A strain combination and its application

Abstract

The invention discloses a strain combination and its application, and relates to microbial technology. The strain combination includes Bacillus subtilis and Leclercia sp.; the Bacillus subtilis is named Bacillus subtilis, strain number T40, and the preservation number is CCTCC NO: M 20221490; the Leclercia sp. is named Leclercia sp., strain number T208, and the preservation number is CCTCC NO: M 20221489. The biocontrol strains T40 and T208 provided by the invention have a broad-spectrum inhibitory effect on a variety of rice pathogenic fungi, and have good antibacterial effect and high prevention efficiency. The incidence of rice damping-off can be reduced by about 47% compared with the control treatment, and the disadvantage that chemical fungicides are easy to produce resistance is overcome.

Description

Technical Field

[0001] The invention relates to microbial technology, and in particular to a strain combination and application thereof. Background Art

[0002] As the main food crop in my country, ensuring the safety, stability and high yield of rice is of great significance to my country's food security. With the development of rice planting technology in my country, dry rice seedling technology has played an important role in cultivating strong rice seedlings, building a high-yield population structure and realizing the production potential of rice. However, due to factors such as low temperature during the seedling stage, the frequent occurrence of soil-borne fungal diseases such as rice blight has seriously affected the safe production of rice.

[0003] In recent years, affected by the irrational use of chemical pesticides, pathogens have gradually shown resistance to old pesticides, which is particularly prominent in the prevention and control of rice damping-off. The use of biocontrol bacteria to prevent and control rice damping-off can not only avoid the occurrence of resistance, but also promote rice growth and induce rice systemic resistance. However, although a variety of biocontrol bacteria have been made into commercial agents and explored the use of biocontrol strains for pathogen control, a single biocontrol strain has the practical problem of unstable control effect and weak sustainability. A single strain has the disadvantages of not having a significant effect in the field, not having a broad spectrum of antibacterial properties, and being unable to exert its maximum advantages. In actual applications, bacterial agents need to cooperate with each other to maximize their effectiveness.

[0004] The patent application with publication number CN110713948A discloses a set of strains for preventing and controlling tomato Verticillium wilt and its application. The set of strains disclosed in the invention includes tomato root fungus NEAU-A5 and tomato root fungus NEAU-H7. The set of strains of the invention can effectively prevent and control tomato Verticillium wilt. The combination of tomato root fungus NEAU-A5 and NEAU-H7 has obvious antibacterial activity against tomato Verticillium wilt, with an antibacterial rate of 67.65%, and a control effect of 62.16% on tomato Verticillium wilt. The invention lays a foundation for the development of a biocontrol combination preparation that effectively controls tomato Verticillium wilt.

[0005] The patent application with publication number CN112574906A discloses a strain and a composite microbial agent for preventing and treating common diseases of tomatoes in greenhouses. The invention compounded the YJY20-02 strain with YJY19-01 to obtain a composite microbial agent. After the composite microbial agent is applied, it is easy to colonize and not easy to develop drug resistance. It has obvious antibacterial activity against tomato pathogens in consecutive crops, and it is higher than the effect of using a single strain. It not only solves the practical problems of unstable control and weak sustainability of a single biocontrol strain, but also has a good control effect on common pathogens of tomatoes in consecutive crops, and can quickly restore and stabilize the balance of the flora in the soil. It is a biocontrol strain with high efficiency and environmental friendliness in preventing and treating common diseases of tomatoes in consecutive crops, laying the foundation for the development of a combined biocontrol preparation that effectively controls tomato diseases in consecutive crops.

[0006] However, there are no reports on the use of Bacillus subtilis and Luxembourg bacteria to control rice damping-off disease and inhibit the growth of other rice pathogenic fungi. Summary of the invention

[0007] In view of the problems existing in the prior art, the purpose of the present invention is to design and provide an application technology solution of biocontrol bacteria combined with rice damping-off disease.

[0008] The strain combination provided by the present invention can be used in combination to not only regulate the soil ecological environment, but also prevent and control the occurrence of soil-borne fungal diseases. It promotes the coordination and joint action of the strains to prevent and control plant diseases, effectively enhances the prevention and control ability, and improves the ecological structure of the soil to a greater extent.

[0009] The specific technical solutions of the present invention are as follows:

[0010] The present invention provides a strain combination, which includes Bacillus subtilis and Leclercia sp.; the Bacillus subtilis is named Bacillus subtilis, strain number T40, and preservation number CCTCC NO: M20221490; the Leclercia sp. is named Leclercia sp., strain number T208, and preservation number CCTCC NO: M20221489, both of which have been deposited in the China Center for Type Culture Collection on September 26, 2022.

[0011] The invention also provides application of the strain combination in inhibiting the growth of rice damping-off pathogenic fungi.

[0012] Preferably, the rice blight pathogenic fungus is Fusarium oxysporum or Fusarium oxysporum.

[0013] The invention also provides a rice damping-off pathogenic fungus inhibitor, the active ingredient of which comprises the strain combination.

[0014] The present invention also provides a method for preparing a rice damping-off pathogenic fungus inhibitor. After the strain combination is inoculated into a fermentation medium for cultivation, the fermentation liquid from which the bacterial bodies are removed is the rice damping-off pathogenic fungus inhibitor.

[0015] Preferably, the culture temperature is 25°C and the culture time is 7 days.

[0016] The present invention also provides a method for inhibiting the growth of rice pathogenic fungi, which comprises applying the bacterial strain combination or the rice damping-off pathogenic fungi inhibitor into the soil where the plants grow.

[0017] Preferably, the plants are in the seedling stage.

[0018] The biocontrol strains T40 and T208 provided by the present invention have a broad-spectrum inhibitory effect on a variety of rice pathogenic fungi, and have good antibacterial effect and high prevention efficiency. The incidence of rice damping-off can be reduced by about 47% compared with the control treatment, thus overcoming the disadvantage that chemical fungicides are prone to resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The figures are the confrontation culture effect diagrams of the biocontrol strains T40, T208 and two biocontrol strains in the present invention on Fusarium oxysporum and rice flax pathogen; wherein A is the inhibition effect diagram of the biocontrol strains T40, T208 and two biocontrol strains on Fusarium oxysporum; B is the inhibition effect diagram of the biocontrol strains T40, T208 and two biocontrol strains on rice flax pathogen; C is the growth inhibition rate diagram of Fusarium oxysporum when the biocontrol strains T40, T208 and two biocontrol strains are used in combination; D is the growth inhibition rate diagram of the biocontrol strains T40, T208 and two biocontrol strains on rice flax pathogen.

[0020] Figure 2 The diagram shows the incidence of rice damping-off and the biocontrol effect after the biocontrol strains T40 and T208 of the present invention are applied to rice seedling trays alone or in combination; wherein A is the growth of rice seedlings under control (CK) conditions; B is the growth of rice seedlings after T40 is applied to rice seedling trays; C is the growth of rice seedlings after T208 is applied to rice seedling trays; D is the growth of rice seedlings when the two biocontrol strains T40 and T208 are used in combination; E to H are the emergence rate, disease index, biomass and seedling height of rice seedlings after the biocontrol strains T40 and T208 are applied to rice seedling trays alone or in combination. DETAILED DESCRIPTION

[0021] Example 1: Screening of biocontrol strains

[0022] (1) Sample collection: The samples used in this study were collected from the Zhejiang Fuyang Rice Research Base using a random sampling method. Five rice plants were collected from different plots, and the soil around the rice roots was retained. The samples were placed in sterilized sealable bags and brought back to the laboratory for biocontrol bacteria screening.

[0023] (2) Preparation of bacterial suspension: 0.1 g of soil, rice roots, rice stems, rice leaves, rice grains and other tissues collected from the roots of rice plants were placed in a sterilized 1.5 mL centrifuge tube and 1 mL of sterilized ddH 2 O and small steel balls, put them into a grinder for oscillation and crushing. Place them on a centrifuge tube rack and let them stand for 10-20 minutes. Take the supernatant into a new centrifuge tube and dilute them into bacterial suspensions of different concentrations at 1:10 (V / V), 1:100 (V / V), and 1:1000 (V / V).

[0024] (3) Bacterial isolation: 200 μL of each diluted bacterial suspension of different concentrations was evenly spread on NA solid culture medium (5 g beef extract, 10 g peptone, 10 g sucrose, 15 g agar powder, 1 L deionized water). After the culture dish was blown dry, it was placed in an incubator at 25°C in the dark and inverted for culture. After 24 h, single colonies were selected and transferred to a new NA culture dish for purification. All isolated strains were numbered according to different parts.

[0025] (4) Screening of biocontrol strains: Screening was performed using the confrontation culture method. The monoclonal bacteria obtained were cultured in antibiotic-free LB liquid and placed in a 37°C incubator for shaking culture. 2 μL of the bacteria cultured overnight was dropped on one side of the potato glucose medium (200 g PDA potato, 20 g glucose, 20 g agar powder), and a block of Fusarium oxysporum (isolated from the diseased site of rice blight plants at the Zhejiang Fuyang Rice Research Institute) was placed symmetrically on the other side, with clean water as the control. The strains were cultured in the dark at 25°C for 7 days, and the longest growth diameter of Fusarium oxysporum was measured as an indicator of the antagonistic effect of the strain to be tested. After the above experimental screening, 9 strains with significant inhibitory effects on Fusarium oxysporum were obtained. The strain with the best antibacterial effect was numbered T40. Then the other 8 bacterial strains were co-cultured with T40, and a strain numbered T208 was screened out that could significantly increase the concentration of the mixed bacterial solution. 50% glycerol was mixed with the bacterial solutions of T40 and T208 strains in a ratio of 1:1 (V / V) and stored in a -80°C refrigerator.

[0026] Example 2: Identification of biocontrol strains

[0027] DNA extraction: The genomic DNA of T40 and T208 was extracted using the Tiangen Bacterial Genome Extraction Kit (Beijing Gaojiaoyan Technology Co., Ltd., OSR-M502).

[0028] Collect 2mL of overnight cultured bacterial solution, centrifuge at 10000rpm for 1min, and discard the supernatant. Add 200μL buffer GA to the bacterial pellet and shake until the bacteria are thoroughly suspended. Add 20μL Proteinase K solution to the tube and mix by inversion. Add 220μL buffer B, shake and mix, place at 70℃ for 10min, add 220μL anhydrous ethanol, shake and mix, and quickly centrifuge to remove water droplets on the inner wall of the tube cap. Transfer all the solution in the tube to the adsorption column, centrifuge at 12000rpm for 30s, discard the waste liquid, and put the adsorption column back into the collection tube. Add 500μL buffer GD (anhydrous ethanol needs to be added in an appropriate proportion in advance) to the adsorption column, centrifuge at 12000rpm for 30s, discard the waste liquid, and put the adsorption column back into the collection tube. Add 600 μL of rinsing solution PW (an appropriate proportion of anhydrous ethanol must be added in advance) to the adsorption column, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column to the collection tube. Repeat the rinse once. Discard the waste liquid, return the adsorption column to the collection tube, and centrifuge at 12000 rpm for 2 minutes. Let the adsorption column stand at room temperature for 2 minutes, then transfer it to a clean centrifuge tube, add 100 μL of deionized water, and let it stand at room temperature for 2 minutes. Centrifuge at 12000 rpm for 2 minutes, and collect the solution into a centrifuge tube. The solution is T40 and T208 genomic DNA.

[0029] Using T40 and T208 genomic DNA as templates, primers were used to amplify the 16S rRNA sequence. The primer sequences are as follows:

[0030] 63F: CAGGCCTAACACATGCAAGTC;

[0031] 13897R:GGGCGGTGATGTACAAGGC.

[0032] PCR reaction system (50 μL): including 25 μL 2× PCR mix, 2 μL 100 ng / μL DNA template, 2.5 μL each of 10 μM primers 63F / 13897R, and the balance is ddH 2 O.

[0033] The reaction conditions were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, amplification for 35 cycles, and final extension at 72°C for 5 min.

[0034] After the reaction was completed, 1% agarose gel electrophoresis was used to detect the bands, and the remaining amplified products were sequenced and analyzed (commissioned by Hangzhou Youkang Biotechnology Co., Ltd.), and DNA fragments were obtained by sequencing.

[0035] The fragment was compared with Bacillus subtilis T40 and Leclercia sp. by BLAST analysis on the NCBI website, and it was found that the fragment had the highest homology with Bacillus subtilis T40 and Leclercia sp. T208, respectively. At the same time, the T40 and T208 strains were deposited in the China Center for Type Culture Collection with the deposit numbers CCTCC NO: M20221490 and CCTCC NO: M 20221489, and the deposit date was September 26, 2022, and the classification names were Bacillus subtilis T40 and Leclercia sp. T208.

[0036] Example 3: Plate confrontation and field inoculation experiments of strains T40 and T208 with other rice pathogenic fungi

[0037] Pipette 2 μL of the overnight cultured T40 and T208 strains and drop them on the PDA solid medium 2 cm from the edge. Drop ddH2O at the same position on another PDA solid medium. 2 O was used as a control. The activated mycelial blocks of rice sesame spot pathogen (isolated from rice sesame spot pathogenic plants at the Zhejiang Fuyang Rice Research Institute) were punched out with a 6mm inner diameter punch and inoculated at symmetrical positions of strains T40 and T208, respectively. After culturing at 25℃ for 7 days, the colony growth was observed and the maximum growth diameter was measured.

[0038] Mycelium growth inhibition rate (%) = (maximum diameter of control colony growth - maximum diameter of treated colony growth) / maximum diameter of control colony growth × 100%,

[0039] Each experiment was repeated 3 times and 3 parallel experiments were performed. Figure 1 .

[0040] A greenhouse seedling experiment was arranged, and the combination of strains T40 and T208 selected in Example 1 was applied to the soil where the rice seedling damping-off disease was serious. The growth and development of the rice seedlings and the incidence of the disease were investigated 14 days after inoculation. The experimental results are as follows: Figure 2 .

[0041] The result of the confrontation is Figure 1 and Figure 2 As shown, the combination of T40 and T208 showed better inhibition of fungal growth and disease efficiency than the two biocontrol bacteria used alone. Among them, the incidence of rice damping-off disease could be reduced by about 47% compared with the control treatment. Therefore, the combined application of T40 and T208 is an effective measure for the prevention and control of rice damping-off disease.

Claims

1. A strain combination, characterized in that: The strain combination includes Bacillus subtilis ( Bacillus subtilis ) strain T40 and Luxembourg bacteria ( Leclercia sp.) strain T208; the preservation number of the Bacillus subtilis strain T40 is CCTCC NO: M 20221490; the preservation number of the Luxembourg strain T208 is CCTCC NO: M 20221489.

2. Use of the strain combination as claimed in claim 1 in inhibiting the growth of Fusarium oxysporum or rice flax spot pathogen.

3. An inhibitor of Fusarium oxysporum or rice flax spot pathogen, characterized in that: The active ingredient comprises the strain combination according to claim 1.

4. The method for preparing the inhibitor of Fusarium oxysporum or rice flax spot pathogen as claimed in claim 3, characterized in that: After the strain combination described in claim 1 is inoculated into a fermentation medium for cultivation, a bacterial suspension is obtained, which is an inhibitor of Fusarium oxysporum or rice flax spot pathogen.

5. The preparation method according to claim 4, characterized in that: The culture temperature was 25°C and the culture time was 7 days.

6. A method for inhibiting the growth of Fusarium oxysporum or rice flax spot pathogen, characterized in that: The strain combination according to claim 1 or the inhibitor of Fusarium oxysporum or rice leaf spot pathogen according to claim 3 is applied to the soil where rice is grown during the seedling stage.

Images