Method for separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations, kit and application thereof
Through orthogonal ligation analysis and functionalized magnetic bead technology, combined with the enzyme cutting method of DNA-RNA hybrids, efficient and non-destructive separation and enrichment of double-positive extracellular vesicle subpopulations of membrane proteins is achieved, solving the problems of slow separation speed and insufficient selectivity in the existing technology, and providing a general separation platform.
Patent Information
- Application Number
- CN202310315720.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-27
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2043-03-27
AI Technical Summary
The prior art is difficult to achieve efficient and non-destructive isolation and enrichment of double-positive extracellular vesicle subpopulations of membrane proteins, especially affected by free proteins, lipoproteins and ruptured fragments, and the separation speed is limited.
Orthotopic ligation analysis (PLA) combined with functionalized magnetic bead technology is used to form DNA-RNA hybrids through specific antibody nucleic acid complexes and RNA ligation strands. Functionalized magnetic beads are used to capture double-positive extracellular vesicle subpopulations of membrane proteins, and enrichment is achieved through enzyme cleavage of nucleic acid strands.
The non-destructive separation and enrichment of double-positive extracellular vesicle subpopulations of membrane proteins is achieved, ensuring the number and quality of vesicles. It also provides a general technical platform that can replace antibodies or target membrane surface molecules as needed to achieve the separation and enrichment of double-target positive extracellular vesicle subpopulations.
Smart Images

Figure CN116254225B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biochemical technology, and in particular to a method for separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations, a kit and applications thereof. Background Art
[0002] Extracellular vesicles (EVs) are lipid bilayer membrane vesicles with a diameter of 30-2000 nm secreted by cells. They carry signaling molecules such as proteins and nucleic acids, mediating processes such as intercellular communication, cell proliferation, and angiogenesis, and are involved in the development and progression of tumors. EVs are highly heterogeneous, especially in terms of protein markers. EVs carrying different proteins have distinct biological functions. For example, HER2+ EVs are used for breast cancer diagnosis, PDL1+ EVs are used for therapeutic efficacy assessment, and Integrin+ EVs can be used for metastasis prediction. EV subpopulations positive for different protein markers also carry distinct nucleic acid profiles, suggesting that sequencing EV subpopulations positive for a particular protein type can more accurately identify nucleic acid markers. Therefore, classifying and analyzing EV subpopulations with specific proteins will facilitate a more precise understanding of the biological significance of EVs.
[0003] Existing EV separation technologies, such as ultracentrifugation, ultrafiltration, and size exclusion, are based on physical properties of EVs, such as size and specific gravity. These methods lack selectivity, hindering the exploration of EV biological functions. However, some studies have reported that magnetic beads modified with antibodies and aptamers, or novel materials that provide a reactive interface, can isolate specific protein-positive EVs. The inventors of this application previously modified lipid probes on metal-organic frameworks (MOFs) with a relatively large specific surface area and constructed an EV separation platform called EV-FISHER by lipid affinity binding with EVs (Pan WL, Feng JJ, Luo TT, Tan Y, Situ B, Nieuwland R, Guo JY, Liu CC, Zhang H, Chen J, Zhang WH, Chen J, Chen XH, Chen HY, Zheng L, Chen JX, Li B. Rapid and efficient isolation platform for plasma extracellular vesicles: EV-FISHER[J]. Journal of Extracellular Vesicles, 2022, 11(11).). However, they are all EV separation methods based on a single parameter, which are inevitably affected by free proteins, lipoproteins and rupture fragments. Flow cytometry can achieve multi-parameter particle separation and enrichment, but due to its detection limit, it is currently only capable of sorting large EVs with a particle size greater than 200 nm. Furthermore, sorting speed is limited, and obtaining sufficient EV content for biomarker screening or functional studies is time-consuming. Therefore, achieving multi-parameter separation and enrichment of specific EV subpopulations remains challenging.
[0004] Proximity ligation assay (PLA) is a specialized immunoassay method that uses a pair of antibody-nucleic acid complexes. The antibodies specifically recognize the target protein. When these two molecules recognize the same protein, the nucleic acid chains carried by the two antibody-nucleic acid complexes come closer together, generating the so-called proximity effect. EVs are a collection of markers, and PLA has been widely used in recent years to detect specific subpopulations of membrane protein-double-positive EVs. However, the isolation of specific membrane protein-double-positive EV subpopulations using PLA has not been reported. Summary of the Invention
[0005] In view of the shortcomings of the prior art described above, the purpose of the present invention is to provide a method for separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations, a kit and its application, and to provide a new general technology for the non-destructive separation and enrichment of membrane protein double-positive specific extracellular vesicle subpopulations.
[0006] To achieve the above-mentioned and other related objectives, the present invention provides, in a first aspect, a method for isolating and enriching a membrane protein double-positive specific extracellular vesicle subpopulation, comprising the following steps:
[0007] The extracellular vesicle sample to be processed, two antibody nucleic acid complexes specifically targeting extracellular vesicle membrane protein markers are incubated with an RNA linker capable of connecting the two antibody nucleic acid complexes to obtain a DNA-RNA hybrid, thereby achieving the bundling of the extracellular vesicle double-positive membrane protein;
[0008] The DNA-RNA hybrid is specifically captured by functionalized magnetic beads to achieve the separation of membrane protein double-positive specific extracellular vesicle subpopulations, wherein the functionalized magnetic beads are immunomagnetic beads coupled with a second antibody that can specifically recognize the DNA-RNA hybrid;
[0009] Enrichment of membrane protein double-positive specific extracellular vesicle subpopulations is achieved by enzymatic cleavage of nucleic acid chains.
[0010] In one embodiment of the present invention, the two antibody-nucleic acid complexes are respectively a first antibody-DNA1 conjugate (i.e., a conjugate of the first antibody and DNA1) and a first antibody-DNA2 conjugate (i.e., a conjugate of the first antibody and DNA2), wherein the first antibody is an antibody against an extracellular vesicle membrane protein marker.
[0011] The sequence of the DNA1 is shown in SEQ ID NO.1:
[0012] TGTGGTCTATGTCCGTCGTTCGCTAGTAGTTCCTGGGCTGCAC,
[0013] The sequence of the DNA2 is shown in SEQ ID NO.2:
[0014] TCGAGGCGTAGAATTCCCCCGATGCGCGCTGTTCT.
[0015] In one embodiment of the present invention, the first antibody is selected from at least one of CD9 antibody, CD63 antibody, CD81 antibody, CD235a antibody, CD45 antibody, CD41a antibody, and CD144 antibody; preferably, the first antibody conjugated to DNA1 is selected from at least one of CD9 antibody, CD63 antibody, and CD81 antibody, and the first antibody conjugated to DNA2 is selected from at least one of CD9 antibody, CD63 antibody, CD81 antibody, CD235a antibody, CD45 antibody, CD41a antibody, and CD144 antibody.
[0016] In one embodiment of the present invention, the first antibody-DNA1 conjugate is selected from at least one of a CD9 antibody-DNA1 conjugate (referred to as CD9-DNA1), a CD63 antibody-DNA1 conjugate (referred to as CD63-DNA1), and a CD81 antibody-DNA1 conjugate (referred to as CD81-DNA1); and the first antibody-DNA2 conjugate is selected from at least one of a CD235a antibody-DNA2 conjugate (referred to as CD235a-DNA2), a CD45 antibody-DNA2 conjugate (referred to as CD45-DNA2), a CD41a antibody-DNA2 conjugate (referred to as CD41a-DNA2), and a CD144 antibody-DNA2 conjugate (referred to as CD144-DNA2).
[0017] In one embodiment of the present invention, the first antibody-DNA2 conjugate used to separate and enrich extracellular vesicles derived from red blood cells, white blood cells, platelets, and vascular epithelial cells is selected from CD235a antibody-DNA2 conjugate, CD45 antibody-DNA2 conjugate, CD41a antibody-DNA2 conjugate, and CD144 antibody-DNA2 conjugate, respectively.
[0018] In one embodiment of the present invention, the first antibody-DNA1 conjugate and the first antibody-DNA2 conjugate are constructed by mixing and incubating a streptavidin-modified first antibody with biotinylated DNA1 and DNA2, respectively.
[0019] In one embodiment of the present invention, the RNA connecting strand contains a plurality of bases that are complementary to the bases of DNA1 and DNA2; preferably, the RNA connecting strand is RNA3, and the sequence of RNA3 is shown in SEQ ID NO. 5:
[0020] CGCCUCGAGUGCAGCC.
[0021] In one embodiment of the present invention, the second antibody is selected from Ab S9.6.
[0022] In one embodiment of the present invention, the functionalized magnetic beads are formed by combining a biotinylated or avidinylated second antibody with avidinylated or biotinylated magnetic beads, and the magnetic beads are preferably Dynabeads TM MyOne TM Streptavidin C1 magnetic beads.
[0023] In one embodiment of the present invention, the enzyme is an endonuclease capable of hydrolyzing the DNA-RNA hybrid.
[0024] In one embodiment of the present invention, the endonuclease is selected from at least one of DNase I, RNase A, and RNase H; preferably, the endonuclease is selected from RNase A and / or RNase H; more preferably, the endonuclease is selected from RNase H.
[0025] In one embodiment of the present invention, the method comprises the following steps:
[0026] First, the extracellular vesicle sample to be processed is incubated with two antibody-nucleic acid complexes that specifically target extracellular vesicle membrane protein markers. The excess free antibody-nucleic acid complexes are removed by ultrafiltration to obtain extracellular vesicles labeled with the antibody-nucleic acid complexes.
[0027] Then, the RNA connecting strand is mixed with the extracellular vesicles labeled with the antibody nucleic acid complex to hybridize to form the DNA-RNA hybrid;
[0028] Then, the functionalized magnetic beads are added, incubated, and washed, and the functionalized magnetic beads capture membrane protein double-positive specific extracellular vesicles;
[0029] Enzymes are then added to hydrolyze the DNA-RNA hybrid, resulting in the release of captured extracellular vesicles.
[0030] In the above examples, incubation and hybridization were performed at room temperature for 0.5 to 2 hours.
[0031] A second aspect of the present invention provides a kit for separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations, the kit comprising:
[0032] At least two antibody-nucleic acid complexes that specifically target extracellular vesicle membrane protein markers, an RNA connecting chain capable of connecting the antibody-nucleic acid complexes, functionalized magnetic beads, and an endonuclease, wherein the functionalized magnetic beads are immunomagnetic beads coupled to a second antibody that can specifically recognize DNA-RNA hybrids;
[0033] The DNA-RNA hybrid is obtained by incubating the extracellular vesicle sample to be processed, two antibody nucleic acid complexes specifically targeting extracellular vesicle membrane protein markers, and an RNA connecting chain capable of connecting the two antibody nucleic acid complexes.
[0034] A third aspect of the present invention provides a kit for separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations, the kit comprising:
[0035] At least two first antibodies, DNA1, DNA2, RNA connecting chain, second antibody, magnetic beads, endonuclease,
[0036] The first antibody is an antibody against an extracellular vesicle membrane protein marker,
[0037] The sequences of DNA1 and DNA2 are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, and the RNA connecting chain contains several bases that are complementary to the bases of DNA1 and DNA2.
[0038] The second antibody is an antibody that can specifically recognize DNA-RNA hybrids,
[0039] The endonuclease is used to hydrolyze the DNA-RNA hybrid.
[0040] In one embodiment of the present invention, the kit further comprises at least one of the following components: biotin and streptavidin.
[0041] In the above embodiment, the kit separates and enriches the extracellular vesicle subpopulations in the extracellular vesicle sample to be processed according to the method described in the first aspect.
[0042] The fourth aspect of the present invention provides use of the method according to the first aspect or the kit according to the second aspect or the third aspect in separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations.
[0043] As described above, the membrane protein double-positive specific extracellular vesicle subpopulation separation and enrichment method, kit and application thereof of the present invention have the following beneficial effects:
[0044] The design proposed in the present invention takes PLA as the technical core. It specifically targets extracellular vesicle membrane protein markers through two antibody nucleic acid complexes, and then introduces an RNA chain connecting the two antibody nucleic acid complexes to form a DNA-RNA hybrid, thereby achieving the bundling of extracellular vesicle double-positive membrane proteins. Then, the DNA-RNA hybrid is specifically captured by immunomagnetic beads coupled with DNA-RNA hybrid antibodies to achieve the separation of membrane protein double-positive extracellular vesicle subpopulations. Finally, the membrane protein double-positive extracellular vesicle subpopulation is enriched by enzymatic cleavage of the nucleic acid chain.
[0045] The technology provided by the present invention can achieve lossless separation and enrichment of membrane protein double-positive specific extracellular vesicle subpopulations, which can ensure both the quantity and quality of extracellular vesicles; at the same time, the technology provided by the present invention is a universal technical platform, and antibodies or recognition elements targeting membrane surface molecules (such as sugars / lipids) can be replaced according to actual needs to achieve lossless separation and enrichment of double-target positive extracellular vesicle subpopulations. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 Shown is a schematic diagram of the principle of the method for separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations in an embodiment of the present invention.
[0047] Figure 2 Shown are the results of the activity verification experiment of the functionalized magnetic beads in the examples of the present invention.
[0048] Figure 3 Shown is a graph showing the results of an RNA connection chain optimization experiment in an embodiment of the present invention.
[0049] Figure 4 Shown is a diagram of the results of a biological enzyme selection experiment in an embodiment of the present invention.
[0050] Figure 5 Shown is a feasibility analysis experimental result diagram of the membrane protein double-positive specific EVs subpopulation separation and enrichment method in an embodiment of the present invention.
[0051] Figure 6 Shown is the electron micrograph of the captured membrane protein double-positive EVs subpopulation in an embodiment of the present invention.
[0052] Figure 7 Shown are the morphology and particle size characterization images of the membrane protein double-positive EVs subpopulation released by enzymatic hydrolysis in an embodiment of the present invention. DETAILED DESCRIPTION
[0053] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.
[0054] In view of the shortcomings of the existing technology and application needs mentioned above, an embodiment of the present invention provides a method for separating and enriching a subpopulation of membrane protein double-positive specific extracellular vesicles (hereinafter referred to as EVs). Based on the method, a new kit can be developed to achieve non-destructive separation and enrichment of membrane protein double-positive specific EVs subpopulations.
[0055] In one embodiment, the method for isolating and enriching the membrane protein double-positive specific extracellular vesicle subpopulation is implemented as follows:
[0056] 1. Principles of Experimental Design
[0057] Experimental design principles such as Figure 1As shown in the figure. First, an antibody (Ab S9.6) that specifically recognizes DNA-RNA hybrids is biotinylated and mixed with avidin magnetic beads to prepare functionalized magnetic beads. Second, the EV sample to be processed is incubated with antibody-nucleic acid complex 1 and antibody-nucleic acid complex 2. Excess free antibody-nucleic acid complexes are removed by ultrafiltration, and then RNA linkers are introduced. Through optimized conditions, only membrane protein double-positive EVs will bind to the RNA linkers, forming DNA-RNA hybrids. Finally, the prepared functionalized magnetic beads are added. Through incubation under certain conditions, the magnetic beads can capture the pre-bound membrane protein double-positive EVs. Subsequently, enzyme molecules are added to hydrolyze the DNA-RNA hybrids, achieving the release of the captured EVs.
[0058] 2. Materials and Methods
[0059] 2.1 Materials
[0060] 2.1.1 Cell lines
[0061] Human breast cancer cell line: MCF7, purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, and stored in liquid nitrogen.
[0062] 2.1.2 Plasma specimens: Healthy human mixed plasma was collected from the Department of Laboratory Medicine, Nanfang Hospital, Southern Medical University.
[0063] 2.1.3 Main reagents and consumables are shown in Tables 1 and 2. The main experimental instruments are: inverted fluorescence microscope Nikon Ti2-U, flow cytometer (BriCyte E6), and HulaMixer.
[0064] Table 1 Main reagents and consumables
[0065]
[0066] Table 2 Nucleic acid sequences required for the experiment
[0067]
[0068] The above nucleic acid sequences were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.
[0069] 2.2 Methods
[0070] 2.2.1 Isolation of cell line-derived EVs
[0071] ① Cell passaging: discard the original culture medium, add 2 mL of PBS to a culture dish (d = 10 cm), gently wash 2-3 times, add 1 mL of trypsin, let it digest for 2-3 minutes, then add fetal bovine serum to stop digestion, add 1 mL of culture medium, gently pipette to detach the cells, collect the cell suspension, centrifuge at 800 rpm for 3 minutes, then discard the supernatant, add DMEM medium containing 10% fetal bovine serum to resuspend, pass to a culture dish (d = 15 cm) at a ratio of 1:1, and culture in a cell culture incubator at 37°C and 5% CO2;
[0072] ②Cell starvation treatment and collection of cell supernatant: When the cell growth density reaches 60-70%, discard the original culture medium, gently wash with PBS, add serum-free DMEM basal medium, starve for 12 hours, discard the culture medium, gently wash with PBS, add 1-2% Exo-FBS TM The cells were cultured in DMEM (exosome-depleted fetal bovine serum) for 48 h, and the cell supernatant was collected.
[0073] ④ Pre-treatment of cell supernatant: centrifuge at 3000g for 20min, take the supernatant, centrifuge at 16000g for 30min, take the supernatant;
[0074] ⑤ Ultracentrifugation of cell supernatant: The supernatant after pretreatment was ultracentrifuged at a centrifugal force of 135,000 g for 70 min, the supernatant was discarded, and the cell was resuspended in PBS and ultracentrifuged at 135,000 g for 70 min. Finally, the pellet was resuspended to obtain EVs derived from the supernatant of MCF7 cells.
[0075] 2.2.2 Isolation of plasma-derived EVs
[0076] 50 mL of pooled plasma was collected from 50 healthy volunteers in the Department of Laboratory Medicine at Nanfang Hospital, Southern Medical University. The plasma was diluted 1:1 with PBS and centrifuged at 3000 g for 20 minutes, followed by centrifugation at 16000 g for 30 minutes. The supernatant was then ultracentrifuged at 135000 g for 70 minutes, discarded, resuspended in PBS, and ultracentrifuged at 135000 g for 70 minutes. Finally, the pellet was resuspended to obtain EVs derived from the healthy human pooled plasma.
[0077] 2.2.3 Preparation of functionalized magnetic beads / styrene microspheres
[0078] 5 μL of Ab S9.6 was reacted with 7 μL of 10 mM Sulfo-NHS-LC-Biotin (Thermo Fisher) at room temperature for 30 min to prepare biotinylated Ab S9.6. 12 μL of biotinylated Ab S9.6 was then diluted to 200 μL with PBS and stored at 4°C until use. 200 μL of Dynabeads TM MyOne TM Streptavidin C1 magnetic beads (Thermo Fisher) were washed three times with PBS and resuspended in 200 μL of biotinylated antibody S9.6. After incubation at room temperature for 30 minutes, the beads were washed three times with PBS and then blocked with 200 μL of 1% BSA for 1 hour. Finally, the beads were washed several times with PBS and resuspended in 200 μL of PBS containing 0.1% BSA to prepare functionalized magnetic beads. Functionalized polystyrene microspheres (Bangs Laboratories, USA) were also prepared using the above steps for subsequent TEM characterization of EV capture.
[0079] 2.2.4 Activity verification of functionalized magnetic beads
[0080] 2 μL of functionalized magnetic beads were incubated with 2 μL of deionized water (negative control), 2 μL of 10 μmol DNA1-FAM, 2 μL of 10 μmol RNA1-FAM, and 6 μL of DNA-RNA hybrid (containing 2 μL of 10 μmol DNA1, 2 μL of 10 μmol DNA2, and 2 μL of 10 μmol RNA1-FAM) in 50 μL of PBS for 1 hour at room temperature. The beads were then washed three times with PBS and resuspended in 100 μL of PBS for flow cytometric analysis (BriCyte E6).
[0081] 2.2.5 RNA ligation chain optimization
[0082] 2 μL of 10 μmol DNA1, 2 μL of 10 μmol DNA2, and a combination of 2 μL of 10 μmol DNA1 and 2 μL of 10 μmol DNA2 were mixed with 1 μL of 1 μmol RNA1-FAM in 50 μL of PBS and subjected to DNA-RNA hybridization for 1 hour at room temperature. Subsequently, 2 μL of functionalized magnetic beads were added to capture fluorescent DNA-RNA hybrids for 1 hour at room temperature. After capture, the beads were washed three times with PBS and resuspended in 100 μL of PBS for flow cytometric analysis (BriCyte E6). The same procedure was also applied to RNA2-FAM, RNA3-FAM, and RNA4-FAM.
[0083] 2.2.6 Biological enzyme selection
[0084] A negative control consisted of 2 μL of functionalized magnetic beads incubated with 2 μL of deionized water in 50 μL of PBS at room temperature for 1 hour. A positive control consisted of 2 μL of functionalized magnetic beads incubated with 6 μL of DNA-RNA hybrid (containing 2 μL of 10 μmol DNA1, 2 μL of 10 μmol DNA2, and 1 μL of 1 μmol RNA3-FAM) in 50 μL of PBS at room temperature for 1 hour. 5 μL of DNase I (5 U / μL), 1 μL of RNase A (10 mg / mL), and 1 μL of RNase H (approximately 20-60 U / μL) dissolved in the corresponding lysis buffer were incubated with the magnetic beads in the positive control for 1 hour to enzymatically digest the fluorescent DNA-RNA hybrid. The beads were then washed three times with PBS and resuspended in 100 μL of PBS for flow cytometric analysis (BriCyte E6) to assess the cleavage efficiency.
[0085] 2.2.7 Antibody-nucleic acid complex construction
[0086] First, use the Streptavidin Conjugation Kit-Lightning- 10 μg of CD9 (0.532 mg / mL, ab236630, Abcam), CD63 (ab134045, Abcam), CD81 (ab79559, Abcam), CD235a (ab134111, Abcam), CD45 (ab208022, Abcam), CD41a (ab134131, Abcam), and CD144 (D87F2, Cell Signaling Technology) antibodies were modified using the ELISA kit (ab102921, Abcam) according to the manufacturer's instructions. Streptavidin-modified CD9 / CD63 / CD81 antibodies were mixed with biotinylated DNA1 at a 1:1 ratio and incubated at room temperature for 1 hour to construct antibody-DNA1 conjugates. Streptavidin-linked CD9 / CD63 / CD81, CD235a, CD45, CD41a, and CD144 antibodies were mixed with biotinylated DNA2 at a ratio of 1:1 and incubated at room temperature for 1 hour to construct antibody-DNA2 conjugates. The antibody-DNA complex was then diluted 1000-fold with PBS and 1 μL of Dynabeads was used for every 100 μL of the complex. TM MyOne TMStreptavidin C1 (Thermo Fisher) was rotated on a HulaMixer (Thermo Fisher) at room temperature for 30 minutes, and repeated 8-10 times to remove excess unbound biotinylated DNA oligonucleotides. The purified supernatant was then collected and stored at 4°C before use.
[0087] 2.2.8 Feasibility analysis of non-destructive separation and enrichment of membrane protein double-positive EVs subpopulations
[0088] MCF7-derived EVs extracted by ultracentrifugation were stained according to the PKH67 Green Fluorescent Cell Linker Midi Kit (PKH67) product manual provided by Sigma-Aldrich and then incubated with purified CD9 / CD63 / CD81-DNA1 and CD9 / CD63 / CD81-DNA2 conjugate mixtures at room temperature for 1 hour as a positive control. EVs pre-stained with PKH67 dye instead of PKH67 and deionized water instead of antibody-DNA conjugates were used as negative controls I and II, respectively. Next, PBS was added to the reaction mixture to a total volume of 500 μL and transferred to a 300 kD ultrafiltration tube (OD300C34, Pall). The mixture was then centrifuged twice at 13,800 g for 2 minutes to wash away excess antibody-DNA conjugate. Subsequently, 50 μL of PBS was added to the membrane in the ultrafiltration tube, and the antibody-DNA-labeled EVs were resuspended. Then, 1 μL of 1 μmol RNA3 was mixed with antibody-DNA-labeled EVs for DNA-RNA hybridization at room temperature for 1 hour, followed by incubation with 2 μL of functionalized magnetic beads for 30 minutes at room temperature in each group. After washing three times with PBS, the positive control magnetic beads were incubated with 0.25 μL of RNase H in 50 μL of 1:1000 diluted PBS lysis buffer at room temperature for 40 minutes to release the captured EVs. Finally, the functionalized magnetic beads were resuspended in 100 μL of PBS for flow cytometric analysis (Mindray, BriCyte E6), fluorescence microscopy observation, and TEM characterization to verify the feasibility of the assay.
[0089] 2.2.9 Isolation, Enrichment, and Characterization of Membrane Protein Double-Positive EVs from Erythrocytes, Leukocytes, Platelets, and Vascular Epithelial Cells
[0090] Different antibody combinations were used to isolate and enrich different EV subpopulations, such as CD9 / CD63 / CD81-DNA1 and CD235a-DNA2 for erythrocyte-derived EVs, CD9 / CD63 / CD81-DNA1 and CD45-DNA2 for leukocyte-derived EVs, CD9 / CD63 / CD81-DNA1 and CD41a-DNA2 for platelet-derived EVs, and CD9 / CD63 / CD81-DNA1 and CD144-DNA2 for vascular epithelial cell-derived EVs. Membrane protein double-positive EVs were isolated and prepared according to the above procedures. After DNA-RNA hybridization, antibody-DNA-RNA labeled EVs were incubated with 200 μL of functionalized magnetic beads at room temperature for 30 minutes. After washing three times with PBS, the beads were incubated with RNase H at room temperature for 40 minutes to release the captured EVs. The enriched EVs were stored in PBS and subjected to transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) to characterize specific EV subpopulations. TEM was performed using functionalized styrene microspheres instead of magnetic beads to characterize the capture of membrane protein double-positive EVs.
[0091] TEM analysis: Spot 20-40 μL of the diluted EV suspension onto a copper grid and let it sit for 2 minutes. Then, add 20-40 μL of phosphotungstic acid to negatively stain the grid, let it sit for 2 minutes, and wash once with PBS. After baking under an incandescent lamp for 20 minutes, observe the grid at 50,000-80,000x magnification on a HITACHI H-7650 electron microscope. Photograph the grid at a suitable field of view.
[0092] NTA analysis: Dilute the EV suspension to 1 × 10 7 / mL-1×10 9 / mL, and then the nanoparticle size analyzer NS300 (Malvern, UK) was used for detection. A 405nm laser was selected as the laser, and a 60s (30frames / s) video of the particle movement was captured. The video was then calculated and analyzed using NTA software (version 2.3, NanoSight), and finally a two-dimensional particle size distribution diagram was output.
[0093] 2.3 Experimental Results Analysis
[0094] Figure 2 The figure shows the results of the activity verification experiment of functionalized magnetic beads. Figure 2It can be seen that there is no significant fluorescence shift after incubation of the magnetic beads with fluorescent single-stranded DNA and fluorescent single-stranded RNA, but there is a significant fluorescence shift after incubation with fluorescent DNA-RNA hybrids, proving that the constructed functionalized magnetic beads can specifically capture DNA-RNA hybrids.
[0095] Figure 3 This is the result of RNA connection chain optimization experiment. Figure 3 It can be seen that as the number of complementary bases between the RNA connecting chain and DNA1 / DNA2 decreases, the number of hybrids of single DNA chains and RNA captured by magnetic beads gradually decreases (the fluorescence signal gradually shifts to the left). When RNA3 is mixed with a single DNA chain (DNA1 or DNA2), the fluorescence signal does not shift significantly to the right relative to the negative control group. Only when both DNA1 and DNA2 are present will a DNA-RNA hybrid be formed, causing the fluorescence signal to shift significantly to the right. In the RNA4 experimental group, whether a single DNA chain or both DNAs are present, the magnetic beads cannot effectively capture them, thus proving that RNA3 meets the subsequent requirements of the present invention.
[0096] Figure 4 Select the experimental result graph for the enzyme. Figure 4 It can be seen that DNase I can decompose DNA-RNA complexes to a certain extent, while RNase A and RNase H can both significantly damage DNA-RNA complexes. Considering the subsequent applications such as EV biological function development or marker screening, RNase H, which can specifically hydrolyze the RNA part of the DNA-RNA complex, is planned to be selected for subsequent experimental steps.
[0097] Figure 5 The experimental results of the feasibility analysis of the membrane protein double-positive specific EVs subpopulation separation and enrichment method. Among them, I is the negative control group 1 (DNA1+DNA2+RNA3+PKH67); II is the negative control group 2 (PKH67+EVs); III is the positive control group (DNA1+DNA2+RNA3+PKH67+EVs); IV is the enzyme treatment group (DNA1+DNA2+RNA3+PKH67+EVs+RNase H). Figure 5 It can be seen that the negative control group had no fluorescent signals under both flow cytometry and fluorescence microscopy; the positive control group had obvious fluorescent signals under both flow cytometry and fluorescence microscopy, proving that the magnetic beads captured the membrane protein double-positive EVs subpopulation; the fluorescence signals of the enzyme treatment group were reduced under both flow cytometry and fluorescence microscopy, proving that the enzymatic cleavage reaction released the EVs captured by the magnetic beads.
[0098] Figure 6Electron micrographs of membrane protein double-positive EV subpopulations captured. A shows the CD9 / CD63 / CD81+CD235a+ EV subpopulation captured by latex microspheres; B shows the CD9 / CD63 / CD81+CD45+ EV subpopulation captured by latex microspheres; C shows the CD9 / CD63 / CD81+CD41a+ EV subpopulation captured by latex microspheres; and D shows the CD9 / CD63 / CD81+CD144+ EV subpopulation captured by latex microspheres. Blue arrows indicate captured membrane protein double-positive EVs.
[0099] Figure 7 Figure 3. Morphological and size characterization of enzymatically released membrane protein double-positive EV subpopulations. Figures A and E show electron micrographs and size distribution of the enzymatically released CD9 / CD63 / CD81+CD235a+ EV subpopulation, with a peak size of 159 nm; Figures B and F show electron micrographs and size distribution of the enzymatically released CD9 / CD63 / CD81+CD45+ EV subpopulation, with a peak size of 87.2 nm; Figures C and G show electron micrographs and size distribution of the enzymatically released CD9 / CD63 / CD81+CD41a+ EV subpopulation, with a peak size of 170 nm; and Figures D and H show electron micrographs and size distribution of the enzymatically released CD9 / CD63 / CD81+CD144+ EV subpopulation, with a peak size of 154.7 nm. Scale bar: 100 nm. The above results demonstrate that the membrane protein double-positive EVs separated by the method of the embodiment of the present invention can be enriched by enzyme cleavage reaction, and the morphology and particle size distribution are identified and characterized by TEM and NTA.
[0100] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the present invention. Anyone skilled in the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by one of ordinary skill in the art without departing from the spirit and technical principles disclosed herein are intended to be covered by the claims of the present invention.
Claims
1. A method for separating and enriching a subpopulation of membrane protein double-positive specific extracellular vesicles, characterized in that: The steps include: The extracellular vesicle sample to be processed, two antibody nucleic acid complexes specifically targeting extracellular vesicle membrane protein markers are incubated with an RNA linker capable of connecting the two antibody nucleic acid complexes to obtain a DNA-RNA hybrid, thereby achieving the bundling of the extracellular vesicle double-positive membrane protein; The DNA-RNA hybrid is specifically captured by functionalized magnetic beads to achieve the separation of membrane protein double-positive specific extracellular vesicle subpopulations, wherein the functionalized magnetic beads are immunomagnetic beads coupled with a second antibody that can specifically recognize the DNA-RNA hybrid; Enrichment of membrane protein double-positive specific extracellular vesicle subpopulations by enzyme cleavage of nucleic acid chains; The two antibody-nucleic acid complexes are respectively a first antibody-DNA1 conjugate and a first antibody-DNA2 conjugate, wherein the first antibody-DNA1 conjugate is a CD9 antibody-DNA1 conjugate, a CD63 antibody-DNA1 conjugate, and a CD81 antibody-DNA1 conjugate; the first antibody-DNA2 conjugates used for separating and enriching extracellular vesicles derived from red blood cells, white blood cells, platelets, and vascular epithelial cells are respectively selected from CD235a antibody-DNA2 conjugate, CD45 antibody-DNA2 conjugate, CD41a antibody-DNA2 conjugate, and CD144 antibody-DNA2 conjugate; The sequences of the DNA1, DNA2 and RNA connecting strand are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.5, respectively; The second antibody is selected from Ab S9.6; The enzyme is endonuclease RNase H.
2. A kit, characterized in that The kit is used for separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations, and the kit comprises: At least two antibody-nucleic acid complexes that specifically target extracellular vesicle membrane protein markers, an RNA connecting chain capable of connecting the antibody-nucleic acid complexes, functionalized magnetic beads, and an endonuclease, wherein the functionalized magnetic beads are immunomagnetic beads coupled to a second antibody that can specifically recognize DNA-RNA hybrids; The DNA-RNA hybrid is obtained by incubating the extracellular vesicle sample to be processed, two antibody nucleic acid complexes that specifically target extracellular vesicle membrane protein markers, and an RNA connecting chain that can connect the two antibody nucleic acid complexes; The two antibody-nucleic acid complexes are respectively a first antibody-DNA1 conjugate and a first antibody-DNA2 conjugate, wherein the first antibody-DNA1 conjugate is a CD9 antibody-DNA1 conjugate, a CD63 antibody-DNA1 conjugate, and a CD81 antibody-DNA1 conjugate; the first antibody-DNA2 conjugates used for separating and enriching extracellular vesicles derived from red blood cells, white blood cells, platelets, and vascular epithelial cells are respectively selected from CD235a antibody-DNA2 conjugate, CD45 antibody-DNA2 conjugate, CD41a antibody-DNA2 conjugate, and CD144 antibody-DNA2 conjugate; The sequences of the DNA1, DNA2 and RNA connecting strand are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.5, respectively; The second antibody is selected from Ab S9.6; The endonuclease is selected from RNase H.
3. A kit, characterized in that The kit is used for separating and enriching membrane protein double-positive specific extracellular vesicle subpopulations, and the kit comprises: At least two first antibodies, DNA1, DNA2, RNA connecting chain, second antibody, magnetic beads, endonuclease, The first antibody is an antibody against an extracellular vesicle membrane protein marker, the first antibody coupled to DNA1 is CD9 antibody, CD63 antibody, and CD81 antibody, and the first antibody coupled to DNA2 is selected from at least one of CD235a antibody, CD45 antibody, CD41a antibody, and CD144 antibody; The sequences of DNA1 and DNA2 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The RNA connecting strand contains several bases that are complementary to the bases of DNA1 and DNA2, and its sequence is shown in SEQ ID NO.
5. The second antibody is an antibody that can specifically recognize DNA-RNA hybrids and is selected from Ab S9.6; The endonuclease is selected from RNase H, which is used to hydrolyze the DNA-RNA hybrid.
4. Use of the method according to claim 1 or the kit according to any one of claims 2 to 3 in isolating and enriching membrane protein double-positive specific extracellular vesicle subpopulations, wherein the use is for non-disease detection or treatment purposes.
Citation Information
Patent Citations
Detection method of glycosylated exosome PD-L1
CN114717299A
Increased sensitivity of proximity ligation assays
US20080090238A1
Method for the isolation of intact extracellular vesicles
US20210102191A1