood samples were collected from Dongshan Hu Sheep Industry Development Co., Ltd. in Suzhou Taihu, Jiangsu Province.

[0046] 2. Separation, extraction and purification of genomic DNA

[0047] Refer to Sambrocketal (2002) method.

[0048] 3. Amplification of target sequence and internal reference sequence

[0049] The reference genome Oar_rambouillet_v1.0 published in the Ensembl database (http: / / asia.ensembl.org / index.html) was used as the reference sequence, and Primer5.0 was used to design "back-to-back" PCR primers (i.e., primer P1, whose gene sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, corresponding to F1 and R1 in Table 1) whose amplification products span the eccDNA (nucleic acid sequence is shown in SEQ ID NO.3, and the eccDNA adapter sequence is located at positions 174 and 175 in SEQ ID NO.3) linker.

[0050] "Head-to-head" PCR primers (i.e., primer P2, whose gene sequences are shown in SEQ ID NO.7 and SEQ ID NO.8, corresponding to F2 and R2 in Table 1) were designed to amplify a 102 bp fragment (nucleic acid sequence is shown in SEQ ID NO.4) of the linear genomic region chr19:22919317-22919972 (nucleic acid sequence is shown in SEQ ID NO.1), and its product was used as a control (see Figure 1 ).

[0051] The primer pair sequence information is shown in Table 1.

[0052] Table 1 Fluorescence quantitative PCR primer information

[0053]

[0054] The amplification system used for PCR was 25 μL: 1.0 μL of 100 ng / μL template DNA, 1 μL of each of the upstream and downstream primers of 10 pmol / L primer pair P, 13 μL of 2×TaqPCRMasterMix, and 9 μL of deionized water.

[0055] The reaction program used for PCR was as follows: (1) pre-denaturation at 95°C for 5 min; (2) denaturation at 94°C for 30 s, annealing at 65°C for 30 s, and extension at 72°C for 30 s, for a total of 15 cycles, with the annealing temperature decreasing by 1°C in each cycle; (3) denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 30 s, for a total of 20 cycles.

[0056] 4. Electrophoresis detection and genotype determination

[0057] The PCR amplification products of each individual were detected by 3% agarose gel electrophoresis (voltage 120V, electrophoresis time 20 minutes), and the eccDNA genotypes of Hu sheep were as follows: the increase type showed two bands of 102 bp and 228 bp; the deletion type showed a single band of 102 bp (see Figure 2 ), the statistical analysis results of eccDNA genotypes are shown in Table 2.

[0058] Table 2 Statistical analysis of eccDNA genotype

[0059]

[0060] 5. Association analysis between eccDNA markers and body weight in Hu sheep

[0061] Genotype data: identified genotypes (additions and deletions).

[0062] Growth trait data: birth weight and weight at 6 months of age of Hu sheep.

[0063] Data analysis: Independent samples t-test.

[0064] Table 3 Association analysis between eccDNA markers and body weight

[0065]

[0066] The results of association analysis showed (see Table 3): the eccDNA produced in the genomic region chr19:22919317-22919972 was significantly correlated with the weight of Hu sheep, and the dominant genotype was the eccDNA increase type, indicating that the eccDNA can be used as a molecular marker for the weight selection of Hu sheep.

[0067] 6. Application of the above eccDNA markers in Hu sheep breeding

[0068] In the early molecular marker-assisted selection, individuals with eccDNA deletion in the genomic region chr19:22919317-22919972 were eliminated, and individuals with eccDNA increase were retained for breeding, forming a higher-weight and superior Hu sheep population, thereby accelerating the breeding process of Hu sheep variety improvement.

[0069] Resequencing of the Hu sheep genome found that the genomic fragment chr19:22919317-22919972 of some Hu sheep can produce eccDNA, while other Hu sheep individuals do not produce eccDNA in this region, indicating that the Hu sheep population has eccDNA polymorphism in the chr19:22919317-22919972 region.

[0070] SEQ ID NO.1:

[0071] TGATACCCCCCAACAAGGTGTTCAATATGTAGTAGTAGAGACAGTGGGCATCCTTGCTGTATACTTCACTTTAGCGGGAATGTCTTTAATGTTTCCCAGTTAAATAAAAAGCTGGCTTTGGGACTTAAGTATTTTTTACTGTGTTAAGTTTAATTGGTTATGGTG CCTCATAGCTTAAGTACAGTATGTTGGAAATTGCATTTTCAAGGGTGGGTGTCAGAAGGCCTAGAGATTCTGAGGCTAATGGGAAGGAAGTAATTTTTCAAACTGTCTTTTTAAAATTTATTTTTGGCTGCAGTAGATCTTCATTGCTGCACACAGCCTTTCTG TGATTGTGTGGATTGGGAGCTACTTTCTGTGGAGGTACTTGGGCTCCTCGCTGAGGTGGCTTTTCTTGTTGTGGAGCACAGGTCCTAGGCACTCGGGCCTCAGTAGTTGTAGCACGCAGGCTCAGTAGTTGTGGTTTTGAGCTTTAGATCACTGACTCCGTAGT TGTGCTGCATGGGCTTAGTCGGTCTGCGGCATGTGGGATCTTCCCAGTTCGGAGATCAAACACGTTTCTTGCATTAGTAGGCAAATGCTTGACCACTAGACCGCCAGAGAAGGCCCTGTGAAGCTGACTTAAAATAATAAGTCATACATACTTTCAATTGATAC

[0072] SEQ ID NO.2:

[0073] GCTTTAGATCACTGACTCCGTAGTTGTGCTGCATGGGCTTAGTCGGTCTGCGGCATGTGGGATCTTCCCAGTTCGGAGATCAAACACGTTTCTTGCATTAGTAGGCAAATGCTTGACCACTAGACCGCCAGAGAAG GCCCTTGTGAAGCTGACTTAAAATAATAAGTCATACATACTTTCAATTGATACTGATACCCCCAACAAGGTGTTCAATATGTAGTAGTAGAGACAGTGGGCATCCTTGCTGTATACTTCACTTTAGCGGGAATGTCTT TAATGTTTCCCAGTTAAATAAAAAGCTGGCTTTGGGACTTAAGTATTTTTTACTGTGTTAAGTTTAATTGGTTATGGTGCCTCATAGCTTAAGTACAGTATGTTGGAAATTGCATTTTCAAGGGTGGGTGTCAGAAGGCCTAGAGATTCTGAGGCTAATGGGAAGGAAGTAATTTTTCAAACTGTCTTTTTAAAATTTATTTTTGGCTGCAGTAGATCTTCATTGCTGCACACAGCCTTTCTGTGATTGTGTGGATTGGGAGCTACTTTCTGT GGAGGTACTTGGGCTCCTCGCTGAGGTGGCTTTTCTTGTTGTGGAGCACAGGTCCTAGGCACTCGGGCCTCAGTAGTTGTAGCACGCAGGCTCAGTAGTTGTGGTTTTGA

[0074] SEQ ID NO.3:

[0075] ACTCCGTAGTTGTGCTGCATGGGCTTAGTCGGTCTGCGGCATGTGGGATCTTCCCAGTTCGGAGATCAAACACGTTTCTTGCATTAGTAGGCAAATGCTTGACCACTAGACCGCCAGAGAAGGCCCTGTGAAGCTGACTTAAAATAATAAGTCATACATACTTTCAATTGATACTGATACCCCCAACAAGGTGTTCAATATGTAGTAGTAGAGACAGTGGGCATCCTT

[0076] SEQ ID NO.4:

[0077] TTAGCGGGAATGTCTTTAATGTTTCCCAGTTAAATAAAAAGCTGGCTTTGGGACTTAAGTATTTTTTACTGTGTTAAGTTTAATTGGTTATGGTGCCTCATA

[0078] SEQ ID NO.5:

[0079] ACTCCGTAGTTGTGCTGC

[0080] SEQ ID NO.6:

[0081] AAGGATGCCCACTGTCTC

[0082] SEQ ID NO.7:

[0083] TTAGCGGGAATGTCTTTA

[0084] SEQ ID NO.8:

[0085] TATGAGGCACCATAACCA

[0086] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. An eccDNA marker associated with Hu sheep weight, characterized in that: The eccDNA marker is an extrachromosomal circular DNA, i.e., an eccDNA marker, produced by the Hu sheep genome fragment chr19: 22919317-22919972; Among them, the nucleotide sequence of the Hu sheep genome fragment chr19: 22919317-22919972 is shown in SEQ ID NO.1, and the eccDNA marker nucleic acid sequence is shown in SEQ ID NO.

2.

2. Use of a reagent for detecting the eccDNA marker of claim 1 in weight selection breeding of Hu sheep, characterized in that: The Hu sheep genome region chr19: 22919317-22919972 was used as a candidate region for eccDNA detection. The variation of eccDNA in the Hu sheep population was detected by PCR and associated with body weight. The body weight of individuals with the increased eccDNA genotype is significantly better than that of individuals with the deleted eccDNA genotype; the body weight refers to birth weight and 6-month-old weight.

3. The use according to claim 2, characterized in that: include, The Hu sheep genome fragment chr19: 22919317-22919972 produces extrachromosomal circular DNA, i.e., eccDNA. The Hu sheep genome DNA to be tested is used as a template, and a DNA fragment containing the eccNDA linker is amplified by PCR using "back-to-back" primers, wherein the sequence of the DNA fragment containing the eccNDA linker is shown in SEQ ID NO.3; "Head-to-head" primers were used to amplify the DNA fragment of the linear genomic region chr19: 22919317-22919972, and the product was used as a control, wherein the sequence of the DNA fragment of the linear genomic region chr19: 22919317-22919972 is shown in SEQ ID NO.4; The amplified products were subjected to agarose gel electrophoresis, and the eccDNA genotype of the Hu sheep to be tested was identified based on the results of agarose gel electrophoresis.

4. The use according to claim 3, characterized in that: The "back-to-back" primers are: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.5; The nucleotide sequence of the downstream primer is shown in SEQ ID NO.

6.

5. The use according to claim 4, characterized in that: The "head-to-head" primers are: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.7; The nucleotide sequence of the downstream primer is shown in SEQ ID NO.

8.

6. The use according to claim 3, characterized in that: The PCR amplification system includes 100 ng / μL template DNA, 1.0 μL and 1 μL of each of 10 pmol / L upstream and downstream primers.

7. The use according to claim 3, characterized in that: The PCR amplification reaction program is: 95°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 65°C annealing for 30 s, 72°C extension for 30 s, a total of 15 cycles, with the annealing temperature decreasing by 1°C in each cycle; Denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 30 s were performed for a total of 20 cycles.

8. The use according to claim 3, characterized in that: The agarose gel electrophoresis uses agarose gel with a mass concentration of 3%.

9. The use according to claim 5, characterized in that: The eccDNA genotype of the Hu sheep is as follows: the increased type is expressed as two bands of 102 bp and 228 bp; the deleted type is expressed as one band of 102 bp.

Images