A synaptosome-associated protein 29 for inhibiting WSSV infection and its application

Abstract

The present invention relates to a synaptosome-associated protein 29 for inhibiting WSSV infection and its application. The nucleotide sequence of the gene Cq-SNAP29 encoding the synaptosome-associated protein 29 for inhibiting WSSV infection is shown as SEQ ID NO:1, and the amino acid sequence of the synaptosome-associated protein 29 is shown as SEQ ID NO:2. The Cq-SNAP29 gene can promote autophagic flux and inhibit the replication and proliferation of WSSV; Cq-SNAP29 can also bind to the WSSV envelope protein VP26, and has good potential application prospects in the development and application of new drugs against WSSV infection with Cq-SNAP29 as the target.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and particularly relates to a synaptosomal associated protein 29 for inhibiting WSSV infection and its application. Background Art

[0002] White spot syndrome virus (WSSV) is one of the most serious viral pathogens endangering the aquaculture of important aquatic crustaceans such as crayfish and prawns, causing huge economic losses to the shrimp aquaculture industry. So far, there is still a lack of effective preventive measures and drug treatment methods. WSSV is a rod-shaped, enveloped double-stranded DNA virus, and its infection process generally can be divided into six stages: virus particles adhere to the surface of susceptible host cells, are endocytosed into cells, are transported intracellularly, viral nucleic acids enter the nucleus and genome transcription is initiated, and progeny virus particles are assembled and matured.

[0003] Synaptosomal associated protein 29 (SNAP29) is a member of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) family and belongs to the Qbc-SNARE molecule. Different SNARE molecules interact to form complexes and participate in various intracellular biological processes, including mediating the fusion of autophagosomes and lysosomes, the fusion of synaptic vesicles and the plasma membrane, retrograde transport of cargo in the endoplasmic reticulum, and cell division. The interaction of SNAP29 with different adaptor proteins in cells can achieve different biological functions. Its interaction with EHD1 regulates receptor internalization and recycling and the formation of the basement membrane around ciliary microtubules, and its binding to Syntaxin17 regulates the membrane fusion process of autophagosome-lysosome. SNAP29 can be recruited by Qa-SNARE Syntaxin17 into mature autophagosomes to promote its binding to lysosomal R-SNARE VAMP8 (VAMP7 in Drosophila), forming the Syntaxin17-SNAP29-VAMP7 / 8 complex, mediating the membrane fusion of autophagosome-lysosome to form autolysosomes, thereby achieving the purpose of degrading "cargo". In the research related to virus infection, it has been found that during the infection process of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the viral ORF7a protein can down-regulate the expression of SNAP29, inhibit the fusion of autophagosome-lysosome, and thus promote virus replication. In addition, SNAP29 promotes the targeting of hepatitis B virus (HBV) to autophagy-lysosome degradation during the infection process of hepatitis B virus. However, there is no report on the relationship between SNAP29 and WSSV infection. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems in the related art to some extent. For this purpose, the object of the present invention is to provide a synaptosome-associated protein 29 that inhibits WSSV infection, and its preparation method and application.

[0005] For this purpose, in the first aspect of the present invention, the present invention proposes a gene Cq-SNAP29 encoding a synaptosome-associated protein 29 that inhibits WSSV infection, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0006] According to an embodiment of the present invention, the ORF sequence of the gene Cq-SNAP29 is 846 bp long, which can significantly promote the autophagy flux of host cells and reduce the replication and proliferation of the virus in Hpt cells. The recombinant protein GST-Cq-SNAP29 binds to the viral envelope protein VP26.

[0007] In the second aspect of the present invention, the present invention proposes the above-mentioned synaptosome-associated protein 29, and its amino acid sequence is shown in SEQ ID NO: 2.

[0008] In the third aspect of the present invention, the present invention proposes the application of the above-mentioned synaptosome-associated protein 29 in the preparation of drugs for preventing animal WSSV infection.

[0009] According to an embodiment of the present invention, Cq-SNAP29 can significantly promote the autophagy flux of host cells and reduce the replication and proliferation of the virus in Hpt cells. The recombinant protein GST-Cq-SNAP29 binds to the viral envelope protein VP26, and it has good potential application prospects in the development and application of new drugs for preventing WSSV infection with Cq-SNAP29 as the target.

[0010] The additional aspects and advantages of the present invention will be partially given in the following description, partially become obvious from the following description, or be understood through the practice of the present invention. Brief Description of the Drawings

[0011] Figure 1 Prediction of the Cq-SNAP29 protein domain according to an embodiment of the present invention;

[0012] Figure 2 Western blot detection diagram according to an embodiment of the present invention;

[0013] Figure 3 Viral copy number according to an embodiment of the present invention;

[0014] Figure 4 Electrophoresis diagram after purification of the GST-Cq-SNAP29 recombinant protein analyzed by SDS-PAGE according to an embodiment of the present invention;

[0015] Figure 5 The GST-Pull down experiment according to an embodiment of the present invention verifies that GST-Cq-SNAP29 binds to the WSSV envelope protein VP26. Specific implementation mode

[0016] The technical solutions of the present invention are described below through specific specific examples. It should be understood that one or more method steps mentioned in the present invention do not exclude the existence of other method steps before and after the combined steps, or other method steps can be inserted between these clearly mentioned steps; it should also be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. Moreover, unless otherwise specified, the numbers of each method step are only convenient tools for identifying each method step, rather than limiting the arrangement order of each method step or the scope in which the present invention can be implemented. The change or adjustment of their relative relationship, without substantial change in the technical content, should also be regarded as the scope in which the present invention can be implemented.

[0017] In order to better understand the above technical solutions, the exemplary embodiments of the present invention are described in more detail below. Although the exemplary embodiments of the present invention are shown, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided so that the present invention can be more thoroughly understood and the scope of the present invention can be fully conveyed to those skilled in the art.

[0018] The test materials used in the present invention are all ordinary commercially available products and can all be purchased in the market; the experiments involved are all conventional experimental methods unless otherwise specified.

[0019] The present invention is described below with reference to specific embodiments. It should be noted that these embodiments are only descriptive and do not limit the present invention in any way.

[0020] Example 1 Cloning of the Cq-SNAP29 gene of red swamp crayfish and prediction of protein domains

[0021] Total RNA of red swamp crayfish Hpt cells was extracted and reverse transcribed into cDNA as a template for gene amplification. According to the Cq-SNAP29 gene ORF sequence in the hematopoietic tissue transcriptome of red swamp crayfish constructed in the early stage of the laboratory, specific amplification primers were designed for PCR. Forward primer F: 5’-ATGGCGTACAGAGGCGGGAA-3’, reverse primer R: 5’-TCATCGTTTGAGGATTTTCTTTAT-3’. Using The gene sequence was amplified using Max DNA Polymerase, and the PCR reaction system was prepared as follows: PrimeSTAR Max Premix 15 μL; upstream primer F (10 μM) 0.5 μL; downstream primer R (10 μM) 0.5 μL; cDNA template 1 μL; RNase-Free H2O 13 μL. PCR amplification program: pre-denaturation at 98 °C for 3 min; denaturation at 98 °C for 10 s, annealing at 55 °C for 15 s, extension at 72 °C for 10 s, repeat 30 cycles; continue extension at 72 °C for 10 min.

[0022] After recovering the PCR product, it was ligated to the pMD18-T vector, transformed into Escherichia coli DH5α, and positive monoclonal bacteria were picked for sequencing. Alignment and analysis were performed to determine the ORF sequence of the obtained Cq-SNAP29 gene, and the nucleotide sequence is shown as SEQ ID NO: 1.

[0023] The results showed that the ORF sequence of the Cq-SNAP29 gene was 846 bp long and encoded 281 amino acids.

[0024] The prediction of the Cq-SNAP29 domain is shown in Figure 1 , and Cq-SNAP29 is composed of 2 typical SNARE domains (Qb-SNARE and Qc-SNARE).

[0025] Example 2 Effects of Cq-SNAP29 gene knockdown on autophagy flux and WSSV-infected Hpt cells

[0026] The double-stranded RNA (dsRNA) of Cq-SNAP29 was synthesized using a kit for gene interference experiments. Redclaw crayfish Hpt cells were prepared and cultured. After dilution in L15 medium, they were added to a cell culture plate and cultured under sterile conditions at 20 °C. After the Hpt cells adhered stably, an appropriate amount of Cq-SNAP29 dsRNA, Cellfectin transfection reagent, and DEPC water were mixed evenly, incubated at room temperature for 10 min, added to the cultured cells. After 24 h, 1 / 2 of the medium was replaced, and secondary interference was performed according to the above method. The control dsRNA was GFP dsRNA. After secondary interference, all the medium was replaced with fresh medium, and the cells were infected with WSSV. The cell culture plate was placed in an incubator at 26 °C. After 12 h of infection, the cells were lysed and collected with 1× SDS loading buffer, and the samples were boiled for 10 min. Western blot was used to detect the changes in autophagy flux and viral VP28 protein; after 24 h of infection, the cells were lysed using a cell genome extraction kit to extract DNA for virus copy number detection.

[0027] The results are shown in Figure 2, after knocking down the Cq-SNAP29 gene, compared with the control group, at MOI = 5 and after 12 h of WSSV infection, the expression level of the Cq-SNAP29 gene was significantly reduced, and the autophagic flux was significantly inhibited (the conversion of CqGABARAP-I to CqGABARAP-II was significantly enhanced, and the stock of Cqp62 protein increased), resulting in an increase in the WSSV envelope protein VP28 and an enhanced transcriptional and replicative ability of WSSV. The results proved that the Cq-SNAP29 gene promoted the autophagic flux and inhibited the transcriptional and replicative ability of WSSV.

[0028] The results are shown in Figure 3 , compared with the control group, at MOI = 2 and after 24 h of WSSV infection, after knocking down the Cq-SNAP29 gene and then infecting with WSSV, the viral copy number increased significantly.

[0029] Example 3 Induced Expression and Protein Purification of the Recombinant Expression Vector pGEX-4T-1-Cq-SNAP29 in Escherichia coli E. coli BL21

[0030] 1. Construction of the recombinant expression vector: Add an EcoR I restriction site to the 5' end of the specific upstream primer F for amplifying the ORF of the Cq-SNAP29 gene, and add a Sal I restriction site to the 5' end of the downstream primer R, and perform PCR amplification on its ORF. The PCR amplification system and reaction conditions are shown in Example 1. Use a kit to recover the PCR product, then perform double digestion of the PCR product and the prokaryotic expression vector pGEX-4T-1 with EcoR I / Sal I, recover the digested products after digestion at 37 °C for 3 h, and ligate the two digested products at 16 °C for 6 h to obtain the recombinant expression vector pGEX-4T-1-Cq-SNAP29. Sequencing identification showed that the reading frame was accurate.

[0031] 2. Transform the constructed recombinant expression vector pGEX-4T-1-Cq-SNAP29 into E. coli BL21(DE3) and culture it at 37 °C for 12 h.

[0032] 3. Pick a single colony and inoculate it into 2 mL of LB medium containing ampicillin, and culture it at 37 °C and 200 rpm in a shaker for 12 h.

[0033] 4. Inoculate at a ratio of 1:50 into 200 mL of LB medium containing Amp + and culture it at 37 °C and 200 rpm in a shaker until the OD600 reaches 0.3 to 0.6.

[0034] 5. Add IPTG to a final concentration of 0.1 mM and induce expression at 28 °C and 160 rpm for 16 h.

[0035] 6. Centrifuge the cells at 8000 × g for 10 min to collect the bacterial cells.

[0036] 7. Resuspend the bacteria cells in 50 mL of PBS, add the PMSF protease inhibitor, sonicate the resuspension until the liquid becomes clear, and then centrifuge at 12,000×g for 30 min at 4°C. Collect the supernatant.

[0037] 8. Mix the above protein supernatant with 300 μL of glutathione agarose beads and rotate overnight at 4°C.

[0038] 9. Centrifuge at 600×g for 3 min to collect the agarose beads bound with the target protein, wash off the non-specifically bound miscellaneous proteins with PBS, and repeat 5 times; elute the target protein with 6 mL of GSH eluent, and take a small amount for SDS-PAGE electrophoresis identification.

[0039] 10. The correctly verified recombinant protein GST-Cq-SNAP29 is used for subsequent experiments after dialysis.

[0040] The results are as Figure 4 , and the recombinant protein GST-Cq-SNAP29 is a relatively single protein band with the correct size.

[0041] Example 4 Verification of the Interaction between GST-Cq-SNAP29 and the WSSV Envelope Protein VP26 by GST-pull down Assay

[0042] Explore whether GST-Cq-SNAP29 interacts with the major envelope proteins (VP19, VP24, VP26, and VP28) of WSSV. First, construct PB513B-Flag vectors for the 4 envelope protein genes, design specific primers to add EcoR I and BamH I restriction enzyme sites at the 5' ends of the upstream and downstream primers respectively, and perform ORF PCR amplification. The primers are as follows:

[0043] VP19-F: CCGGAATTCATGGCCACCACGACTAACACT;

[0044] VP19-R: CGCGGATCCCTGCCTCCTCTTGGGGTAAG;

[0045] VP24-F: CCGGAATTCATGCACATGTGGGGGGTTTAC;

[0046] VP24-R: CGCGGATCCTTTTTCCCCAACCTTAAACAGATCA;

[0047] VP26-F: CCGGAATTCATGGAATTTGGCAACCTAACAA;

[0048] VP26-R: CGCGGATCCCTTCTTCTTGATTTCGTCCTTGATA;

[0049] VP28-F: CCGGAATTCATGGATCTTTCTTTCACTCTTTCGG;

[0050] VP28-R: CGCGGATCCCTCGGTCTCAGTGCCAGAGTAGG;

[0051] The PCR amplification system and reaction conditions are shown in Example 1. The PCR products were recovered using a kit, and then the PCR products and the expression vector PB513B-Flag were respectively double digested with EcoR I / BamH I. After ligating the four envelope protein genes to the digested expression vector respectively, recombinant expression vectors of the four envelope protein genes were obtained.

[0052] Subsequently, the PB513B-VPs-Flag plasmid was transfected into HEK293T cells using a transfection reagent. After 48 h of transfection, the cells were lysed with IP cell lysis buffer at 4 °C for 30 min, and then centrifuged at 12000×g for 10 min at 4 °C. Each supernatant was divided into two parts, and 40 μg of GST-Cq-SNAP29 protein and GST protein were added respectively. And 20 μL of glutathione agarose beads were added to all samples, and the samples were incubated with rotation at 4 °C for 6 h. The resin beads were washed 5 times with PBS, and 20 μL of 2×SDS-PAGE sample buffer was added and boiled for 10 min for denaturation. The protein samples were electrophoresed on a 15% SDS-PAGE gel and electrotransferred to a PVDF membrane, and the protein-protein interaction was detected using an anti-Flag antibody.

[0053] The results are as Figure 5 , demonstrating that GST-Cq-SNAP29 binds to the WSSV envelope protein VP26.

[0054] In summary, according to the embodiments of the present invention, on the basis of amplifying the Cq-SNAP29 gene, dsRNA was designed according to the obtained Cq-SNAP29 gene sequence to interfere with its expression; the research results showed that Cq-SNAP29 significantly promoted the autophagic flux of host cells and reduced the replication and proliferation of the virus in Hpt cells; in addition, the recombinant protein GST-Cq-SNAP29 binds to the viral envelope protein VP26. Therefore, Cq-SNAP29 has important research value in exploring the mechanism of how the autophagy-lysosome degradation pathway inhibits WSSV infection, and has good potential application prospects in the development and application of new drugs against WSSV infection targeting Cq-SNAP29.

[0055] In the description of this specification, the description referring to terms such as "one embodiment", "some embodiments", "examples", "specific examples", or "some examples", etc. means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic expressions of the above terms should not be understood as necessarily referring to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine the different embodiments or examples described in this specification.

[0056] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. A gene Cq-SNAP29 encoding synaptosome-associated protein 29 that inhibits WSSV infection, characterized in that, Its nucleotide sequence is shown as SEQ ID NO:

1.

2. A synaptosomal-associated protein 29 that inhibits WSSV infection, characterized in that, Its amino acid sequence is shown as SEQ ID NO:

2.

3. Use of the synaptosomal-associated protein 29 according to claim 2 in the preparation of a medicament for preventing Procambarus clarkii from being infected by WSSV.

Images