Method for knocking down transpeptidase gene to increase yield of transglutaminase
By using CRISPRi/dCas9 technology in Streptomyces in Streptocytica, the transcription level of the transpeptidase gene SMDS_318 was reduced, and the expression of transpeptidase was inhibited, which solved the problem of low TG enzyme yield, and achieved a significant increase in TG enzyme yield and a reduction in fermentation cost.
Patent Information
- Application Number
- CN202310012023.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-05
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2043-01-05
AI Technical Summary
In the prior art, Streptocytica glutamine transaminase (TG enzyme) production is relatively low, mainly due to the cross-linking effect of TG enzyme, the cell wall of the bacteria is thickened, which hinders the transport of substances and restricts the outflow of zymogen.
CRISPRi/dCas9 technology is used to reduce the transcription level of the gene SMDS_318 encoding Streptomyces IPIO transpeptidase, inhibit the expression of transpeptidase, weaken the formation of cell walls, strengthen the material transportation process, and increase the yield of TG enzymes.
At the laboratory shake flask level, TG enzyme production increased by 54%, and the fermentation cost was significantly reduced.
Smart Images

Figure CN116144566B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering technology and relates to a method for knocking down a transpeptidase gene to increase the production of glutamine transaminase. Specifically, it is a method for reducing the transcription level of SMDS_318 by using CRISPRi / dCas9 technology, inhibiting the expression of the above-mentioned transpeptidase protein, and increasing the fermentation level of TG enzyme. Background Art
[0002] TG enzyme is a kind of single subunit protein produced by Streptomyces mobaraensis, it can catalyze the amido transfer reaction between the γ-amide group of glutamine residues in protein and the ε-amino group of lysine, forming the heterotypic peptide bond of ε-(γ-glutamine)-lysine, so as to change the functional properties of protein, it is widely used in food industry protein products edible additives, cross-linked antibodies and drug molecules to produce antibody-coupled drugs, improve the intensity of wool textiles, etc., market demand increases year by year, but the enzyme output is still relatively low, urgently need to be further improved. The present invention finds that in the process of Streptomyces mobaraensis producing TG enzyme, due to the cross-linking effect of TG enzyme, the cell wall is thickened, the material transport process such as zymogen is hindered. Further, the present invention has found important transpeptidase encoding gene SMDS_318 in the process of cell wall formation by genome and transcriptome, utilizes CRISPRi technology to reduce the transcription level of above-mentioned gene, weakens the formation of cell wall and strengthens material transport process, finally improves the yield of TG enzyme. Summary of the Invention
[0003] The present invention aims to knock down the transpeptidase gene to increase the production of transglutaminase, specifically a method for inhibiting the expression of the transpeptidase SMDS_318; by using CRISPRi / dCas9 technology in Streptomyces moyuanensis IPIO to reduce the transcription level of SMDS_318 and inhibit SMDS_318 expression, the production of transglutaminase (TG enzyme) can be significantly increased.
[0004] To achieve the above objectives, the present invention provides the following technical solutions:
[0005] In a first aspect, the present invention provides a strain (WBH21) that produces high TGase, wherein the transcription of the transpeptidase gene of the strain is inhibited.
[0006] As an embodiment of the present invention, the strain is Streptomyces moyuanensis.
[0007] As one embodiment of the present invention, the strain inhibits the expression of transpeptidase.
[0008] As one embodiment of the present invention, the transcription level of the transpeptidase encoding gene SMDS_318 was reduced in Streptomyces truncatula IPIO, the expression of the transpeptidase was inhibited, and ultimately the TG enzyme production was significantly increased.
[0009] In the second aspect, the present invention relates to an integrative plasmid vector for knocking down the transcription level of a gene encoding a transpeptidase gene, wherein the vector reduces the transcription level of the transpeptidase encoding gene SMDS_318, contains a gRNA targeting the promoter region of the above-mentioned gene, and inhibits protein expression by reducing the gene transcription level.
[0010] As one embodiment of the present invention, the transpeptidase encoding gene SMDS_318 is derived from Streptomyces moyuanensis IPIO.
[0011] As an embodiment of the present invention, the sequence of the transpeptidase encoding gene SMDS_318 is shown in SEQ ID NO.1, and its corresponding gRNA SMDS_318 The sequence is shown in SEQ ID NO.2.
[0012] As one embodiment of the present invention, the inhibition of transpeptidase expression is CRISPRi interference gene transcription level.
[0013] In a third aspect, the present invention relates to a method for constructing an integrative plasmid vector for knocking down the transcription level of a transpeptidase encoding gene, comprising the following steps:
[0014] The gRNA targeting SMDS_318 was specifically designed on the CRISPy-web website, and the gRNA containing SMDS_318 The PCR fragment of the gene sequence was connected to the SpeI / EcoRI site of the integrative plasmid pSET-dCas9-actII4-NT-S1 by Gibson ligation to obtain the integrative plasmid vector pLQ2125;
[0015] As one embodiment of the present invention, the primers used for the amplification are primers SMDS_318gRNAp-F / gRNA-R whose sequences are shown as SEQ ID NO.3 / 4.
[0016] In a fourth aspect, the present invention relates to a high-TG enzyme-producing Maoyuan Streptomyces strain, wherein the aforementioned integrative plasmid vector or the integrative plasmid vector constructed by the aforementioned method is introduced into the recipient fungus Maoyuan Streptomyces through conjugation transfer for recombination to obtain the strain.
[0017] As an embodiment of the present invention, the recombination is site-specific recombination.
[0018] As an embodiment of the present invention, after the recombination, the step of obtaining a recombinant mutant strain with overexpression of the gene by resistance and PCR verification screening is also included.
[0019] In a fifth aspect, the present invention relates to a method for increasing the yield of TG enzyme by knocking down the transcription level of the transpeptidase encoding gene and inhibiting the expression of the corresponding protein to increase the yield of TG enzyme produced by Maoyuan Streptomyces IPIO fermentation.
[0020] As one embodiment of the present invention, the transpeptidase encoding gene and gRNA are SMDS_318 as shown in SEQ ID NO.1-NO.2, and gRNA SMDS_318 .
[0021] As one embodiment of the present invention, the transcription level of the transpeptidase encoding gene was knocked down in Streptomyces elegans IPIO to obtain a transpeptidase-attenuated expression mutant, which was then fermented to obtain TG enzyme. As a specific example, the transcription level of the transpeptidase encoding gene SMDS_318 was reduced in Streptomyces elegans IPIO to obtain an expression-inhibiting mutant WBH21, which was then fermented to obtain TG enzyme. By using CRISPRi / dCas9 technology in Streptomyces elegans IPIO to reduce the transcription level of the transpeptidase encoding gene, the expression of the corresponding protein was inhibited, the protein excretion process was enhanced, and the TG enzyme yield was increased.
[0022] As one embodiment of the present invention, the fermentation comprises the following steps: inoculating activated attenuated mutant spores into a seed culture medium, culturing at 25-30° C. and 200-220 rpm for 24-26 hours, transferring 6-10% of the inoculum to a fermentation medium, and fermenting at 25-30° C. and 200-220 rpm for 28-32 hours; and collecting the fermentation broth and testing for TGase activity.
[0023] As a specific example, the fermentation includes the following steps: inoculating the activated weakened mutant spores into the seed culture medium, culturing at 30°C and 200 rpm for 24-26 hours, transferring the inoculation amount to the fermentation medium at 10%, and fermenting at 30°C and 200 rpm for 28-32 hours.
[0024] As one embodiment of the present invention, the seed culture medium includes 1-3 w / v% glycerol, 0.4-0.8 w / v% yeast extract, 1-3 w / v% fish meal peptone, 0.1-0.3 w / v% MgSO4·7H2O, and 0.1-0.3 w / v% K2HPO4·3H2O. As a specific example, the seed culture medium includes 2 w / v% glycerol, 0.6 w / v% yeast extract, 2.5 w / v% fish meal peptone, 0.2 w / v% MgSO4·7H2O, and 0.2 w / v% K2HPO4·3H2O.
[0025] In one embodiment of the present invention, the fermentation medium includes 1-3 w / v% glycerol, 0.4-0.8 w / v% yeast extract, 1-3 w / v% fish meal peptone, 0.1-0.3 w / v% MgSO4·7H2O, 0.1-0.3 w / v% K2HPO4·3H2O, and 0.1-0.4 w / v% fermentation promoter. As a specific example, the fermentation medium includes 2 w / v% glycerol, 0.6 w / v% yeast extract, 2.5 w / v% fish meal peptone, 0.2 w / v% MgSO4·7H2O, 0.2 w / v% K2HPO4·3H2O, and 0.1 w / v% fermentation promoter.
[0026] The plasmid pSET-dCas9-actII4-NT-S1 involved in the present invention has been recorded in the SCI database document "Zhao Y, Li L, Zheng G, Jiang W, Deng Z, Wang Z, Lu Y. CRISPR / dCas9-Mediated Multiplex Gene Repression in Streptomyces. Biotechnol J. 2018 Sep; 13(9): e1800121."
[0027] The strain Streptomyces mobaraensis IPIO involved in the present invention was obtained by strain mutagenesis of Taixing Dongsheng Biotechnology Co., Ltd. and deposited in the China Center for Type Culture Collection (CCTCC). The deposit address is: Wuhan University, Wuhan, China; the deposit number is M 2020196, and the deposit date is 2020.6.25.
[0028] Compared with the prior art, the present invention has the following beneficial effects:
[0029] 1) The present invention found that during the fermentation process of Streptomyces moyuanensis IPIO, the cross-linking effect of TG enzyme thickened the cell wall of the bacteria, hindering the transport of substances such as the export of zymogen, which may be a factor limiting the increase in TG enzyme production. By inhibiting the expression of transpeptidase, the formation of the cell wall is weakened to enhance the material transport process, and ultimately increase the production of TG enzyme.
[0030] 2) The present invention further utilizes the integrative vector pSET-dCas9-actII4-NT-S1 in Streptomyces moyuanensis IPIO, and utilizes CRISPRi / dCas9 technology in IPIO to weaken the transcription level of the transpeptidase SMDS_318 derived from Streptomyces moyuanensis IPIO, thereby inhibiting the expression of the corresponding protein. At the laboratory shake flask level, the TG enzyme activity was increased by 54% compared with the control strain (blank vector integrated strain); the present invention can significantly increase the fermentation yield of TG enzyme, while significantly reducing the fermentation cost. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:
[0032] Figure 1 Schematic diagram of the construction of the SMDS_318 gene attenuation plasmid;
[0033] Figure 2 Schematic diagram of TG enzyme fermentation yield of the knockdown transpeptidase mutant and the control strain. DETAILED DESCRIPTION
[0034] The present invention will be described in detail below with reference to the examples. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that those skilled in the art may make several adjustments and improvements without departing from the scope of the present invention. These all fall within the scope of protection of the present invention.
[0035] The present invention relates to an integrative plasmid vector for knocking down the transcription level of a gene encoding a transpeptidase gene. The vector reduces the transcription level of the transpeptidase encoding gene SMDS_318, contains a gRNA targeting the promoter region of the gene, and inhibits protein expression by reducing the gene transcription level.
[0036] The transpeptidase encoding gene SMDS_318 is derived from Streptomyces moyuanensis IPIO.
[0037] The sequence of the transpeptidase encoding gene SMDS_318 is shown in SEQ ID NO.1, and its corresponding gRNA SMDS_318 The sequence is shown in SEQ ID NO.2.
[0038] The first step of the present invention is to construct plasmid pLQ2125: using the integration plasmid pSET-dCas9-actII4-NT-S1 as a template, using primers SMDS_318gRNAp-F / gRNA-R that introduce Gibson repeat sequences at both ends, the gRNA-containing SMDS_318The amplified fragment was inserted into the SpeI / EcoRI site of the plasmid pSET-dCas9-actII4-NT-S1 to obtain the plasmid pLQ2125. Figure 1 .
[0039] *The endonuclease recognition sites (enzyme cutting sites) involved in steps 1 to 4 are as follows:
[0040] EcoRI recognition site: SpeI recognition site:
[0041] 5'...G^AATTC...3' 5'...A^CTAGT...3'
[0042] 3'...CTTAA^G...5' 3'...TGATC^A...5
[0043] *The primer sequences used in steps 1 to 4 are:
[0044]
[0045]
[0046] *PCR system and conditions used for gene fragment preparation in steps 1 to 4:
[0047] PCR reaction system: 30 ng DNA template, 20 pmol primers, 5 μL 50% DMSO, 10 nmol dNTP, 25 μL buffer, 1 unit Taq DNA polymerase, and make up to 50 μL with purified water;
[0048] PCR conditions: 95°C for 5 min; 95°C for 15 s; 55°C for 15 s; 72°C for 25 s; 32 cycles; 72°C for 10 min.
[0049] Step 5: The plasmid vectors pLQ2125 constructed in steps 1 to 4 were introduced into the recipient strain Streptomyces elegans IPIO via conjugation for site-specific recombination. The correct conjugates were screened by resistance and PCR verification to obtain the SMDS_318 gene attenuated mutant. This specifically includes the following steps:
[0050] The plasmid pLQ2125 was transformed into the host ET12567 (pUZ8002). The corresponding ET12567 (pUZ8002) was inoculated into LB containing three antibiotics: Apr (final concentration 50 μg / mL), Kan (final concentration 50 μg / mL) and Chl (final concentration 25 μg / mL), cultured at 37°C for 20 hours, and then rinsed with fresh LB solution to remove the antibiotics in the culture. At the same time, fresh spores of Streptomyces tumefaciens IPIO (activated on solid culture medium for about 7-10 days) were collected in TES solution, heat-shocked at 50°C for 10 minutes, rinsed with LB solution 2 to 3 times, and then mixed with the previously prepared host bacteria ET12567 (pUZ8002) (the ratio of recipient bacteria cells to donor bacteria was about 10). 8 :10 9 ) was evenly spread on ISP4MYM solid medium containing 20mM magnesium ions and inverted in a 37°C incubator. After 14-16 hours, the plate was removed, and two antibiotics, apramycin (final concentration 50μg / mL) and trimethoprim (final concentration 50μg / mL), were added to 1mL of sterile water, mixed and covered on the ISP4MYM solid medium. After the solid medium was dried, it was transferred to a 30°C incubator for inverted culture. Generally, after 3-5 days, conjugates can be seen growing on the plate. They were expanded by transferring them to ISP4MYM solid medium containing two antibiotics, apramycin (final concentration 50μg / mL) and trimethoprim (final concentration 50μg / mL). The SMDS_318 gene attenuated mutant was obtained by mycelial PCR verification and screening, and was recorded as WBH21.
[0051] *The primer sequences used in step 5 are:
[0052] Primer name base sequence dCas9-YZ-F AAGGGTACCGGATCCTTGACA(SEQ ID NO.5) dCas9-YZ-R AGCGAGTCAGTGAGCGAGGAA(SEQ ID NO.6)
[0053] *The PCR system and conditions used in the fifth step to verify and screen mutants:
[0054] PCR system: DNA template 10-100 ng, primer 10 pmol, 50% DMSO 2 μL, 2× Mix buffer 10 μL, add pure water to 20 μL;
[0055] PCR conditions: 95°C for 10 min; 95°C for 30 s; 58°C for 30 s; 72°C for 30 s; 30 cycles; 72°C for 10 min.
[0056] Example 2
[0057] This example describes the fermentation process for producing TG enzyme using the attenuated mutant strain WBH21 encoding the transpeptidase gene. The specific steps are as follows: The mutant strain WBH21 is plated onto solid Gao's Medium No. 1 for activation. After incubation at 30°C for 7-10 days, spores are scraped from one plate and inoculated into a seed medium. The culture is then incubated at 30°C and 200 rpm for 24-26 hours. A 10% inoculum is then transferred to a fermentation medium and fermented at 30°C and 220 rpm for 28-32 hours. The fermentation broth is then collected and assayed for TG enzyme activity.
[0058] Table 1 Composition of seed culture medium and fermentation medium
[0059]
[0060] Example 3
[0061] This example is a method for detecting the enzyme activity of TG enzyme using colorimetry. Specifically, take 200 μL of fermentation liquid supernatant diluted 10-20 times into a test tube, add 200 μL of water to one tube as a control, add 2 mL of 37°C preheated solution A, react at 37°C for 10 minutes, and then add 2 mL of solution B to terminate the reaction. Use a quartz cuvette to measure the absorbance of the fermentation liquid at 525 nm in a spectrophotometer. Finally, the OD 525nm The enzyme activity of TG enzyme was calculated by substituting the formula obtained from the standard curve into the formula.
[0062] The solution preparation method is as follows:
[0063] Solution A: Weigh 9.688 g of tris(hydroxymethyl)aminomethane, 2.780 g of hydroxylamine hydrochloride, 1.229 g of reduced glutathione, and 4.048 g of the substrate N-benzyloxycarbonyl-L-glutamylglycine (N-α-CBZ-GLN-GLY) into a beaker, add 350 mL of water, adjust the pH to 6.0, and dilute to 400 mL with water.
[0064] Solution B: 3 mol / L hydrochloric acid, 12% trichloroacetic acid, and 3% FeCl3 dissolved in 0.1 mol / L HCl. Mix the three solutions in equal amounts.
[0065] Figure 2 The results show that the fermentation yield of TG enzyme of the mutant strain with weakened transpeptidase encoding gene and the control strain is 54% higher than that of the wild-type strain in laboratory shake flasks.
[0066] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various variations or modifications within the scope of the claims, which do not affect the essence of the present invention.
Claims
1. A high-yield strain of glutamine transaminase, characterized in that: The transpeptidase gene transcription of the strain is inhibited; the glutamine transaminase high-yielding strain is constructed by the following method: Reducing the transcription level of gene SMDS_318 in Streptomyces moyuanensis IPIO; the sequence of the gene SMDS_318 is shown in SEQ ID NO.1; The deposit number of the Maoyuan Streptomyces IPIO is CCTCCNO: M2020196.
2. A high-yield transglutaminase-producing Streptomyces Maoyuanensis strain, characterized in that: The integrative plasmid vector is introduced into the recipient strain Streptomyces elegans IPIO by conjugation transfer, and site-specific recombination is performed to obtain the strain; The integrative plasmid vector inhibits the transcription level of the transpeptidase encoding gene SMDS_318 of Streptomyces moyuanensis IPIO, contains a gRNA targeting the promoter region of the transpeptidase encoding gene SMDS_318, and inhibits protein expression by reducing the gene transcription level; the sequence of the transpeptidase encoding gene SMDS_318 is shown in SEQ ID NO.1, and its corresponding gRNA SMDS_318 The sequence is shown in SEQ ID NO.2; The deposit number of the Maoyuan Streptomyces IPIO is CCTCCNO: M2020196.
3. The high-yield transglutaminase-producing Streptomyces Maoyuanensis strain according to claim 2, characterized in that: The construction steps of the integrative plasmid vector are as follows: The gRNA targeting the SMDS_318 promoter region was designed on the CRISPy-web website, and the gRNA containing SMDS_318 The PCR fragment of the gene sequence was connected to the SpeI / EcoRI site of the integrative plasmid pSET-dCas9-actII4-NT-S1 by Gibson ligation to obtain the integrative plasmid vector pLQ2125.
4. A method for increasing the production of transglutaminase, characterized in that: Using CRISPRi technology, the transcription level of the transpeptidase encoding gene SMDS_318 was reduced in Streptomyces moyuanensis IPIO to obtain a gene-attenuated mutant, which was then fermented to obtain glutamine transaminase. The sequence of the gene SMDS_318 is shown in SEQ ID NO.1; The deposit number of the Maoyuan Streptomyces IPIO is CCTCCNO: M2020196.
5. The method according to claim 4, characterized in that The fermentation comprises the following steps: inoculating the activated weakened mutant spores into a seed culture medium, culturing at 25-30° C. and 200-220 rpm for 24-26 hours, transferring the inoculation amount to a fermentation culture medium at 6%-10%, and fermenting at 25-30° C. and 200-220 rpm for 28-32 hours.
6. The method according to claim 5, characterized in that The seed culture medium comprises 1-3 w / v% glycerol, 0.4-0.8 w / v% yeast extract, 1-3 w / v% fish meal peptone, 0.1-0.3 w / v% MgSO4·7H2O, and 0.1-0.3 w / v% K2HPO4·3H2O; The fermentation medium comprises 1-3 w / v% glycerol, 0.4-0.8 w / v% yeast extract, 1-3 w / v% fish meal peptone, 0.1-0.3 w / v% MgSO4·7H2O, 0.1-0.3 w / v% K2HPO4·3H2O, and 0.1-0.4 w / v% fermentation promoter.