Aspergillus terreus DK3-18 and application thereof in extracting total flavones from persimmon leaves
By using crude enzyme solution prepared by fermentation of Aspergillus terreus DK3-18 to enzymatically hydrolyze persimmon leaves, combined with ultrasonic extraction of ethanol, the problems of low extraction rate and high cost of total flavonoids from persimmon leaves in existing technologies have been solved, achieving a significant improvement in extraction rate and a reduction in cost.
Patent Information
- Application Number
- CN202211597813.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-12
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2042-12-12
AI Technical Summary
Existing technologies for extracting total flavonoids from persimmon leaves suffer from problems such as low extraction rate, high cost, and low purity. In particular, enzymatic hydrolysis is not ideal and is also costly.
The crude enzyme solution prepared by fermentation of Aspergillus terrestris DK3-18 was used to enzymatically hydrolyze persimmon leaves. Combined with ultrasonic extraction with ethanol, the multiple hydrolytic enzymes produced by this strain synergistically decomposed the cell wall components of persimmon leaves, thereby improving the extraction rate of total flavonoids.
It significantly improved the extraction rate of total flavonoids from persimmon leaves, increasing it by 38.4% compared to direct ethanol ultrasonic extraction, while also reducing costs.
Smart Images

Figure CN116144506B_ABST
Abstract
Description
(I)TECHNICAL FIELD
[0001] The present application belongs to the field of bioengineering technology, and particularly relates to a strain of Aspergillus terreus DK3-18 and application thereof in extracting total flavones from persimmon leaves. (II)BACKGROUND
[0002] Persimmon leaf is the leaf of Diospyros kaki, and is recorded in Chinese Herbal (Song Liping, editor) and has the effects of relieving cough and asthma, producing saliva and stopping thirst, promoting blood circulation and stopping bleeding, and treating sores, and is used for treating cough and asthma, diabetes, internal hemorrhage, and sores. Modern pharmacological studies show that persimmon leaf has the effects of antioxidation, hypoglycemia, inhibiting specific dermatitis, enhancing immune function, reducing weight and lowering lipid, anticancer, and antibacterial. Persimmon leaf contains bioactive substances such as flavones, triterpenes, coumarins, and polysaccharides, among which flavones are the main components, including flavones such as formononetin, cyanidin, quercetin, isoquercetin, kaempferol, rutin, and hyperoside. In recent years, flavones are widely used in the medical and food industries due to their pharmacological effects such as lipid-lowering, antithrombosis, and antiarrhythmia, and advantages such as low toxicity, rich resources, and easy industrial extraction, and have great development value. The content of flavones in persimmon leaf is relatively high, and the content of flavones in persimmon leaves from different regions is between 1.092% and 9.428% [Sun Huapeng, Zhang Min, and Zhong Xiaohong. Study on ultrasonic-assisted extraction process of total flavones from persimmon leaves. Hunan Forestry Science and Technology, 2014, 41(5): 18-21], so persimmon leaf is a good raw material for extracting flavones.
[0003] At present, there are many reports on the extraction of total flavones from persimmon leaves, and the main methods include hot water extraction, organic solvent extraction, and CO2 supercritical extraction, and the last two methods are assisted by ultrasonic waves, microwaves, surfactants, and enzymolysis. Different extraction methods have their own advantages and disadvantages, and the yield of total flavones also differs greatly. For example, hot water extraction has low cost, but the yield of total flavones is poor, and the contents of polysaccharides and proteins in the extract are high; the organic solvent extraction method uses ethanol for extraction, and has the advantages of high yield and high purity of the product; the ultrasonic or microwave-assisted extraction method increases ultrasonic or microwave treatment on the basis of water extraction or ethanol extraction, promotes the dissolution of total flavones, and has a certain improvement in the yield; the CO2 supercritical extraction method has high purity of the extracted total flavones, but the yield is often not high, and the equipment requirements are relatively high; the enzyme-assisted extraction method has mild extraction conditions and small damage to the structure of flavones, but the effect of improving the yield is often not ideal, and the cost of commercial pure enzyme is high. Compared with the above-mentioned extraction methods, ultrasonic-assisted ethanol extraction has certain advantages, and has relatively high yield and product purity, and the ethanol can be recycled and reused, and the cost of ultrasonic wave is also low.
[0004] In recent years, enzyme-assisted extraction technology has been widely used in the extraction of plant active ingredients, and there have been reports of its application in the extraction of persimmon leaf total flavonoids. The extraction rate of total flavonoids can be significantly improved. For example, Yuan Xiuping et al. used a composite enzyme (including cellulase, hemicellulase, pectinase and beta-glucanase) to assist in ultrasonic-assisted extraction of persimmon leaf total flavonoids, and the extraction rate was 7.16%, which was 24.5% higher than that of the control group without enzyme [Yuan Xiuping, Hua Yanqing, Wang Yunyun. Process optimization of composite enzyme assisted ultrasonic extraction of persimmon leaf total flavonoids. China Food Additives, 2019, 30(8): 103-108]; In the study of Xue Xuanji et al., the extraction rate of flavonoids was increased from 3.40% to 5.70% by using composite enzyme assisted ethanol reflux extraction, which was increased by 67.6% [Xue Xuanji, Luo Jun, Zhang Xinxin, et al. Process screening and optimization of semi-bionic enzyme extraction of total flavonoids from persimmon leaf. China Pharmacy, 2017, 28(13): 1813-1816]. The composition of plant cell wall includes cellulose, hemicellulose, lignin, pectin and protein, etc. The effect of using composite enzyme to assist in the extraction of plant active ingredients is often better than using a single enzyme, but the use of multiple enzymes undoubtedly increases the extraction cost.
[0005] Microorganisms can produce a variety of plant tissue-degrading hydrolytic enzymes, including cellulase, hemicellulase, ligninase, pectinase and protease, etc., especially some molds, such as Aspergillus spp., Rhizopus spp. and Trichoderma spp. Therefore, if a certain microorganism is cultured under suitable conditions, the fermentation broth contains a large amount of hydrolytic enzymes, and the plant raw material is directly hydrolyzed by using the fermentation broth (crude enzyme solution). These enzymes can synergistically decompose the cell wall components, thereby facilitating the release of active ingredients, and thus significantly improving the extraction rate.
[0006] In order to improve the extraction rate of persimmon leaf total flavonoids, the crude enzyme solution prepared by microbial fermentation is used to hydrolyze persimmon leaves, which can significantly improve the extraction rate of persimmon leaf total flavonoids. (Three) Summary of the Invention
[0007] The purpose of the present application is to provide a new strain of microorganism—Aspergillus terreus DK3-18 and its application in the extraction of persimmon leaf total flavonoids. After the crude enzyme solution prepared by the fermentation of the strain is hydrolyzed, the extraction rate of total flavonoids can be significantly improved.
[0008] The technical scheme adopted by the present application is:
[0009] The application provides a new microbial strain, Aspergillus terreus DK3-18, which is preserved in the Guangdong Microbial Culture Collection Center, has a preservation number of GDMCC No:62857, a preservation date of October 12, 2022, an address of 59, 5th Floor, Building 100, Xianlie Middle Road, Guangzhou, Guangdong, and a postal code of 510070.
[0010] The Aspergillus terreus DK3-18 is an excellent strain isolated from a microbial enrichment culture of persimmon leaves, and is obtained through screening and mutagenic breeding. The colony morphological characteristics of the Aspergillus terreus DK3-18 are as follows: on a potato dextrose agar (PDA) plate culture medium, 30 DEG C culture is carried out for 1 day, and radially gray-white hyphae grow along both sides of the inoculation line, then the center gradually turns into a soil yellow color, and the edge is gray-white; after 3 days of culture, the colony center is soil yellow, has wrinkles, the back is brown yellow, and the surface is soil yellow and powdery with more spores; the conidial phialide is short, straight or curved; the metula is hemispherical, the small stem is double-layered, covers two-thirds of the upper end of the metula, and is fan-shaped; the conidium is spherical to nearly spherical, the wall is smooth, colorless, and the diameter is about 1.5-2.5 μm. The colony photograph of the Aspergillus terreus DK3-18 after streak inoculation on a PDA plate culture medium and 30 DEG C culture for 3 days is shown in FIG. 1. Figure 1 .
[0011] The ribosomal DNA internal transcribed spacer (rDNA-ITS) nucleotide sequence of the Aspergillus terreus DK3-18 is shown in SEQ ID NO. 1.
[0012] The application also provides an application of the Aspergillus terreus DK3-18 in extracting persimmon leaf total flavonoids, and the method is as follows: (1) filtering the fermentation liquid obtained by culturing the Aspergillus terreus DK3-18, and collecting the filtrate as a crude enzyme liquid; (2) mixing the crude enzyme liquid with persimmon leaf powder, and carrying out enzymolysis at 30-35 DEG C for 6-8 h, then adding anhydrous ethanol to the enzymolysis system and carrying out ultrasonic extraction, and performing suction filtration to obtain a total flavonoid extract; and (3) performing vacuum evaporation on the total flavonoid extract, dissolving in anhydrous ethanol, and performing vacuum drying to obtain a total flavonoid extract.
[0013] Further, the crude enzyme solution preparation method of step (1) is as follows: spores of Aspergillus terreus DK3-18 are inoculated into an enzyme production culture medium, and cultured at 30℃ with 180-200r / min shaking for 60-68h; the fermentation broth is filtered, and the filtrate is the crude enzyme solution; the enzyme production culture medium has the following final concentrations: corn flour 40-50g / L, peptone 4-5g / L, (NH4)2SO5-6g / L, KH2PO4 3-5g / L, MgSO4·7H2O 0.5-1.0g / L, CaCl2 0.3-0.5g / L, FeSO4·7H2O 0.1-0.2g / L, and the solvent is tap water, and the pH is 6.0-6.5.
[0014] Further, preferably, the enzyme production culture medium has the following composition: corn flour 50g / L, peptone 4g / L, (NH4)2SO4 6g / L, KH2PO4 5g / L, MgSO4·7H2O 1.0g / L, CaCl2 0.5g / L, FeSO4·7H2O 0.1g / L, and the solvent is tap water, and the pH is 6.0.
[0015] Before the enzyme production culture of the Aspergillus terreus DK3-18, spores are first produced by plate culture medium, and then the spores are suspended in physiological saline to obtain the Aspergillus terreus DK3-18 spore solution, which is inoculated into the enzyme production culture medium at a volume fraction of 4%-5% for culture, and the specific enzyme production culture method is as follows:
[0016] ①Spore solution preparation: Aspergillus terreus DK3-18 is inoculated into a potato dextrose agar (PDA) plate culture medium, and cultured at 30℃ for 56-64h to obtain a plate culture; sterile physiological saline is added to the plate culture, and the spores are suspended by stirring with an inoculation loop to obtain the Aspergillus terreus DK3-18 spore solution; the PDA plate culture medium has the following final concentrations: potato 200g / L (cut into small pieces, boiled in water for 20min, and the residue is retained), glucose 20g / L, agar 20g / L, and the solvent is tap water, and the pH is natural (measured as 6.6).
[0017] ②Enzyme production culture: the Aspergillus terreus DK3-18 spore solution prepared in step ① is inoculated into the enzyme production culture medium at a volume fraction of 4%-5%, and cultured at 30℃ with 180-200r / min shaking for 60-68h to obtain a fermentation broth with a dry cell concentration of 4.37-4.52g / L and a cellulase activity of 85.7-88.2U / mL.
[0018] Further, the volume of the crude enzyme liquid in step (2) is 6-10 mL / g of the mass of the persimmon leaf powder [i.e. the ratio of material to enzyme is 1:6-1:10 (g:mL)], wherein the persimmon leaf powder is obtained by drying fresh persimmon leaves at 85°C after washing with tap water, crushing and sieving through a 40-mesh sieve. The volume of anhydrous ethanol is 1.5-2.0 times the volume of the crude enzyme liquid.
[0019] Further, the preparation method of the total flavone extract liquid in step (2) is as follows: after the enzyme hydrolysis of the persimmon leaf is completed, anhydrous ethanol is added to the enzyme hydrolysis system in an amount of 1.5-2.0 times the volume of the crude enzyme liquid, so that the volume fraction of ethanol in the system reaches 60%-66.7%, and the ratio of material to liquid is 1:18-1:25 (g:mL). After shaking, the system is extracted in an ultrasonic cleaning machine with a water temperature of 60-70°C and a power of 100-200W for 30-40 min. After the ultrasonic alcohol extraction is completed, the system is filtered while hot to obtain the total flavone extract liquid.
[0020] Further, the method for recovering total flavones from the total flavone extract liquid in step (3) is as follows: the total flavone extract liquid is distilled at 45°C and -0.1 MPa until no liquid flows out, anhydrous ethanol is added in an amount of 1-2 mL / g of the mass of the raw persimmon leaves, the system is shaken thoroughly and then centrifuged at 8000 r / min for 5-10 min, the supernatant is transferred into a clean petri dish, and the petri dish is dried at 50°C and -0.1 MPa to obtain the total flavone extract.
[0021] Compared with the prior art, the present application has the following beneficial effects: before the total flavones are extracted from persimmon leaves by ultrasonic extraction with ethanol, the crude enzyme liquid prepared by microbial fermentation is added for enzyme hydrolysis. The enzyme-producing microorganism Aspergillus terreus DK3-18 is obtained by targeted isolation and screening based on the ability to hydrolyze plant tissues of persimmon leaves. The crude enzyme liquid prepared by enzyme-producing fermentation contains various hydrolytic enzymes, which can synergistically hydrolyze cellulose, pectin and other substances in persimmon leaves, cause the cell wall to be damaged, help the dissolution of flavonoids, and significantly improve the yield of total flavones. The method for enzyme hydrolysis of persimmon leaves provided by the present application can improve the yield of total flavones extracted from persimmon leaves by 38.4% compared with the direct ultrasonic extraction method with ethanol. (Four)BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 It is a colony photograph of Aspergillus terreus DK3-18 cultured on PDA at 30°C for 3 days.
[0023] Figure 2 It is a standard curve for determining total flavones by spectrophotometry.
[0024] Figure 3 It is a standard curve for determining glucose by the DNS method. (Five)DETAILED DESCRIPTION
[0025] The application will be further described in connection with specific examples, but the scope of the application is not limited to the following:
[0026] The persimmon leaf described in the application is the leaf of Diospyros kaki, which is collected from Hangzhou, Zhejiang Province. The persimmon leaf powder is prepared by washing fresh persimmon leaves with tap water, drying at 85°C, crushing, and then passing through a 40-mesh sieve.
[0027] Example 1: Isolation and screening of enzyme-producing strains
[0028] The enzyme-producing microbial strains for persimmon leaf enzymolysis are obtained by isolation and screening according to the following steps:
[0029] (1) 10 g of persimmon leaf powder was added to a 250-mL triangular flask, 15 mL of sterile normal saline was added and stirred uniformly, and then cultured at 30°C for 72 h. The enrichment culture covered with mold was diluted by 1×10 -6 , 1×10 -7 , 1×10 -8 times with sterile normal saline, respectively, 0.1 mL of the diluent was taken and spread on a potato dextrose agar plate culture medium (PDA) respectively, and then cultured at 30°C for 48 h, the mold colonies with different colors and shapes were picked and transferred to fresh PDA plate culture medium, and then cultured at 30°C for 64 h, 7 pure culture strains were obtained, and the strain numbers are shown in Table 1.
[0030] (2) 10 mL of sterile normal saline was added to the fresh plate culture of the 7 strains, and the spore suspension was obtained by stirring with an inoculation loop.
[0031] (3) 2 mL of the spore liquid prepared in step (2) was taken and inoculated into 50 mL of enzyme-producing medium (the inoculation amount was 4% of the volume fraction), and then cultured at 30°C under the condition of 200 r / min vibration for 68 h, and then all the fermentation liquid was filtered by a Buchner funnel, and the collected filtrate was the crude enzyme liquid.
[0032] (4) 1 g of persimmon leaf powder was added to 7 50-mL centrifugal tubes, 10 mL of the crude enzyme liquid of each strain prepared in step (3) was added [i.e. the material to enzyme ratio was 1:10 (g:mL)], and then stirred uniformly, and then enzymolyzed at 30°C for 8 h, and then the persimmon leaf enzymolysis products were obtained.
[0033] (5) 15 mL of anhydrous ethanol [1.5 times the volume of the crude enzyme liquid, the ethanol volume fraction in the system was 60%, and the material to liquid ratio was 1:25 (g:mL)] was added to all the persimmon leaf enzymolysis products enzymolyzed by the crude enzyme liquid of each strain in step (4). After shaking, it was placed in an ultrasonic cleaning machine with a water temperature of 60°C and a power of 200W for 30 min, and then filtered by a Buchner funnel while hot, and then the filtrate was collected, and the total flavonoid content was determined by spectrophotometry.
[0034] Starting from step (4), 10 mL of non-inoculated enzyme-producing medium instead of crude enzyme solution was used for non-enzymatic control; 10 mL of cellulase phosphate buffer (pH 6.0, 0.2 mol / L) with a vitality of 2000 U / mL instead of crude enzyme solution was used for cellulase enzymatic control. The total flavonoid yield of persimmon leaves enzymatically hydrolyzed by crude enzyme solution of different strains and controls is shown in Table 1.
[0035] Table 1 Total flavonoid yield of persimmon leaves enzymatically hydrolyzed by crude enzyme solution of different strains and controls
[0036]
[0037] As shown in Table 1, the total flavonoid yield of persimmon leaves enzymatically hydrolyzed by crude enzyme solution prepared by DK3 strain fermentation was 6.74%, which was 15.0% higher than that of the non-enzymatic control of 5.86%. The total flavonoid yield of persimmon leaves treated with cellulase also increased by 9.73% compared with the non-enzymatic control, but was far less than that of the crude enzyme solution prepared by DK3 strain fermentation. The total flavonoid yield of persimmon leaves enzymatically hydrolyzed by crude enzyme solution of some microbial strains did not increase, and even decreased, such as DK5 strain. The above results show that the microbial strain used for enzymatic hydrolysis of persimmon leaves to increase the total flavonoid yield is selective, which not only requires the ability to produce enzyme to hydrolyze the cell wall components of persimmon leaves, but also requires the ability not to produce enzyme to degrade flavonoids. The DK3 strain is selected as the enzyme-producing strain for increasing the total flavonoid yield of persimmon leaves in the present application.
[0038] The PDA flat plate culture medium is prepared according to the following composition and method: 200 g of peeled and cut potatoes with an edge length of about 1 cm are added to 1000 mL of tap water, boiled for 20 min, filtered with 4 layers of gauze to remove residues, the filtrate is supplemented to 1000 mL, 20 g of glucose and 20 g of agar are added, the pH is natural (measured to be about 6.5), after heating to dissolve the agar, it is divided into triangular flasks, sterilized by high-pressure steam at 121°C for 20 min, and poured into sterile culture dishes with a diameter of 9 cm before solidification, 15-20 mL per dish.
[0039] The final concentration composition and preparation method of the enzyme-producing medium are as follows: corn powder 50 g / L, peptone 4 g / L, (NH4)2SO4 6 g / L, KH2PO4 5 g / L, MgSO4·7H2O 1.0 g / L, CaCl2 0.5 g / L, FeSO4·7H2O 0.1 g / L, solvent is tap water, pH 6.0. 50 mL of enzyme-producing medium is placed in a 250-mL triangular flask, the opening is sealed with 8 layers of gauze, and sterilized by high-pressure steam at 121°C for 20 min.
[0040] The total flavonoid content is determined by spectrophotometry, and the specific method is as follows: 2.5 mL of total flavonoid extract (the sample amount is appropriately adjusted according to the total flavonoid concentration in the sample, and the determination A510 = 0.2 - 0.8, the total flavonoids extract was dissolved with 60% ethanol aqueous solution), 0.4 mL of 5% sodium nitrite (NaNO2) aqueous solution was added in a 10-mL graduated test tube, and it was allowed to stand for 6 min. Then, 0.6 mL of 10% aluminum nitrate (Al(NO3)3) aqueous solution was added, and it was allowed to stand for 6 min. Then, 2 mL of 20% sodium hydroxide (NaOH) aqueous solution was added, and it was diluted to 10 mL with 60% ethanol aqueous solution. After shaking, it was allowed to stand for 15 min, and the absorbance (A 510 ) at 510 nm was measured by a spectrophotometer. The total flavonoids concentration in the sample was calculated according to the rutin standard curve, and then the total flavonoids mass was calculated by multiplying the concentration with the volume of the sample.
[0041] Preparation of the Rutin Standard Curve: The rutin standard solution with a concentration of 0.25 g / L was prepared with 60% ethanol aqueous solution. 0, 0.5, 1.0, 1.5, 2.0, and 2.5 mL of the rutin standard solution was taken in 10-mL graduated test tubes, respectively, and it was diluted to 2.5 mL with 60% ethanol aqueous solution. Then, 0.4 mL of 5% sodium nitrite aqueous solution was added, and it was allowed to stand for 6 min. Then, 0.6 mL of 10% aluminum nitrate aqueous solution was added, and it was allowed to stand for 6 min. Then, 2 mL of 20% sodium hydroxide aqueous solution was added, and it was diluted to 10 mL with 60% ethanol aqueous solution. After shaking, it was allowed to stand for 15 min, and the absorbance (A 510 ) at 510 nm was measured by a spectrophotometer. The rutin concentration was taken as the abscissa, and A 510 was taken as the ordinate to draw the standard curve. Figure 2
[0042] The total flavonoids yield from persimmon leaves was calculated according to the following formula:
[0043]
[0044] Example 2: Mutagenesis Breeding of Fermentation Strain DK3
[0045] Mutagenesis breeding was performed on strain DK3 to screen strains with excellent fermentation performance. The specific method was as follows:
[0046] (1) Preparation of Spore Liquid: After strain DK3 was cultured at 30°C for 56 h on PDA plate medium, 5 mL of sterile normal saline was added, and the spores were suspended by stirring with an inoculation loop. 1 mL of the spore liquid was transferred to a triangular flask containing 50 mL of sterile normal saline (with 20-30 glass beads), and it was shaken for 15 min. The spore liquid was filtered to remove mycelium (a small bundle of fluffy defatted cotton was plugged at the bottom of the triangular funnel), and the spores in the spore liquid were counted under a microscope using a hemocytometer. The spore liquid was appropriately diluted with sterile normal saline to adjust the number of spores to 1.43 x 107 0.5 mL.
[0047] (2) Mutagenesis: Under red light illumination, 1.5 mL of the spore liquid and a sterile paper clip were taken respectively in 5 culture dishes with a diameter of 6 cm, and the culture dishes were placed on a magnetic stirrer, and irradiated for 1, 2, 3, 4, 5 and 6 min respectively under a 15 W ultraviolet lamp with a distance of 30 cm after preheating for 30 min. 0.5 mL of the spore liquid after the irradiation treatment was taken, and after appropriate dilution, 0.1 mL was taken and spread on PDA plate culture medium. The same operation was performed on the spore liquid without ultraviolet irradiation to dilute and spread on the plate as a control to calculate the mortality rate. The inoculated PDA plate was wrapped with a black cloth and inverted and cultured at 30°C for 48 h, and the colonies on the plate were counted to calculate the mortality rate.
[0048] (3) Screening: the colonies on the PDA plate with a mortality rate of more than 90% were selected and transferred to fresh PDA plate culture medium to obtain 40 strains. 10 mL of sterile normal saline was added to each strain in the fresh plate culture medium after 30°C culture for 64 h, and the spores were suspended by stirring with an inoculation loop to obtain the spore liquid of each strain. 2 mL of the spore liquid of each strain was inoculated into 50 mL of enzyme-producing culture medium, and after 30°C, 200 r / min shaking culture for 68 h, the fermentation liquid was filtered with a Buchner funnel, the filtrate was collected, and the cellulase activity of the fermentation filtrate of each strain was determined. 13 strains with relatively high enzyme activity were selected, and the crude enzyme liquid of the 13 strains was used to hydrolyze persimmon leaves according to the method of Example 1, and the total flavonoids were extracted by ultrasonic extraction with ethanol. The total flavonoid extraction yield of the persimmon leaves hydrolyzed by the crude enzyme liquid of the mutant strain and the control is shown in Table 2.
[0049] Table 2 Total flavonoid extraction yield of persimmon leaves hydrolyzed by the crude enzyme liquid of the mutant strain and the control
[0050]
[0051]
[0052] As can be seen from the data in Table 2, among the 13 strains screened, the strain numbered DK3-18 has a cellulase activity of 87.3 U / mL, which is 48.7% higher than that of the wild strain DK3 of 58.7 U / mL. After the persimmon leaves are hydrolyzed by the crude enzyme liquid prepared by the strain, the total flavonoid extraction yield is 8.02%, which is 19.0% higher than that of the wild strain DK3 of 6.74%, and 36.9% higher than that of the control without enzyme hydrolysis of 5.86%. Therefore, the DK3-18 strain is selected as the enzyme-producing strain for improving the total flavonoid extraction yield of persimmon leaves.
[0053] The final concentration composition and preparation method of the enzyme-producing culture medium are the same as those of Example 1.
[0054] The cellulase activity determination: 1.5 mL of 10 g / L sodium carboxymethyl cellulose solution (pH 6.0, 0.2 mol / L phosphate buffer) and 0.5 mL of crude enzyme solution were added into a 10-mL graduated test tube respectively, and then the test tube was incubated in a 50°C water bath for 30 min. Then 3 mL of DNS reagent was added, and boiled for 5 min. After cooling with running water, deionized water was added to make the volume to 10 mL, and then shaken well. The same treatment was performed on the crude enzyme solution which was inactivated by boiling at 100°C for 10 min, and the result was used as a reference. The absorbance (A 540 ) at 540 nm was measured by a spectrophotometer. The glucose concentration in the sample was calculated according to the glucose standard curve Figure 3 , and then the cellulase activity (U / mL) was calculated. The definition of cellulase activity: the amount of enzyme required to hydrolyze 1 μg of glucose from sodium carboxymethyl cellulose per minute at pH 6.0 and 50°C is 1 unit of enzyme activity (U).
[0055] The cellulase activity was calculated according to the following formula (1).
[0056]
[0057] In formula (1), C: the glucose concentration (mg / mL) calculated according to the standard curve; V1: the volume of enzyme reaction system, i.e. 2 mL; T: the reaction time, i.e. 30 min; V2: the volume of crude enzyme solution, i.e. 0.5 mL.
[0058] Preparation of glucose standard curve: 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 mL of standard glucose aqueous solution with a concentration of 1 mg / mL were added into 6 10-mL graduated test tubes respectively, and then 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, 0.8 mL of pH 6.0, 0.2 mol / L phosphate buffer was added into each test tube respectively. Then 3.0 mL of DNS solution was added into each test tube, and the mixture was boiled in a boiling water bath for 5 min. After cooling with running water, deionized water was added to make the volume to 10 mL, and then shaken well. The absorbance (A 540 ) at 540 nm was measured by a spectrophotometer. The glucose concentration was taken as the abscissa, and the absorbance (A 540 ) was taken as the ordinate to draw the standard curve Figure 3 .
[0059] Preparation of DNS reagent: 6.3 g of 3,5-dinitrosalicylic acid, 262 mL of 2 mol / L NaOH aqueous solution were added into 500 mL of hot water solution containing 182 g of sodium tartrate, and then 5 g of heavy steam phenol and 5 g of sodium sulfite were added. After stirring and dissolving, deionized water was added to make the volume to 1 L after cooling. The solution was stored in a brown bottle, and used after 7 days.
[0060] Example 3: Classification and identification of strain DK3-18
[0061] Strain DK3-18 was streaked on PDA plate medium and incubated at 30°C for 1 day. Radial gray-white mycelium grew along both sides of the inoculation line, and then the center gradually turned to tan, and the edge was gray-white. After 3 days of incubation, the colony was tan on the front side and brownish yellow on the back side, with wrinkles in the center and a tan powdery spore on the surface. The conidiophores were short, straight or curved. The apothecia were hemispherical, with double-layered phialides covering two-thirds of the upper end of the apothecia in a fan shape. The conidia were spherical to subspherical, smooth, colorless, and about 1.5-2.5 μm in diameter. The colony photograph of Aspergillus terreus DK3-18 streaked on PDA plate medium and incubated at 30°C for 3 days is shown in FIG. 1. Figure 1 .
[0062] The rDNA-ITS nucleotide sequence of strain DK3-18 was measured as SEQ ID NO. 1, which was subjected to BLAST comparison on NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov) and had 100% homology with the rDNA-ITS sequence of the typical strain ATCC1012 of Aspergillus terreus. The colony morphology of strain DK3-18 also conformed to the colony morphology characteristics of Aspergillus terreus (reference Mycobank, http: / / www.mycobank.org). Therefore, it can be determined that the biological classification position of strain DK3-18 is: Fungi, Ascomycota, Pezizomycotina, Eurotiomycetes, Eurotiomycetidae, Eurotiales, Aspergillaceae, Aspergillus, Aspergillus terreus.
[0063] The rDNA-ITS sequence of the strain DK3-18 is:
[0064] CTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT.
[0065] In summary, strain DK3 was isolated from the persimmon leaf powder microbial enrichment, and after UV mutagenesis, strain DK3-18, Aspergillus terreus DK3-18, was screened. The strain is preserved in the Guangdong Microbial Culture Collection Center, with the preservation number GDMCC No:62857, the preservation date October 12, 2022, the address 59, Building 5, Guangzhou, Guangdong Province, China, and the postcode 510070.
[0066] Example 4: Application of Aspergillus terreus DK3-18 for enzyme-assisted extraction of total flavonoids from persimmon leaves
[0067] The total flavonoids in persimmon leaves can be extracted by Aspergillus terreus DK3-18 according to the following steps:
[0068] (1) Freeze-dried Aspergillus terreus DK3-18 spore powder was inoculated on fresh PDA plate culture medium and incubated at 30°C for 64 h. 10 mL of sterile normal saline was added to the plate culture, and the spore suspension was obtained by stirring with a inoculation loop. The PDA plate culture medium had the same composition and preparation method as in Example 1.
[0069] (2) 4 mL of the spore solution prepared in step (1) was inoculated into 100 mL of enzyme production medium (inoculation volume was 4%), and cultured at 30°C and 200 r / min under shaking conditions for 68 h to obtain a fermentation liquid with a dry cell concentration of 4.56 g / L. The entire fermentation liquid was filtered using a Buchner funnel, and the collected filtrate was the crude enzyme liquid, with a cellulase activity of 88.2 U / mL. The final concentration composition of the enzyme production medium was the same as in Example 1. 100 mL of the enzyme production medium was placed in a 250-mL conical flask, the mouth of the flask was sealed with 8 layers of gauze, and sterilized with high-pressure steam at 121°C for 20 min.
[0070] (3) 5 g of persimmon leaf powder was added to a 250-mL conical flask, 50 mL of the crude enzyme solution prepared in step (2) was added [i.e., the feed-enzyme ratio was 1:10 (g:mL)], and the mixture was stirred evenly and then enzymolyzed at 30°C for 8 h to obtain persimmon leaf hydrolysate.
[0071] (4) Add 75 mL of anhydrous ethanol (1.5 times the volume of the crude enzyme solution, 60% ethanol volume fraction, solid-liquid ratio 1:25 (g:mL)) to the entire persimmon leaf hydrolysate from step (3). Shake well and extract in an ultrasonic cleaner at 60°C and 200W for 30 min. After ultrasonic alcohol extraction, filter through a hot Buchner funnel to obtain a total flavonoid extract.
[0072] (5) The total flavonoid extract prepared in step (4) was distilled under reduced pressure at 45° C. and −0.1 MPa until no liquid flowed out, 10 mL of anhydrous ethanol (2 mL / g based on the mass of the raw material persimmon leaf powder) was added, and after sufficient shaking, the mixture was transferred to a centrifuge tube and centrifuged at 8000 r / min for 5 min. The supernatant was transferred to a clean culture dish and vacuum dried at 50° C. and −0.1 MPa to obtain a total flavonoid extract.
[0073] According to the above steps, 1.02 g of total flavonoid extract was obtained, with a total flavonoid content of 39.6%, that is, 0.404 g of total flavonoids was obtained, and the extraction yield was 8.08%.
[0074] Comparative Example 1: Extraction of Total Flavonoids from Persimmon Leaves without Enzymatic Hydrolysis (Compared with Example 4)
[0075] (1) 5 g of persimmon leaf powder was added to 125 mL of 60% ethanol in a 250 mL Erlenmeyer flask (material-liquid ratio 1:25 (g:mL)). The mixture was shaken and then extracted in an ultrasonic cleaner at 60°C and 200 W for 30 min. After ultrasonic extraction, the mixture was filtered through a hot Buchner funnel to obtain the total flavonoid extract.
[0076] (2) The total flavone extract prepared in step (1) was distilled at 45°C under reduced pressure of -0.1 MPa until no liquid was discharged, 10 mL of anhydrous ethanol (2 mL / g based on the mass of persimmon leaf powder) was added, and the mixture was shaken thoroughly and then transferred into a centrifuge tube. The supernatant was obtained by centrifugation at 8000 r / min for 5 min, and the supernatant was transferred into a clean petri dish. The supernatant was dried at 50°C under vacuum of -0.1 MPa to obtain the total flavone extract.
[0077] According to the above steps, 0.782 g of the total flavone extract was obtained, and the total flavone content was 37.3%, i.e., 0.292 g of total flavones was obtained, and the extraction yield was 5.84%.
[0078] As can be seen from the results of Comparative Example 1 and Example 1, the total flavone extraction yield was increased from 5.84% to 8.08% by increasing the enzyme hydrolysis of the crude enzyme solution prepared by fermentation of Aspergillus terreus DK3-18 before extracting the total flavones from persimmon leaves, which was increased by 38.4%.
[0079] Example 5: Application of Aspergillus terreus DK3-18 enzyme hydrolysis for assisting extraction of total flavones from persimmon leaves
[0080] The total flavones in persimmon leaves can be extracted by enzyme hydrolysis of Aspergillus terreus DK3-18 according to the following steps:
[0081] (1) The Aspergillus terreus DK3-18 PDA colony spores stored at 4°C were inoculated into fresh PDA plate culture medium, and cultured at 30°C for 60 h. 10 mL of sterile normal saline was added to the plate culture, and the spores were suspended by stirring with an inoculation loop to obtain a spore solution of Aspergillus terreus DK3-18. The composition and preparation method of the PDA plate culture medium were the same as in Example 1.
[0082] (2) 5 mL of the spore solution prepared in step (1) was inoculated into 100 mL of enzyme production medium (inoculation amount of 5% by volume fraction), and cultured at 30°C under the condition of 180 r / min shaking for 64 h to obtain a fermentation liquid with a dry cell concentration of 4.47 g / L. The fermentation liquid was filtered through a Buchner funnel, and the collected filtrate was the crude enzyme solution. The cellulase activity of the filtrate was 86.8 U / mL. The composition and preparation method of the enzyme production medium were the same as in Example 4.
[0083] (3) 10 g of persimmon leaf powder was added into a 250-mL triangular flask, and 80 mL of the crude enzyme solution prepared in step (2) was added [i.e., the material to enzyme ratio was 1:8 (g:mL)]. After stirring uniformly, the mixture was subjected to enzyme hydrolysis at 35°C for 7 h to obtain a persimmon leaf hydrolysate.
[0084] (4) Step (3) in all persimmon leaf enzymatic hydrolysate, add 160 mL of absolute ethanol [2 times the volume of crude enzyme liquid, the system ethanol volume fraction 66.7%, the ratio of 1:24 (g:mL)]. After shaking, placed in the ultrasonic cleaning machine at water temperature 65℃, power 150W extraction 35 min. After ultrasonic alcohol extraction, hot Buchner funnel filtration, total flavonoids extract.
[0085] (5) Step (4) prepared total flavonoids extract at 45℃, -0.1 MPa reduced pressure distillation to no liquid outflow, add 15 mL of absolute ethanol (1.5 mL / g according to the mass of persimmon leaf powder), fully oscillated into a centrifuge tube, centrifugation at 8000 r / min for 8 min, the supernatant into a clean petri dish, 50℃, -0.1 MPa vacuum drying, total flavonoids extract.
[0086] According to the above steps, the total flavonoids extract 1.88 g, the total flavonoids content of 43.1%, namely the total flavonoids 0.810 g, the yield of 8.10%.
[0087] Comparative Example 2: persimmon leaf total flavonoids extraction without enzymolysis (compared with Example 5)
[0088] (1) 10 g of persimmon leaf powder in a 500-mL flask, add 240 mL of 66.7% ethanol aqueous solution [system ratio of 1:24 (g:mL)]. After shaking, placed in the ultrasonic cleaning machine at water temperature 65℃, power 150W extraction 35 min. After ultrasonic alcohol extraction, hot Buchner funnel filtration, total flavonoids extract.
[0089] (2) Step (1) prepared total flavonoids extract at 45℃, -0.1 MPa reduced pressure distillation to no liquid outflow, add 15 mL of absolute ethanol (1.5 mL / g according to the mass of persimmon leaf powder), fully oscillated into a centrifuge tube, centrifugation at 8000 r / min for 8 min, the supernatant into a clean petri dish, 50℃, -0.1 MPa vacuum drying, total flavonoids extract.
[0090] According to the above steps, the total flavonoids extract 1.45 g, the total flavonoids content of 40.6%, namely the total flavonoids 0.589 g, the yield of 5.89%.
[0091] Comparing the results of Example 5 and Comparative Example 2 can be seen: before extracting persimmon leaf total flavonoids, the crude enzyme liquid prepared by Aspergillus terreus DK3-18 fermentation was increased, and the total flavonoids extraction yield was increased by 37.5% from 5.89% to 8.10%.
[0092] Example 6: Application of Aspergillus terreus DK3-18 enzymolysis assisted extraction of persimmon leaf total flavonoids
[0093] The total flavones in persimmon leaves can be extracted by using Aspergillus terreus DK3-18 enzymolysis, which can be operated according to the following steps:
[0094] (1) The Aspergillus terreus DK3-18 PDA colony spores stored at 4℃ were inoculated into fresh PDA plate culture medium and cultured at 30℃ for 56h. 10mL of sterile normal saline was added to the plate culture, and the spores were suspended by stirring with an inoculation loop to obtain the spore solution of Aspergillus terreus DK3-18. The PDA plate culture medium had the same composition and preparation method as in Example 1.
[0095] (2) 7.5mL of the spore solution prepared in step (1) was inoculated into 150mL of enzyme-producing culture medium (inoculation amount of 5% by volume fraction), and cultured at 30℃ under the condition of 180r / min shaking for 60h to obtain a fermentation liquid with a dry cell concentration of 4.35g / L. The whole fermentation liquid was filtered by a Buchner funnel, and the collected filtrate was the crude enzyme liquid. The cellulase activity of the filtrate was 85.4U / mL. The enzyme-producing culture medium had the same final concentration composition as in Example 1, and 150mL of enzyme-producing culture medium was placed in a 500-mL triangular flask, which was sealed with 8 layers of gauze and sterilized by high-pressure steam at 121℃ for 20min.
[0096] (3) 20g of persimmon leaf powder was placed in a 500-mL triangular flask, and 120mL of the crude enzyme liquid prepared in step (2) was added [i.e. the material to enzyme ratio was 1:6 (g:mL)]. After stirring uniformly, the enzyme hydrolysis was carried out at 35℃ for 6h to obtain persimmon leaf hydrolysate.
[0097] (4) 240mL of anhydrous ethanol [2 times the volume of the crude enzyme liquid, the ethanol volume fraction in the system was 66.7%, and the material to liquid ratio was 1:18 (g:mL)] was added to the whole persimmon leaf hydrolysate of step (3). After shaking uniformly, it was placed in an ultrasonic cleaning machine with a water temperature of 70℃ and a power of 100W for extraction for 40min. After the ultrasonic alcohol extraction was completed, it was filtered by a Buchner funnel while hot to obtain the total flavone extract.
[0098] (5) The total flavone extract prepared in step (4) was distilled at 45℃ under reduced pressure of -0.1MPa until no liquid flowed out. 20mL of anhydrous ethanol (1mL / g based on the mass of the persimmon leaf powder) was added, and after fully shaking, it was transferred into a centrifuge tube and centrifuged at 8000r / min for 10min. The supernatant was transferred into a clean culture dish, and vacuum dried at 50℃ and -0.1MPa to obtain the total flavone extract.
[0099] According to the above steps, 3.72g of total flavone extract was obtained, with a total flavone content of 43.7%, i.e. 1.63g of total flavones was obtained, and the extraction yield was 8.15%.
[0100] Comparative Example 3: Extraction of total flavones in persimmon leaves without enzyme hydrolysis (compared with Example 6)
[0101] (1) 20 g persimmon leaf powder was added to a 500-mL triangular flask, and 360 mL of 66.7% ethanol aqueous solution [system liquid ratio 1:18 (g:mL)] was added. After shaking, it was placed in an ultrasonic cleaning machine with a water temperature of 70°C and a power of 100W for extraction for 40 min. After the ultrasonic alcohol extraction was completed, it was hot-filtered through a Buchner funnel, and total flavonoid extract was obtained.
[0102] (2) The total flavonoid extract prepared in step (1) was distilled at 45°C under reduced pressure of -0.1 MPa until no liquid flowed out, 20 mL of anhydrous ethanol (1 mL / g based on the mass of persimmon leaf powder) was added, and it was shaken thoroughly and then transferred to a centrifuge tube, which was centrifuged at 8000 r / min for 10 min. The supernatant was transferred to a clean petri dish, which was dried at 50°C under vacuum of -0.1 MPa, and total flavonoid extract was obtained.
[0103] According to the above steps, 2.94 g of total flavonoid extract was obtained, with a total flavonoid content of 40.4%, i.e., 1.19 g of total flavonoids was obtained, with a yield of 5.95%.
[0104] As can be seen from the results of Comparative Example 6 and Comparative Example 3, before extracting total flavonoids from persimmon leaves, the addition of crude enzyme solution prepared by fermentation of Aspergillus terreus DK3-18 for enzymolysis increased the yield of total flavonoids to 8.15% from 5.95%, an increase of 37.0%.
Claims
1. Aspergillus terreus ( Aspergillus terreus ) DK3-18, deposited in Guangdong Provincial Microbiological Culture Collection, deposit number: GDMCC No: 62857, deposit date October 12, 2022, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province; Postal Code: 510070.
2. The application of Aspergillus terreus DK3-18 in extracting total flavonoids from persimmon leaves according to claim 1.
3. Use according to claim 2, wherein the compound is ###0002### The method of the application is as follows: (1) filtering the fermentation broth obtained by culturing Aspergillus terreus DK3-18 to collect the filtrate as crude enzyme solution; (2) mixing the crude enzyme solution with persimmon leaf powder, and carrying out enzymolysis at 30-35℃ for 6-8 h, then adding anhydrous ethanol to the enzymolysis system and carrying out ultrasonic extraction, and then performing suction filtration to obtain total flavonoid extract; (3) evaporating the total flavonoid extract under reduced pressure, dissolving in anhydrous ethanol and vacuum drying to obtain total flavonoid extract.
4. The use according to claim 3, wherein the compound is ###0002### The method for preparing the crude enzyme solution in step (1) is as follows: inoculating spores of Aspergillus terreus DK3-18 into enzyme production medium, and culturing at 30℃ with 180-200 r / min shaking for 60-68 h, then filtering the fermentation broth to obtain the filtrate as the crude enzyme solution; the enzyme production medium has a final concentration consisting of corn flour 40-50 g / L, peptone 4-5 g / L, (NH4)2SO4 5-6 g / L, KH2PO4 3-5 g / L, MgSO4·7H2O 0.5-1.0 g / L, CaCl2 0.3-0.5 g / L and FeSO4·7H2O 0.1-0.2 g / L, and the solvent is tap water with pH 6.0-6.
5.
5. The use according to claim 4, wherein the compound is ###0002### The enzyme production medium has a final concentration consisting of corn flour 50 g / L, peptone 4 g / L, (NH4)2SO4 6 g / L, KH2PO4 5 g / L, MgSO4·7H2O 1.0 g / L, CaCl2 0.5 g / L and FeSO4·7H2O 0.1 g / L, and the solvent is tap water with pH 6.
0.
6. The use according to claim 3, wherein the compound is ###0002### Before culturing in the enzyme production medium, the Aspergillus terreus DK3-18 is first cultured in a plate medium to produce spores, and then the spores are suspended in physiological saline to obtain spore solution of Aspergillus terreus DK3-18, which is inoculated into the enzyme production medium at a volume fraction of 4%-5% for culturing; the method for preparing the spore solution is as follows: inoculating Aspergillus terreus DK3-18 into PDA plate medium, and culturing at 30℃ for 56-64 h to obtain plate culture; adding sterile physiological saline to the plate culture, and stirring with an inoculation loop to suspend the spores, thereby obtaining the spore solution of Aspergillus terreus DK3-18.
7. The use according to claim 3, wherein the compound is ###0002### The fresh persimmon leaves are washed with tap water, dried at 85℃, crushed and sieved to obtain fine powder with a mesh size of 40.
8. The use according to claim 3, wherein the compound is ###0002### The volume of the crude enzyme solution used in step (2) is 6-10 mL / g based on the mass of the persimmon leaf powder, and the volume of anhydrous ethanol used is 1.5-2.0 times the volume of the crude enzyme solution.
9. The use according to claim 3, wherein the compound is ###00003### 3 The method for preparing the total flavonoid extract in step (2) is as follows: after the enzymolysis of the persimmon leaves is completed, anhydrous ethanol with a volume 1.5-2.0 times that of the crude enzyme solution is added to the enzymolysis system to make the volume fraction of ethanol in the system reach 60%-66.7%, and then the system is stirred uniformly and placed in an ultrasonic cleaning machine with a water temperature of 60-70℃ and a power of 100-200 W for extraction for 30-40 min; after the ultrasonic extraction is completed, the total flavonoid extract is obtained by suction filtration while hot.
10. The use according to claim 3, wherein the compound is ###00003### 3a The method for recovering total flavones from the total flavone extract is as follows: the total flavone extract is distilled at 45 DEG C and -0.1 MPa until no liquid is discharged, 1-2 mL / g of anhydrous ethanol based on the mass of the raw persimmon leaves is added, and then the mixture is fully shaken and centrifuged at 8000 r / min for 5-10 min; the supernatant is transferred into a clean culture dish and dried at 50 DEG C and -0.1 MPa, thereby obtaining the total flavone extract.
Citation Information
Patent Citations
Persimmon leaf flavone with whitening and anti-aging activity, and preparation method and application thereof
CN107440963A
Strain for producing high-activity exoglucanase and application thereof
CN114989985A
Fermented tea of persimmon leaf and manufacturing method of the same
KR101381950B1