Preparation and application of a mouse model of biliary liver fibrosis

A mouse model of biliary liver fibrosis was prepared by knocking out the Zfyve19 gene in mice using CRISPR gene editing technology and inducing it with α-naphthyl isothiocyanate. This solved the problem that existing models could not effectively simulate human diseases and achieved efficient and stable simulation of drug research.

CN116218915BActive Publication Date: 2026-04-14CHILDRENS HOSPITAL OF FUDAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-29
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing mouse models of biliary liver fibrosis cannot effectively simulate human disease and suffer from problems such as complex operation, high mortality rate, or poor simulation effect.

Method used

The Zfyve19 gene in mice was knocked out using CRISPR gene editing technology, and a Zfyve19 gene knockout mouse model was prepared by induction with isothiocyanate-A-naphthyl ester. This model simulates human ZFYVE19 deficiency and provides a mouse model of biliary liver fibrosis.

Benefits of technology

It provides a stable and efficient animal model that simulates human biliary liver fibrosis, suitable for drug research, with high simulation stability and efficiency, and closely resembles the human disease process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116218915B_ABST
    Figure CN116218915B_ABST
Patent Text Reader

Abstract

The application relates to preparation of a cholestatic liver fibrosis mouse model and application thereof, and belongs to the technical field of biological medicines. The preparation of the cholestatic liver fibrosis mouse model comprises preparing Zfyve19 gene knockout mice, and performing an isothiocyanate-A-naphthyl ester drug induction on the Zfyve19 gene knockout mice to obtain the cholestatic liver fibrosis mouse model. The model preparation method has the advantages of good simulation of human diseases, high success rate of modeling, short modeling time and high modeling stability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the preparation and application of a mouse model of biliary liver fibrosis, belonging to the field of biomedical technology. Background Technology

[0002] Biliary liver fibrosis / cirrhosis is a major cause of death or liver transplantation in children and adults. Animal models play an irreplaceable role in studying pathogenic mechanisms and discovering new therapeutic targets. Current techniques for creating mouse models of biliary liver fibrosis include bile duct ligation, drug / toxin induction, and some gene manipulation techniques (Mdr2). - / - Mouse, Cftr - / - Mouse, CDH1 ΔL Mouse, Vil2 kd / kd Disease models (e.g., rodents). While bile duct ligation surgery for modeling is fast, it has a high mortality rate, requires a demanding surgical environment, and cannot accurately simulate human diseases. Drug / toxicant induction models, including DDC, TAA, and CCI4, also cannot accurately simulate human diseases. Mdr2 - / - Mouse, Cftr - / - Mouse, CDH1 ΔL Mouse, Vil2 kd / kd Each mouse has its own unique characteristics, but also its own limitations. Therefore, there is an urgent need for new models of biliary liver fibrosis / cirrhosis in this field.

[0003] The inventors' team was the first in the world to identify that complete loss-of-function mutations in the ZFYVE19 biallelic gene can cause bile duct hyperplasia and biliary liver fibrosis in humans, ultimately leading to portal hypertension and death or requiring liver transplantation for long-term survival. This finding has been replicated by international peers and indexed by OMIM (MIM#619849). Based on these findings, the inventors created Zfyve19 gene knockout mice and induced them with α-naphthyl isothiocyanate, finding that they could mimic human ZFYVE19 disease. These mice hold promise as animal models for studying the pathogenesis of biliary liver fibrosis and for researching new drugs. Summary of the Invention

[0004] One of the technical problems to be solved by this invention is how to obtain a mouse model that can better simulate human biliary liver fibrosis.

[0005] To address the aforementioned problems, the present invention provides a method for preparing a mouse model of biliary liver fibrosis, comprising preparing Zfyve19 gene knockout mice and inducing the Zfyve19 gene knockout mice with isothiocyanate-A-naphthyl ester to obtain a mouse model of biliary liver fibrosis.

[0006] Preferably, the Zfyve19 gene knockout mouse is prepared by using CRISPR gene editing technology to obtain a gene knockout mouse model.

[0007] Preferably, the Zfyve19 gene knockout selects exons 3-6 of the mouse Zfyve19 gene as the target site.

[0008] Preferably, in the process of obtaining a gene knockout mouse model using the CRISPR gene editing technology, the sgRNA used includes gRNA1 with a nucleotide sequence as shown in SEQ ID NO.1 and gRNA2 with a nucleotide sequence as shown in SEQ ID NO.2.

[0009] Preferably, the isothiocyanate-A-naphthyl ester induction process includes selecting Zfyve19 - / - Mice were given 60 mg / kg of α-naphthyl isothiocyanate by gavage on days 0, 7, and 14 to induce a mouse model of biliary liver fibrosis.

[0010] This invention provides the application of a mouse model obtained according to the above-described method for preparing a mouse model of biliary liver fibrosis.

[0011] Preferably, the application includes its use in the preparation of medicaments for the prevention or treatment of congenital liver fibrosis.

[0012] Preferably, the application includes its use in the preparation of medicaments for the prevention or treatment of biliary liver fibrosis.

[0013] Preferably, the application includes its use in the preparation of medicaments for the prevention or treatment of liver fibrosis.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] This invention uses Zfyve19 knockout mice, homologous to the pathogenic gene that causes human biliary liver fibrosis, sclerosing cholangitis, and cholestasis, as the basic animal model. A-naphthyl isothiocyanate is then used for gavage to establish the model, effectively mimicking human ZFYVE19 deficiency and simulating acquired biliary liver fibrosis and cirrhosis in humans under a specific genetic background. Furthermore, the model establishment method exhibits high stability and efficiency. The model creation method provided by this invention has the advantage of more closely resembling the human disease process. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of the gene knockout scheme of the present invention;

[0017] Figure 2 This is a diagram showing changes in mouse liver tissue and gallbladder after the successful construction of the model of this invention.

[0018] Figure 3 These are H&E and Sirius red stained sections of mouse liver tissue obtained after the successful construction of the model of this invention.

[0019] Figure A shows H&E staining with a scale bar of 100 μm; Figure B shows Sirius red staining with a scale bar of 100 μm.

[0020] Figure 4 This is a PCR diagram of the F0 generation mice that were positive for biliary liver fibrosis in this invention.

[0021] Figure 5 This is a PCR diagram of the F1 generation mice that were positive for the biliary liver fibrosis mouse model of this invention.

[0022] Figure 6 The PCR-positive F2 generation mouse gene PCR of the biliary liver fibrosis mouse model of this invention was verified. Figure 1 ;

[0023] Figure 7 The PCR-positive F2 generation mouse gene PCR of the biliary liver fibrosis mouse model of this invention was verified. Figure 2 ;

[0024] Figure 8 The images show H&E and Sirius red stained sections of liver tissue obtained from the biliary liver fibrosis mouse model of the present invention after administration of ANIT. Detailed Implementation

[0025] To make the present invention more apparent and understandable, detailed descriptions are provided below with reference to embodiments:

[0026] The technical solution adopted in this invention is to provide a method for preparing a mouse model of biliary liver fibrosis, including preparing Zfyve19 gene knockout mice and inducing Zfyve19 gene knockout mice with isothiocyanate-A-naphthyl ester to obtain a mouse model of biliary liver fibrosis.

[0027] Zfyve19 gene knockout mice were created using CRISPR gene editing technology to obtain a gene knockout mouse model.

[0028] During the Zfyve19 gene knockout process, exons 3-6 of the mouse Zfyve19 gene were selected as target sites.

[0029] In the process of obtaining gene knockout mouse models using CRISPR gene editing technology, the sgRNAs used include gRNA1 with nucleotide sequences as shown in SEQ ID NO.1 and gRNA2 with nucleotide sequences as shown in SEQ ID NO.2.

[0030] The induction process of α-naphthyl isothiocyanate involved selecting Zfyve19 calves aged 6-8 weeks and weighing 18-22g. - / - Male mice were administered 60 mg / kg of α-naphthyl isothiocyanate by gavage on days 0, 7, and 14 of modeling to induce a mouse model of biliary liver fibrosis.

[0031] This invention provides the application of a mouse model obtained according to the above-described method for preparing a mouse model of biliary liver fibrosis.

[0032] The above applications include the use in the preparation of drugs for the prevention or treatment of congenital liver fibrosis.

[0033] The above applications include the use in the preparation of drugs for the prevention or treatment of biliary liver fibrosis.

[0034] The above applications include the use in the preparation of drugs for the prevention or treatment of liver fibrosis.

[0035] The method for preparing a mouse model includes the following steps:

[0036] (1) Preparation of Zfyve19 gene knockout mice:

[0037] ① The mouse species was C57BL / 6N, and gene knockout mice were obtained using CRISPR gene editing technology.

[0038] ② Target site selection: The mouse Zfyve19 gene (GenBank accession number: NM 028054.3; Ensembl: ENSMUSG00000068580) is located on mouse chromosome 2. Exons 3–6 were selected as target sites.

[0039] ③ Design sgRNA (single guide RNA):

[0040] gRNA1 (matches forward strand of gene): SEQ ID NO.1: CCTTGTGGCCTTGTGCGCCCTGG;

[0041] gRNA2 (matches reverse strand of gene): SEQ IDNO.2GGAGCGGGCAACTGCACGGTAGG;

[0042] ④ Inject sgRNA and Cas9 mRNA into mouse zygotes;

[0043] ⑤ The injected fertilized eggs were transferred to the oviduct of a pseudopregnant female mouse;

[0044] ⑥ Obtain and screen positive F0 generation mice, perform genotyping by PCR, and then perform DNA sequencing analysis.

[0045] ⑦ Positive F0 mice were mated with wild-type mice to obtain F1 generation heterozygous mice;

[0046] ⑧ The positive F1 cells were cultured into the next generation (F2), and then genotyping was performed by PCR and DNA sequencing analysis.

[0047] (2) Gavage with α-naphthyl isothiocyanate (ANIT):

[0048] Zfyve19 for children aged 6-8 weeks and weighing 18-22g - / - Male mice were administered ANIT 60 mg / kg (dissolved in olive oil) by gavage on days 0, 7, and 14 of modeling; modeling was completed.

[0049] (3) Verification of modeling results: Mice were sacrificed 36-48 hours after the last gavage and after fasting for 4 hours. Body weight was recorded before each gavage and before sacrifice. Serum and liver samples were collected for further analysis.

[0050] Phenotypic observation:

[0051] Mice that had successfully established the model were euthanized after inhaling an excessive amount of isoflurane. The abdomen was opened to expose the liver, and the liver color, texture, lesions, gallbladder size, and bile color were observed. After weighing the intact liver, a 0.5mm thick section was obliquely cut from the largest lobe and fixed in 4% paraformaldehyde for 48 hours before being embedded in paraffin. The degree of liver fibrosis was observed using H&E and Sirius red staining. The sections showed typical biliary liver fibrosis, bile duct proliferation, and widening and deformity, confirming successful model establishment.

[0052] like Figure 1 The image shows the gene knockout protocol, Zfyve19. - / - A schematic diagram of the mouse construction process.

[0053] like Figure 2 The images show changes in the liver tissue and gallbladder of mice that have successfully developed the model; gross anatomical images of the mouse liver and gallbladder are also shown.

[0054] Figure 3 The liver tissue sections of the model mice were stained with H&E and Sirius red. Image A shows H&E staining (scale bar = 100 μm); Image B shows Sirius red staining (scale bar = 100 μm).

[0055] Example

[0056] Preparation of a mouse model of biliary liver fibrosis:

[0057] 1. Preparation of gene knockout mouse models:

[0058] (1) Mouse species: C57BL / 6N, a gene knockout mouse model was obtained using CRISPR gene editing technology.

[0059] (2) Target site selection: The mouse Zfyve19 gene (GenBank accession number: NM 028054.3; Ensembl: ENSMUSG00000068580) is located on mouse chromosome 2. Exons 3-6 were selected as target sites.

[0060] (3) Design sgRNA (single guide RNA):

[0061] SEQ ID NO.1: gRNA1 (matches forward strand of gene): CCTTGTGGCCTTGTGCGCCCTGG

[0062] SEQ ID NO.2: gRNA2 (matches reverse strand of gene): GGAGCGGGCAACTGCACGGTAGG

[0063] (4) Inject sgRNA and Cas9 mRNA into mouse zygotes;

[0064] (5) The injected fertilized eggs were transferred into the oviduct of pseudopregnant female mice;

[0065] (6) Obtain and screen positive F0 generation mice, perform genotyping by PCR, and then perform DNA sequencing analysis.

[0066] (7) Positive F0 mice were mated with wild-type mice to obtain F1 generation heterozygous mice;

[0067] (8) Positive F1 cells were cultured into the next generation (F2), and then genotyping was performed by PCR and DNA sequencing analysis.

[0068] 2. Results of the gene knockout mouse model:

[0069] (1) F0 generation detection:

[0070] PCR typing was performed using the primers and conditions shown below to obtain the PCR products (e.g., ...). Figure 4 As shown, Figure 4 Zfyve19 - / -The F0 generation of mice, numbered 117 and 142, produced PCR products of 620 bp (compared to 2643 bp in wild-type mice). The amplicon was subsequently purified and sent for DNA sequencing analysis. DNA sequencing using the primers listed below revealed that Mouse-ID#117 had a 2081-base deletion and 6 point mutations (CCTTGT>GTACCC) in one allele; Mouse-ID#142 had a 2021-base deletion in one allele.

[0071] ·Mouse Zfyve19-F:5'-CAAAATCTGGTCACAACTTCACTTCC-3'

[0072] ·Mouse Zfyve19-R:5'-GTAGCAATTCAGCTCTACATCGCAC-3'

[0073] ·Product Size: WT: 2643bp; MT: ∽ 620bp, delete ∽ 2020bp

[0074] Annealing Temperature: 60℃

[0075] ·DNA Sequencing Primer (Forward Sequencing):

[0076] 5'-CAGAGAAGAGCCATCGGGGC-3'

[0077] (2) F1 generation detection:

[0078] PCR typing was performed using the above primers and conditions to obtain PCR products (e.g. Figure 5 As shown, Figure 5 Zfyve19 - / - Mice from the F1 generation, numbered 51, 52, 53, 61, 62, and 64, produced PCR products of 620 bp, while wild-type mice produced products of 2643 bp. The amplicon was subsequently purified and sent for DNA sequencing analysis. DNA sequencing revealed that mouse IDs #51, #52, and #53 had a deletion of 2081 bases and 6 point mutations (CCTTGT>GTACCC) in one allele; Mouse-IDs #61, #62, and #64 had a deletion of 2021 bases in one allele.

[0079] (3) F2 generation detection:

[0080] The following two pairs of primers and conditions were used for PCR typing to obtain the PCR products (e.g. Figure 6 , Figure 7 As shown, Figure 6 The PCR product size of Zfyve19 F2 generation mice numbered 2, 4, 7, 8, 9, 10, 12 and 14 was 620bp, while the product size of wild-type mice was 2643bp. Figure 7 Mice from the F2 generation of Zfyve19 mice, numbered 2, 4, 7, 9, 12, and 14, produced PCR products of 493 bp, indicating heterozygous mice; mice numbered 8 and 10 showed no bands, indicating homozygous mice; wild-type mice produced PCR products of 2643 bp. The amplicon was subsequently purified and sent for DNA sequencing analysis.

[0081] Primer 1

[0082] ·Mouse Zfyve19-F:5'-CAAAATCTGGTCACAACTTCACTTCC-3'

[0083] ·Mouse Zfyve19-R:5'-GTAGCAATTCAGCTCTACATCGCAC-3'

[0084] ·Product Size: WT: 2643bp; MT: ≈ 620bp, delete ≈ 2020bp

[0085] Annealing Temperature: 60℃

[0086] ·DNA Sequencing Primer (Forward Sequencing):

[0087] 5'-CAGAGAAGAGCCATCGGGGC-3'

[0088] Primer 2

[0089] ·Mouse Zfyve19-F:5'-CAAAATCTGGTCACAACTTCACTTCC-3'

[0090] ·Mouse Zfyve19-R-homo:5'-AGCCCCACTTGTCTTCTTCTCAGC-3'

[0091] ·Product Size:Heterozygote:493bp; Homozygote:0bp

[0092] Annealing Temperature: 60℃

[0093] (4)The mRNA transcribed from targeted allele with frame shiftundergoes nonsense-mediated decay (NMD):

[0094] ID#117-F2-Mouse-ID#2,#4,#7,#8:

[0095] 1 MESRCYGCAV KFTLFKKEYG CKNCGRAFCN GCLSFSALVP RAGNTQQKVC

[0096] 51 KQCHTILTSL SPE

[0097] ID#142-F2-Mouse-ID#9,#10,#12,#14:

[0098] 1 MESRCYGCAV KFTLFKKEYG CKNCGRAFCN GCLSFSALVP RAGNTQQKVC

[0099] 51 KQCHTILTSL SPE

[0100] 3. Modeling by gavage administration of α-naphthyl isothiocyanate (ANIT):

[0101] Among the mice mentioned above, male mice aged 6-8 weeks and weighing 18-22g were selected. On days 0, 7, and 14, ANIT 60mg / kg (dissolved in olive oil) was administered by gavage to establish the model.

[0102] 36-48 hours after the last gavage, the patient was euthanized by isoflurane overdose. The abdominal cavity was opened to expose the liver, and the liver color, texture, lesions, gallbladder size, and bile color were observed. The entire liver was harvested and weighed. The largest lobe was obliquely cut into 0.5 mm thick pieces, fixed in 4% paraformaldehyde for 48 hours, and then embedded in paraffin. The entire gallbladder was then harvested.

[0103] Result: As Figure 8 Figure A shows H&E staining of mouse liver tissue, indicating bile duct proliferation and biliary liver fibrosis. Figure 8 Image B shows Sirius red staining of mouse liver tissue, indicating significant biliary liver fibrosis. Combined with... Figure 8 Figures A and B show that the model was successfully created.

[0104] The degree of liver fibrosis was observed by H&E and Sirius red staining. Typical biliary liver fibrosis, bile duct proliferation and widening deformity were observed in the sections, confirming that the model was successful.

[0105] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

[0106]

Claims

1. A method for preparing a mouse model of biliary liver fibrosis, characterized in that, This includes preparing homozygous Zfyve19 gene knockout mice and inducing homozygous Zfyve19 gene knockout mice with isothiocyanate-A-naphthyl ester to obtain a mouse model of biliary liver fibrosis. The Zfyve19 gene knockout mouse model was obtained using CRISPR gene editing technology. The Zfyve19 gene knockout selects exons 3-6 of the mouse Zfyve19 gene as target sites; In the process of obtaining gene knockout mouse models using the CRISPR gene editing technology, the sgRNAs used include gRNA1 with nucleotide sequences as shown in SEQ ID NO.1 and gRNA2 with nucleotide sequences as shown in SEQ ID NO.

2.

2. The method for preparing a mouse model of biliary liver fibrosis according to claim 1, characterized in that, The isothiocyanate-A-naphthyl ester induction process includes selecting Zfyve19 - / - Mice were given 60 mg / kg of α-naphthyl isothiocyanate by gavage on days 0, 7, and 14 to induce a mouse model of biliary liver fibrosis.