Rice endosperm development-related gene OsHsp40-1 and its application

Abstract

The present invention belongs to the field of plant genetic engineering and biotechnology, discloses a rice endosperm development-related gene OsHsp40‑1 and its application, its CDS sequence is shown in SEQ ID NO.1, its protein sequence is shown in SEQ ID NO.2, and discloses the application of the gene in regulating endosperm development and improving rice yield and quality. The present invention first discovered and cloned a new heat shock protein gene OsHsp40‑1 related to endosperm development, and obtained its functional loss mutant using gene editing technology. After the gene mutation, the rice seed endosperm development is abnormal, presenting an opaque endosperm phenotype, thereby causing a significant decrease in the thousand-grain weight of the seed. The present invention also confirms that overexpression of OsHsp40‑1 can significantly increase rice grain weight, single plant yield and reduce rice chalky grain rate. The gene and its encoded protein can be used for the study of the molecular mechanism of regulating rice endosperm development and the genetic improvement of high-yield and high-quality rice.

Description

Technical Field

[0001] The invention relates to the technical fields of biotechnology and plant genetic engineering, and in particular to the application of OsHsp40-1 gene in regulating rice endosperm development and improving rice yield and quality. Background Art

[0002] Rice is one of the most important food crops in the world. More than half of the world's population relies on rice as their staple food. High yield, high quality, multi-resistance and adaptability to mechanization are important goals in rice breeding. At present, China's rice production has reached a relatively high level. With the rapid development of society, the increase in population, and the improvement of people's living standards and consumption levels, people's requirements for rice yield and quality are also increasing day by day. Endosperm is the main energy storage organ of rice grains. The main component of endosperm is starch, which is mainly converted into starch through a series of enzymatic reactions from the precursor substance ADP glucose (ADPG). The quality of endosperm development not only affects the size of seeds, but also determines the quality of rice. Rice grain size and starch content in endosperm have a decisive influence on rice yield and quality, but their related regulatory mechanisms are still not very clear.

[0003] HSP40 is a class of heat shock protein family, also known as DnaJ protein or J protein. HSP40 is involved in protein folding, unfolding, transport to specific organelles and regulation of protein complex disassembly (Craig and Marszalek, How do J-Proteins get Hsp70 to do so many different things? Trends in Biochemical Sciences, 2017, 42: 355-368.). HSP40 family proteins in rice have been widely studied. OsDjA7 / 8 mutants were identified during rice chloroplast development. After OsDjA7 / 8 mutation, chloroplast development was abnormal, chloroplasts could not be synthesized normally, and the whole plant showed an albino phenotype (Zhu et al., 2015). Leaf size is one of the important agronomic traits affecting crop yield. OsHSP40 is also involved in the regulation of rice leaf size (Wang et al., Leaf Mutant 7 Encoding Heat Shock Protein OsHSP40 Regulates Leaf Size in Rice, Int. J. Mol. Sci, 2022.) When studying proliferating cells and antigen protein OsPCNA, its interacting protein OsDNAJ was found. It was found that OsDNAJ could be induced to express through H2O2 and UV induction, indicating that OsDNAJ may be involved in the regulation of cell proliferation under stress conditions (Yamamoto et al., Interaction between proliferating cell nuclear antigen (PCNA) and a DnaJ induced by DNA damage. J Plant Research, 2005, 118: 91-97.). Rice DnaJ protein is also involved in the resistance to rice blast, such as OsDjA6 negatively regulating rice resistance to rice blast, OsDjA6 RNAi plants WRKY45, NPR1 and PR5 significantly down-regulated expression, ROS levels also significantly reduced, rice blast fungus inoculation results showed that the lesion area of ​​OsDjA6 RNAi plants was significantly relative to the wild type (Zhong et al., The DnaJ protein OsDjA6 negatively regulates rice innate immunity to the blast fungus Magnaportheoryzae. Mol Plant Pathol, 2018, 19: 607-614.). At present, no research on rice heat shock protein 40 in rice quality and yield and no functional research on OsHsp40-1 gene have been reported. Summary of the invention

[0004] In view of the problems existing in the prior art, the purpose of the present invention is to design and provide a technical solution for the rice endosperm development-related gene OsHsp40-1 and its application.

[0005] The present invention is specifically implemented by the following technical solutions:

[0006] The first aspect of the present invention provides a rice endosperm development-related gene OsHsp40-1, the nucleotide sequence of the OsHsp40-1 gene is shown in SEQ ID NO.1.

[0007] The second aspect of the present invention provides the encoded protein of the rice endosperm development-related gene OsHsp40-1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0008] The third aspect of the present invention provides the use of the above rice endosperm development-related gene OsHsp40-1 in improving rice yield and quality.

[0009] The fourth aspect of the present invention provides a CRISPR / Cas9-gRNA expression plasmid containing the target site of the above-mentioned OsHsp40-1 gene.

[0010] The fifth aspect of the present invention provides Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 genetically engineered strains containing a knockout expression vector targeting the OsHsp40-1 gene.

[0011] The sixth aspect of the present invention provides an insertion or deletion homozygous mutant of the OsHsp40-1 gene obtained by knocking out the OsHsp40-1 gene using the knockout expression vector.

[0012] Furthermore, the nucleotide sequence of the homozygous mutant is shown in SEQ ID NO.3 and SEQ ID NO.4, and the encoded protein is shown in SEQ ID NO.5 and SEQ ID NO.6.

[0013] A seventh aspect of the present invention provides the use of the above homozygous mutant in studying the molecular mechanism of rice endosperm development, quality and yield formation.

[0014] The eighth aspect of the present invention provides a method for improving rice yield and quality, characterized in that the OsHsp40-1 gene is overexpressed in a rice crop, comprising the following steps:

[0015] (1) Construction of pCUbi1390-OsHsp40-1 overexpression vector;

[0016] (2) constructing an overexpression vector of the OsHsp40-1 gene of step (1) and introducing it into rice cells by Agrobacterium-mediated method, and obtaining transgenic plants after culturing;

[0017] (3) Hygromycin marker was used to screen positive transgenic plants, and RT-PCR was further used to obtain positive plants with higher expression levels.

[0018] The ninth aspect of the present invention provides transgenic rice overexpressing OsHsp40-1 obtained by the above method.

[0019] The present invention identified a new heat shock protein 40 gene. After the gene was knocked out, the mutant showed that the grains had opaque endosperm, increased chalkiness, and poor rice quality; the mutant seed width, grain thickness and 1000-grain weight decreased. After overexpression of this gene, the grain length, 1000-grain weight and single plant yield can be significantly increased. At the same time, overexpression of the OsHsp40-1 gene in the Zhonghua 11 background can reduce the endosperm chalky grain rate and improve the nutritional quality of rice. There are no related reports on the heat shock protein 40 family in rice quality. The present invention provides a new regulatory network and gene resources for the study of the molecular mechanism of rice endosperm development and the study of rice yield and quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram showing the site prediction and tissue expression analysis of the OsHsp40-1 gene.

[0021] Figure 2 This is an analysis diagram of the spatiotemporal expression pattern of the OsHsp40-1 gene in different rice tissues.

[0022] Figure 3 This is the subcellular localization map of OsHsp40-1 protein.

[0023] Figure 4 This is a map of the CRISPR-Cas9 knockout vector containing the OsHsp40-1 gene target site sequence.

[0024] Figure 5 Schematic diagram of gene editing of OsHsp40-1 in the Zhonghua 11 background.

[0025] Figure 6 This is a comparison chart of the wild-type ZH11 and mutant oshsp40-1.

[0026] Figure 7 This is a graph showing the mature seed yield characteristics of the wild-type ZH11 and the mutant oshsp40-1.

[0027] Figure 8 The figures show the phenotype and cytological analysis of wild-type ZH11 and mutant oshsp40-1 brown rice.

[0028] Fig. 9 This is the determination of physical and chemical indicators of wild-type ZH11 and mutant oshsp40-1 rice.

[0029] Fig.10 This is the map of the pCUbi1390-OsHsp40-1 overexpression vector.

[0030] Fig.11 Statistical graphs of some important agronomic and yield traits of transgenic positive lines overexpressing the OsHsp40-1 gene in different receptor backgrounds.

[0031] Fig.12 This is a diagram for analyzing the quality of rice overexpressing the OsHsp40-1 gene in the Zhonghua 11 background. DETAILED DESCRIPTION

[0032] In order to understand the present invention, the present invention is further illustrated by the following examples, but the present invention is not limited thereto.

[0033] Example 1

[0034] Analysis of the Expression Pattern of Rice Heat Shock Protein Gene OsHsp40-1

[0035] In order to obtain the expression pattern of the rice heat shock protein gene OsHsp40-1, RNA was extracted from various parts of rice at different growth stages, with three replicates for each sample. The extraction of rice seed RNA was based on the corn endosperm RNA extraction method, using the SDS-TRIZOL method (Joao Leiva, Ricardo Dante and David Holding), and the extraction of RNA from other rice tissues (roots, stems, leaves, and panicles) all used the TRIZOL method.

[0036] The specific steps are as follows:

[0037] 1. Reagent preparation and sample preparation

[0038] Prepare SDS-buffer (50mM TRIS pH 8.0, 150mM LiCl, 5mM EDTA pH 8.0, 1% SDS) and use DEPC water for containers and pipette tips; take out the corresponding samples from the -80℃ freezer, place them on ice for later use, quickly remove the husks with tweezers, and then put them into 1.5mL RNA-free centrifuge tubes placed on ice. Take 3-5 seeds for each period of sample;

[0039] 2. SDS-buffer extraction

[0040] Add 400 μL of SDS-buffer to the above centrifuge tubes, prepare steel balls that have been scalded with alcohol flame, add one to each centrifuge tube, and immediately put them into a DNA extraction and proofing shaker to quickly crush the sample for 1 min; add 800 μL of phenol (balanced in TRIS pH 8.0)-chloroform (1:1), shake well, place on ice for 5 min, and centrifuge at 10,000g, 4°C for 10 min; aspirate 500 μL of supernatant and transfer it to a new RNA-Free 1.5 mL centrifuge tube;

[0041] 3. TRIZOL Extraction

[0042] Add 1 mL of TRIZOL extract to the sample; add 200 μL of chloroform, shake well, and leave at room temperature for 3 min; centrifuge at 10,000 g, 4 °C for 10 min;

[0043] 4. RNA Precipitation

[0044] Carefully pipette 500 μL of supernatant into a new RNA-free 1.5 mL centrifuge tube, add 400 μL of isopropanol, mix by inverting, and place on ice for 10 min; centrifuge at 10,000 g, 4°C for 10 min. 5. RNA cleaning and dissolution

[0045] Carefully pour out the supernatant, add 500 μL 75% ethanol (prepared with DEPC water), and gently suspend the RNA precipitate at the bottom; centrifuge at 10,000g, 4℃ for 5 min, carefully pour out the supernatant, briefly centrifuge for 15 s, use an RNA-free pipette tip to absorb the remaining liquid, and then place in an ultra-clean workbench to air dry; add 40 μL DEPC water and flick to promote the dissolution of the RNA precipitate.

[0046] 6. RNA digestion (removal of gDNA contamination)

[0047] The reaction system consisted of Template RNA 40 μL, 10x Buffer 4.5 μL, DNase I, RNase-Free 4 μL. The cells were treated in a metal bath at 37°C for 30 min, 75°C for 5 min, and stored in a -80°C refrigerator.

[0048] 7. Synthesis of First-Strand cDNA

[0049] ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) was used for reverse transcription to obtain cDNA. An equal amount of digested RNA was added to each RNase-free centrifuge tube, and RNase-free water was added to mix. The reverse transcription system was as follows: Total RNA (2 μg), RNA-free water was added to 22 μL, reaction conditions: treated in a metal bath at 75°C for 5 minutes, and immediately placed on ice for use; the reverse transcription reaction Mix was prepared, the components were as follows: 5x Quantiscript RT Buffer 8 μL, dNTP 4 μL, Oligdt (20) 2 μL, RNA inhibitor 2 μL, ReverTra Ace 2 μL, the total volume was 40 μL, the reaction conditions were incubated at 42°C for 60 min, incubated at 75°C for 5 min to terminate the reaction, after the reaction was completed, an equal volume of RNA-free water was added to dilute it by one half, mixed and stored in a refrigerator at -20°C for use.

[0050] 8. Real-time fluorescence quantitative PCR

[0051] The kit used was SYBR Green Real-time PCR Master Mix (Toyobo), and the reaction system was 2xSYBR Premix Ex Taq II 10 μL, 10 μM PCR Forward Primer 2 μL, 10 μM PCR Reverse Primer 2 μL, cDNA template 4 μL, and water was added to 20 μL. The PCR program was: 95°C 30 s, 95°C 5 s, 60°C 30 s, and the number of cycles was 40; 95°C 15 s, 60°C 1 min, 95°C 15 s.

[0052] 9. Result analysis:

[0053] qRT-PCR was further performed using qRT-Hsp40-1F and qRT-Hsp40-1R primers, with rice constitutively expressed gene Actin1 as the internal reference. The primer sequences are as follows:

[0054] Actin-F(SEQ ID NO.7):CCCTCCTGAAAGGAAGTACAGTGT

[0055] Actin-R(SEQ ID NO.8):GTCCGAAGAATTAGAAGCATTTCC

[0056] qRT-Hsp40-1F (SEQ ID NO.9):TACACTGACGGCACTGTCTT

[0057] qRT-Hsp40-1R (SEQ ID NO.10):TCTCCTTCGTAGCGGAAGTC

[0058] The results of the experiment are based on 2 -△△CT The results showed that OsHsp40-1 was expressed in all tissues tested, with higher expression levels in roots, stems, leaves and spikes, and relatively higher in the late stages of seed development (e.g. Figure 2 The site prediction and tissue expression analysis of OsHsp40-1 gene Figure 1 shown.

[0059] Example 2

[0060] Localization of Heat Shock Protein OsHsp40-1 in Rice

[0061] The nucleotide sequence of the rice endosperm development-related gene OsHsp40-1 of the present invention is shown in SEQ ID NO.1, and the nucleotide sequence of the protein encoded by its coding region is shown in SEQ ID NO.2. Recombinant primers are designed according to the nucleotide sequence of the OsHsp40-1 gene, and PCR amplification is performed using the cDNA of Zhonghua 11 as a template. After agarose electrophoresis detection, the gel is cut and recovered and purified to obtain a PCR purified product. A green fluorescent label vector pAN580 is used, and SpeI and XbaI are selected to perform double enzyme digestion on it to obtain a purified linearized vector for standby use. The PCR product is further connected to the linearized pAN580 vector using an infusion enzyme and transformed into Escherichia coli, and the correctly sequenced large-scale plasmid is used to transform rice protoplasts, and the fluorescent expression site is observed and photographed using laser confocal microscopy (LSM710, Zeiss, Germany). The specific operation steps are as follows:

[0062] (1) Rice seedling cultivation

[0063] Prepare 1 / 2MS, sterilize the culture bottle at the same time, add kanamycin after sterilization and cooling, and pour the culture medium into the culture bottle to a thickness of about 3cm; select 93-11 rice grains with complete embryos, clean and without melanin, disinfect with 75% ethanol for 1min, wash three times with sterile water, change to 50% pasteurized solution for 30min, and shake up and down on a shaker. After pasteurization, wash with sterile water about 4 times until the bubbles disappear, and place the sterilized seeds on the clean bench to dry. Transfer to 1 / 2MS culture medium, and then place it in a 30℃ incubator for culture. After 2 weeks, the seedlings can be used for protoplast extraction.

[0064] (2) Protoplast extraction

[0065] Take out 15 10-13 day old seedlings, cut them into pieces smaller than 0.5 mm on clean A4 paper, and transfer them to 0.6 M mannitol solution in time. After all the seedlings are cut, place them in a vacuum box for 30 minutes, remove the air in the leaves, remove 0.6 M mannitol through a 40 μm filter, add room temperature enzymolysis solution, shake at 28 ° C, 40 rpm for 3-5 hours; after the enzymolysis is completed, remove the enzymolysis solution with a 40 μm filter, add 10 mL of W5, release it on a shaker at 28 ° C, 40 rpm for 10 minutes, filter it into a 50 mL centrifuge tube marked as tube 1, and then add 10 mL After W5, release the protoplasts at 28℃, 40rpm shaker for 10min, filter into another 50mL centrifuge tube marked as tube 2; centrifuge the filtrate at 70g for 5min at room temperature, horizontal rotor, acceleration and deceleration set to 1, and discard the supernatant; add 1mL W5 solution to suspend the protoplasts, and shake the centrifuge tube carefully to allow the protoplasts to be fully released in the W5 solution. Pipette 10μL of protoplast suspension and count, and adjust the protoplast concentration to 0.5-1×10 7 / mL; centrifuge at 70g for 5 min at room temperature, discard the supernatant, resuspend the protoplasts in MMG, and adjust the concentration to 0.5-1×10 7 / mL, prepare 5μg or 10μg of the plasmid to be transformed, dilute it to 10μL, add 200μL of protoplast suspension to each round-bottom centrifuge tube, flick with your thumb to mix, then add 210μL of PEG-CaCl2 solution to the centrifuge tube and flick to mix. Place at room temperature for 10-15min; then add 840μL of W5 solution to the centrifuge tube to stop the transformation; transfer the centrifuge tube to a centrifuge (horizontal rotor, 100g) and centrifuge for 5min, add 0.5mL of WI solution, resuspend the protoplasts, and transfer them to a culture plate, in which 300μL of WI solution is pre-added; culture for 12-16h. Centrifuge the cultured protoplasts for 5 minutes (horizontal rotor, 100g), remove the supernatant, and the remaining part is used to observe the fluorescence signal.

[0066] (3) Results

[0067] The fluorescent signals were distributed in the cytoplasm and nucleus of rice protoplasts transformed with empty vector plasmids. The green fluorescence of OsHsp40-1::GFP fusion protein could overlap with the spontaneous red light of chloroplasts, indicating that OsHsp40-1 may play a role in chloroplasts (e.g. Figure 3 shown).

[0068] Example 3

[0069] Construction of OsHsp40-1 gene knockout vector in rice

[0070] 1. Selection of gRNA target sequence

[0071] According to CRISPR / Cas9 related experimental methods, a 5′-TGGAGAGGCCGTACGAGGCGAGG-3′ sequence containing NGG as a recognition site was selected as a knockout target site on the second exon of the OsHsp40-1 gene, and the PAM sequence was AGG;

[0072] 2. Design of upstream and downstream primers of gRNA oligonucleotide chain

[0073] The upstream primer is Hsp40-1_gRNA_F (SEQ ID NO.11):

[0074] 5′-CAGTGGAGAGGCCGTACGAGGCG-3′,

[0075] The downstream primer is Hsp40-1_gRNA_F (SEQ ID NO.12):

[0076] 5′-AACCGCCTCGTACGGCTCTCCA-3′;

[0077] 3. CRISPR / Cas9 vector construction

[0078] This example uses a plant Cas9 / gRNA plasmid construction kit (Catalog. No. VK005-01, Figure 4 After the target sequence is loaded, a recombinant vector containing the OsHsp40-1 gene target site is formed (as shown in Figure 5 The specific operation method is as follows:

[0079] (1) Formation of oligo dimers

[0080] Take 5 μL of each 10 μM target site front and back primer and add 15 μL of ddH2O, mix well, treat at 95℃ for 3 minutes, slowly cool from 95℃ to 25℃, and treat at 16℃ for 5 minutes to obtain a double-stranded sequence containing the knockout target site;

[0081] (2) Insertion of oligo dimer into vector

[0082] Take 1 μL of Cas9 / gRNA vector, 1 μL of oligo dimer from step 1, 1 μL of buffer 1 and 2 respectively, add 6 μL of ddH2O, and react in a 16°C metal bath for 2 hours;

[0083] (3) E. coli transformation

[0084] Take 5-10 μL of the final product of step 2 and add it to 50 μL of DH5a competent cells that have just been thawed, flick to mix, place on ice for 30 minutes, heat shock at 42°C for 45 seconds, let stand on ice for 2 minutes, then add 200 μL of antibiotic-free LB, place in a 37°C constant temperature shaker at 200 rpm, and after one hour of recovery, place on a plate coated with kanamycin resistance (Kana+);

[0085] (4) Bacterial liquid PCR detection

[0086] The next day, a single clone was picked and placed in a kanamycin-resistant liquid culture medium, and cultured in a 37°C shaker until the bacterial solution became turbid. Sequencing was performed using the VK005 vector-specific sequencing primers provided in the kit; the sequencing results were analyzed using Snapgene software, and the plasmid of the positive clone bacterial solution was extracted for later use.

[0087] 4. Agrobacterium transformation and rice genetic transformation

[0088] The successfully constructed plasmid was transferred into Agrobacterium (EHA105): 1 μL of plasmid was injected into the freeze-thawed Agrobacterium competent cell on ice, and then placed on ice for 5 minutes, liquid nitrogen for 5 minutes, and 37°C for 5 minutes. 300 μL of resistance-free LB was added to resuscitate at 28°C for 4 hours, and evenly spread on a (kanamycin + rifampicin) K+ / Rif-resistant plate. After culturing at 28°C for 2-3 days, single clones were picked out, and positive clones were obtained by detection with hygromycin primers and expanded in 3 mL of liquid K+ / Rif culture medium. The positive K+ / Rif bacterial solution was further sent to the company for genetic transformation of rice under the Zhonghua 11 background.

[0089] Example 4

[0090] Phenotypic Analysis of Rice OsHsp40-1 Gene Knockout Lines

[0091] In order to identify the knockout transgenic strain obtained above, the transgenic seedlings obtained were cultured in a normal temperature light incubator for about a week, and then the positive seedlings were identified. The specific steps are as follows:

[0092] 1. Knockout transgenic seedling detection

[0093] 25 T0 generation transgenic seedlings were obtained, placed in a normal temperature light incubator for culture for about a week, and then DNA of the 25 seedlings was taken. After PCR amplification using Hsp40-1cas9TF and Hsp40-1cas9TR, the DNA was sent to the company for sequencing. The sequencing results were analyzed to obtain transgenic plants with premature termination of translation of two proteins. The nucleotide sequences of the two homozygous mutants of the insertion or deletion of the OsHsp40-1 gene obtained by the knockout of the present invention are shown in SEQ ID NO.3 and SEQ ID NO.4, and the encoded proteins are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0094] Hsp40-1cas9TF (SEQ ID NO.13):5′-AGTTCCGTGTCGTGCTGG-3′,

[0095] Hsp40-1cas9TR (SEQ ID NO. 14): 5′-AGATGACAACGTCAGCAGCAT-3′;

[0096] 2. Phenotypic Identification

[0097] The T1 generation plants were sown in the natural field environment, the edge row effect was removed, the plants with normal morphology were selected, and 5-10 stable strains were selected. The important agronomic traits of different strains of knockout mutants were observed. It was found that compared with the wild type Zhonghua 11, the plant height of the mutant was significantly reduced, and there was no significant difference in other important agronomic traits (such as Figure 6 After obtaining a stable genetic T2 knockout strain, the target site was further sequenced. After the target site was determined, mature rice seeds were harvested. The mature seeds were placed in a 65°C oven and dried to a constant weight. The grain shape of the mature seeds was analyzed. The grain width, grain thickness and thousand-grain weight of the mutant were significantly lower than those of the wild type, and there was no significant difference in grain length (as shown in Figure 2). Figure 7 ). The observation of brown rice of wild type and knockout mutant showed that compared with wild type, the mutant showed an opaque endosperm phenotype (as shown in Figure 8 shown).

[0098] 3. Cytological Analysis

[0099] The mature seeds of wild-type ZH11 and knockout mutants were shelled, and the brown rice was broken in the middle with tweezers to obtain natural cross-sections. The samples were sent to Zhejiang Agricultural Biology and Environmental Science Analysis Center, and the broken seeds were glued to a round carrier with double-sided conductive adhesive. After gold spraying, the processed samples were observed and photographed using a Hitachi SU-8010 scanning electron microscope. The results showed that most of the starch granules in the middle part of the knockout mutant endosperm cells were loosely arranged in circles or ovals, and a small number had irregular polyhedral structures, while the starch granules in the middle part of the wild type were arranged in a compact and regular cube (such as Figure 8 shown).

[0100] Example 5

[0101] Determination of key starch physicochemical parameters in rice OsHsp40-1 gene knockout lines

[0102] To further

[0103] 1. Determination of total starch content

[0104] (1) The mature seeds of the wild type and knockout mutants were shelled and ground into rice flour. The rice flour was carefully sieved into a clean ziplock bag using a 100-mesh sieve for later use. 50 mg of each sample was weighed and three replicates were set up and placed in a 50 mL centrifuge tube. 5 mL of 80% anhydrous ethanol was gently added to the centrifuge tube along the tube wall. The tube was placed in an 85°C water bath for 5 min, and 5 mL of 80% anhydrous ethanol was added again. The tube was centrifuged at a speed of 4000 g for 10 min. The supernatant was carefully removed with a gun. 10 mL of 80% anhydrous ethanol was added to the precipitate, and the mixture was gently mixed. The tube was further centrifuged at 4000 g for 10 min at room temperature. The 50 mL centrifuge tube was quickly turned upside down on filter paper to allow the residual ethanol to dry naturally.

[0105] (2) Dissolve the sample from (1) in 1 mL of ddH2O and boil in a boiling water bath for 30 min; cool to room temperature, add 4 mL of 2 M KOH, and oscillate at room temperature for 30 min (to prevent caking); add 16 mL of sodium acetate (1.2 M, pH = 3.8) and 200 μL of amyloglucosidase (3000 U / mL), and bathe in a 60°C water bath for 45 min, oscillating 2 to 3 times during the process. Finally, make up to 100 mL and gently mix.

[0106] (3) GOD-PAP was used to measure the glucose content. 1 mL of the treated sample (2) was placed in a 1.5 mL centrifuge tube and centrifuged at 4,000 rpm for 10 min. 100 μL of the supernatant was placed in a 10 mL test tube or a 10 mL centrifuge tube and 3 mL of GOD-PAP (taken out in advance, wrapped in tin foil, and placed on ice to melt) was added. The sample was placed in a 37°C constant temperature water bath for 20 min, and then inverted to mix thoroughly. The absorbance was measured at a wavelength of 510 nm using an ELISA reader (Infinite 200PRO, TECAN, Switzerland). The blank was zeroed using 100 μL of the reaction solution treated with 0.1 M (pH 4.75) sodium acetate and 3 mL of GOD-PAP reagent under the same conditions. All samples must be measured within 60 min.

[0107] The gradient glucose solution standard sample reaction solution is as follows:

[0108]

[0109] According to the absorbance value of the standard sample measured in the microplate reader and the known concentration of the standard sample, a standard curve and a regression equation were established. Then, the absorbance value of each sample was substituted into the regression equation to obtain the corresponding glucose content, and finally converted into the total starch content (total starch content equals 0.9 times the glucose content, and the sample water content is calculated as 12%). Each sample was repeated three times, and the average value was finally used as the total starch content. The results showed that the total starch content of the knockout mutant was significantly lower than that of the wild type (such as Fig. 9 shown).

[0110] 2. Determination of amylose content

[0111] (1) Reagent preparation and sample preparation

[0112] The determination of amylose requires anhydrous ethanol, 1M NaOH, 1M acetic acid solution and KI-I2 (2g I2+20g KI+1000mL ddH2O). The mature seeds of the material to be determined are shelled and ground into rice flour, which is sieved with a 100-mesh sieve. 50mg of rice flour and standard sample are weighed into a 50mL volumetric flask (three replicates per group), and the volumetric flask is gently shaken to shake the rice flour attached to the wall of the volumetric flask to the bottom of the flask.

[0113] (2) Determination of amylose

[0114] Add 500 μL of anhydrous ethanol to a 50 mL volumetric flask, and gently rotate the 50 mL volumetric flask to allow the rice flour to be fully mixed with the anhydrous ethanol; then add 4.5 mL of 1 M NaOH solution, rotating the bottle while adding, to wash the rice flour attached to the inner wall to the bottom of the bottle, and let it stand overnight at room temperature for 24 h; add ddH2O to make the volume 50 mL, and gently shake to mix; pipette 5 mL of ddH2O into a 10 mL test tube, and then add 500 μL each of blank, standard and sample to be tested (before pipetting, do not use the first two shots to rinse the gun tip to reduce experimental errors), add 100 μL of 1 M acetic acid solution, 200 μL of KI-I2 and 4.2 mL of ddH2O to the test tube, shake the solution thoroughly using a vortex oscillator, and let it stand for 20 min. The absorbance value OD620 of each sample was measured at a wavelength of 620nm using an ELISA reader (Infinite 200PRO, TECAN, Switzerland). Before use, the blank reaction solution was used to adjust the zero value. A standard curve (standard sample concentration 1.5%, 10.4%, 16.2%, 26.5%) was drawn, and the amylose content of each sample was calculated based on the prepared standard curve. The results showed that the amylose content of the knockout mutant was significantly lower than that of the wild type (such as Fig. 9 shown).

[0115] 3. Determination of total protein content

[0116] (1) Turn on the digestion furnace and set the temperature to 290°C. Weigh 0.2 g of sieved rice flour into a 100 mL digestion tube (try not to let the rice flour touch the tube wall). Add 5 mL of H2SO4. When the temperature reaches 290°C, place the sample in the digestion furnace and boil for 20 min.

[0117] (2) Then take out the digestion tube and shake it gently, then put it back into the digestion furnace and treat it at 290℃ for 1 hour. Take out the digestion tube every 15 minutes and shake it well. After 1 hour, take out the digestion tube and cool it to room temperature. Add 1mL H2O2 to mix it thoroughly, then put the digestion tube back into the digestion furnace. After 10 minutes of treatment, check whether the sample has become clear (if the sample has not become clear after 10 minutes, add 0.5mL H2O2 and put it back into the digestion furnace until it becomes clear), then take it out and cool it to room temperature.

[0118] (3) The volume was finally adjusted to 100 mL and the nitrogen was determined on a FOSS 250 Kjeldahl nitrogen analyzer. The results showed that the total protein content of the oshsp40-1cr1 mutant was significantly lower than that of the wild type, while the oshsp40-1cr2 mutant had no significant change (e.g. Fig. 9 shown).

[0119] 4. Determination of total soluble sugar content

[0120] (1) Reagent preparation

[0121] 100μg / mL glucose standard solution: weigh 100mg of analytical pure anhydrous glucose (glucose, oven-dried at 105℃ for 55min), dissolve it in ddH2O water, and dilute to 100mL, and dilute ten times before use. Anthrone: 1g of anthrone is dissolved in 1L of 80% H2SO4 (diluted with 98% H2SO4, note that the acid must be poured into the water).

[0122] The standard samples are as follows:

[0123]

[0124] (2) Measurement steps

[0125] Weigh 50 mg of sieved rice flour, add 20 mL of deionized water, shake at 250 rpm for 2 h in a 37 ° C shaker, and then centrifuge for 10 min at 4,000 rpm), transfer it to a 100 mL volumetric flask, and dilute to 100 mL with deionized water. Use a 1 mL gun to draw 1 mL of the test solution and add 5 mL of anthrone, place it in boiling water and boil for 10 min, cool to room temperature, and use an ELISA reader (Infinite 200 PRO, TECAN, Switzerland) to measure the absorbance of each sample at a wavelength of 620 nm.

[0126] (3) Calculation: Soluble sugar content (%) = (Y * extract * 10-3) / weight of the measured sample, Y refers to the value calculated by substituting the sample absorbance value measured by the microplate reader into the standard curve regression equation, the water content is 12%, each sample is repeated three times, and the average value is taken as the final measured value. The results showed that the total soluble sugar content of the oshsp40-1cr1 mutant was significantly higher than that of the wild type, and there was no significant change in the oshsp40-1cr2 mutant (such as Fig. 9 shown).

[0127] 5. RVA spectrum analysis

[0128] Weigh 3g of refined rice flour of wild type and knockout mutant accurately, add 25mL of distilled water respectively, and use TechMaster RVA rapid viscosity analyzer of Perten Company of Sweden to measure the viscosity characteristics of rice flour. The results show that the viscosity curve of knockout mutant starch has a similar trend to that of wild type, but there are significant differences between them (such as Fig. 9 As the temperature rises, starch reaches a maximum viscosity peak, which is basically consistent with the wild type, but the maximum viscosity of the knockout mutants is only 57% and 66% of the wild type, respectively. When the temperature decreases, the viscosity values ​​of the three mutants begin to decrease like the wild type, but are still lower than the wild type.

[0129] Example 6

[0130] Obtaining materials related to overexpression of OsHsp40-1 gene

[0131] According to the website https: / / bioinfo.clontech.com / infusion / , the recombinant primers OsHsp40-1-CDS-F and OsHsp40-1-CDS-R were designed for the target gene. The recombinant primers were used to perform PCR amplification with the cDNA of rice Zhonghua 11 as the template. The obtained PCR product of 2097 bp was connected with the cut and purified linearized vector pCUbi1390 in a 50°C metal bath, and then transformed into DH5α Escherichia coli competent cells, spread on LB solid medium containing 50 μg / mL kanamycin resistance, and cultured at 37°C for 12-16h. A single clone was picked and placed in LB liquid medium with kanamycin resistance, and cultured at 37°C until the bacterial solution became turbid. The shaken monoclonal bacteria were then tested by PCR using the recombinant primers, and the positive recombinant bacteria were sent for sequencing verification. The correct vector obtained was named pCUbi1390-OsHsp40-1, which is the expression vector of the gene OsHsp40-1. pCUbi1390-OsHsp40-1 was transformed into Agrobacterium EHA105 competent cells, and Agrobacterium transformation was performed to obtain positive strains, which were mailed to a transgenic company for transgenic. The recipient materials were Zhonghua 11, Ningjing 1, and Huazhan. The map of the pCUbi1390-OsHsp40-1 overexpression vector is shown in Figure 1. Fig.10 shown.

[0132] OsHsp40-1-CDS-F (SEQ ID NO.15):

[0133] 5′TTACTTCTGCACTAGGTACCATGGAGTCCGTCGCGATCG-3′;

[0134] OsHsp40-1-CDS-R (SEQ ID NO.16):

[0135] 5′-GAATTCCCGGGGATCCTCACAGAATTGGAAATATG-3′.

[0136] Example 7

[0137] Positive identification of rice lines overexpressing OsHsp40-1 gene

[0138] In order to identify the positive overexpression transgenic strains, the obtained transgenic seedlings were cultured in a normal temperature light incubator for about a week and then identified. The specific steps are as follows:

[0139] Hygromycin primers were designed online by NCBI, and DNA extracted from leaves of overexpressed transgenic plants was used as template for PCR amplification. Water or leaf DNA of non-transgenic materials was generally used as negative control. The amplified samples were subjected to agarose electrophoresis to detect whether there were bands. Plants with bands were positive. The primer information is as follows:

[0140] HygF(SEQ ID NO.17):GACCTGATGCAGCTCTCGGA

[0141] HygR(SEQ ID NO.18):GCTGTTATGCGGCCATGTC

[0142] The RNA of the overexpressed transgenic strain was extracted and converted into cDNA for later use. qRT-PCR was further performed (the steps were the same as in Example 1). The primers used were qRT-Hsp40-1F and qRT-Hsp40-1R, and the rice constitutively expressed gene Actin1 was used as the internal reference. The primer sequences were as follows:

[0143] qRT-Hsp40-1F(SEQ ID NO.19):TACACTGACGGCACTGTCTT

[0144] qRT-Hsp40-1R (SEQ ID NO.20):TCTCCTTCGTAGCGGAAGTC

[0145] The results of the real-time PCR experiment are based on 2 -△△CT The results showed that the expression level of OsHsp40-1 gene in the T2 transgenic lines numbered OE12 and OE17 under the Zhonghua 11 background was significantly higher than that in the wild type (e.g. Fig.11 The expression level of OsHsp40-1 gene in the transgenic lines numbered OE16 and OE25 of the T2 generation of Ningjing 1 was significantly higher than that in the wild type (as shown in Fig.11 The expression level of OsHsp40-1 gene in the T2 transgenic lines numbered OE1 and OE20 under the Huazhan background was significantly higher than that in the wild type (as shown in Fig.11 shown).

[0146] Example 8

[0147] Effects of OsHsp40-1 overexpressing transgenic lines on rice yield-related agronomic traits

[0148] Wild-type (ZH11, Ninggeng01 and Huazhan) and T2 transgenic positive lines overexpressing OsHsp40-1 were cultivated in the field with conventional sunlight and water and fertilizer management. 15 lines with significantly increased expression of OsHsp40-1 gene and their corresponding wild-type plants were selected at the peak tillering stage, and the number of rice tillers (such as Fig.11 When the rice matures, 15 positive strains of the OsHsp40-1 gene and 15 corresponding wild-type plants are selected, and the rice plant heights are counted (as shown in Fig.11 At the same time, the yield traits, grain length, grain width, thousand-grain weight and single-plant yield (as shown in Fig.11 The results showed that except for the overexpression lines in Ningjing 1 background, which had significantly lower plant height and significantly higher tillering than the wild type, there were no significant differences in plant height and tillering in Zhonghua 11 and Huazhan backgrounds. The overall tillering rate was not significantly different between the overexpression lines and their wild type counterparts under the three backgrounds. The grain length, 1000-grain weight and single-plant yield of the OsHsp40-1 overexpression lines under the three backgrounds were all increased compared with the corresponding indicators of the wild type plants (such as Fig.11 shown).

[0149] Example 9

[0150] Quality evaluation of rice transgenic lines overexpressing OsHsp40-1 gene in Zhonghua 11 background

[0151] The wild-type ZH11 and the T2 transgenic lines overexpressing the OsHsp40-1 gene were cultivated in the field with conventional sunlight, water and fertilizer management, and the mature seeds were harvested for the following experiments.

[0152] (1) Analysis of chalky rice grain rate

[0153] For the mature seeds of the wild type and the OsHsp40-1 overexpression positive strain, 100 mature seeds were randomly selected, and the seed shells were removed to count the chalky grain rate. The results showed that the chalky grain rate of the overexpression strain seeds was significantly lower than that of Zhonghua 11 (such as Fig.12 shown).

[0154] (2) Analysis of Rice Nutritional Quality

[0155] The obtained mature seeds of the wild type and the positive strains overexpressing the OsHsp40-1 gene were hulled and ground into rice flour, and the rice flour was carefully sieved into a clean ziplock bag using a 100-mesh sieve for determining the total starch content, amylose content and total protein content in the prepared rice flour. The specific method is as shown in Example 5. The results showed that overexpressing the OsHsp40-1 gene in rice can increase the total starch and amylose content in rice (such as Fig.12shown).

Claims

1. Rice endosperm development-related genes OsHsp40-1 Application in improving rice yield and quality, the OsHsp40-1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. The improving rice yield and quality specifically includes increasing grain length, thousand-grain weight, single plant yield and reducing endosperm chalky grain rate.

2. The use according to claim 1, characterized in that The rice endosperm development-related gene OsHsp40-1 The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A method for improving rice yield and quality, wherein the rice yield is improved by increasing grain length, thousand-grain weight and single-plant yield, and the quality is improved by reducing the rate of endosperm chalky grains, characterized in that Overexpression in rice plants as claimed in claim 1 OsHsp40-1 Gene, including the following steps: (1) Construction of pCUbi1390-OsHsp40-1 overexpression vector; (2) Through Agrobacterium-mediated method, the OsHsp40-1 The gene overexpression vector is introduced into rice cells, and transgenic plants are obtained after cultivation; (3) Hygromycin marker was used to screen positive transgenic plants, and then RT-PCR method was used to obtain positive plants with higher expression levels.

Images