Application of indexsulfanilamide in the preparation of drugs for the prevention and / or treatment of multiple myeloma

By inducing abnormal MEK5 gene splicing with indexsulfanilamide and combining it with bortezomib, the treatment challenges of multiple myeloma have been addressed, achieving significant tumor suppression and cell death effects, and providing a new drug combination for the treatment of multiple myeloma.

CN116270665BActive Publication Date: 2026-03-06阎骅
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210984013.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-17
Publication Date
2026-03-06
Estimated Expiration
2042-08-17

AI Technical Summary

Technical Problem

There is a lack of effective drugs for the treatment of multiple myeloma in the current technology, especially when relapse and progression still occur after treatment with bortezomib. How to prolong the survival of patients and improve the treatment effect is an urgent problem to be solved.

Method used

Indexsulfanilamide was used as the main drug, which induces abnormal splicing of the MEK5 gene, thereby causing multiple myeloma cell death. It was also used in combination with bortezomib to form a drug combination to enhance the therapeutic effect.

Benefits of technology

Indexsulfanilamide has shown significant anti-multiple myeloma effects both in vitro and in vivo, inhibiting tumor growth and promoting cell apoptosis. It also exhibits a synergistic effect when used in combination with bortezomib, with no obvious toxic side effects, providing a new approach to the treatment of multiple myeloma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116270665B_ABST
    Figure CN116270665B_ABST
Patent Text Reader

Abstract

This invention provides the application of indexsulfanilamide in the preparation of drugs for the prevention and / or treatment of multiple myeloma, belonging to the field of oncology drug technology. Indexsulfanilamide exhibits significant anti-multiple myeloma effects in various multiple myeloma cell lines, primary cells, and multiple myeloma mouse models, and inhibits tumor growth in multiple myeloma mice while demonstrating good safety. Furthermore, the combination of indexsulfanilamide and bortezomib produces a synergistic effect, suggesting that indexsulfanilamide has a promising therapeutic prospect for multiple myeloma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of tumor drug technology, specifically relating to the application of indexsulfanilamide in the preparation of drugs for the prevention and / or treatment of multiple myeloma. Background Technology

[0002] Multiple myeloma (MM) is a malignant tumor originating from the abnormal proliferation of plasma cells, often accompanied by excessive production of monoclonal immunoglobulins or light chains (M protein). Malignant plasma cells and their secreted M protein can both lead to damage to related organs or tissues. The clinical manifestations of MM can be summarized as the CRAB phenomenon: hypercalcemia, kidney damage, anemia, and multiple osteolytic lesions. MM is more common in the elderly, with a median age of onset of 69 years, and mortality increases significantly with age. In recent years, the prognosis of MM has improved with the advent of proteasome inhibitors, immunomodulators, and new targeted therapies. Nevertheless, MM remains an incurable disease. According to the latest statistics from the US SEER database, the 5-year survival rate for MM patients is 52.2%. Patients reach a plateau after remission, followed by rapid relapse and progression. Most patients receive four or more different therapies throughout the course of the disease. Therefore, how to benefit patients and prolong their survival remains a challenging problem for clinicians. There is an urgent need to discover more new drugs to further improve prognosis.

[0003] Indisulam (E7070) belongs to the sulfonamide class of drugs and can exert anti-tumor effects against certain cancers. Prior to 2017, research on the anti-tumor mechanism of indisulam mainly focused on its inhibition of carbonic anhydrase activity. In 2017, Professor Han reported that indisulam, acting as a molecular glue, induces the interaction between RBM39 and the E3 ubiquitin ligase DCAF15, thereby degrading RBM39 via the ubiquitin-proteasome pathway. Indisulam-induced RBM39 degradation leads to widespread alternative splicing alterations, thus exerting its anti-tumor effect. A total of 20 clinical trials related to indisulam have been conducted, including studies on various relapsed / refractory solid tumors and acute myeloid leukemia (AML). A phase II open-label clinical trial (NCT01692197) of indisulam for AML evaluated its efficacy and safety. The results showed that when indexsulfamethoxazole was used in combination with chemotherapy, 11 out of the 31 enrolled patients achieved complete or partial remission, with significantly higher overall survival than unresponsive patients (17.4 months vs. 4.3 months). Side effects such as granulocytopenia and thrombocytopenia that occurred during treatment were alleviated. Currently, there are limited studies on the treatment of other types of cancer with indexsulfamethoxazole, and its application in multiple myeloma has not been reported. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide the use of indexsulfonamide in the preparation of drugs for the prevention and / or treatment of multiple myeloma. Indexsulfonamide can cause abnormal MEK5 splicing in cells, thereby leading to cell death and achieving the purpose of inhibiting the growth of multiple myeloma cells.

[0005] This invention provides the use of indexsulfanilamide in the preparation of drugs for the prevention and / or treatment of multiple myeloma.

[0006] This invention provides the application of indexsulfanilamide in the preparation of multiple myeloma cell inhibitors and / or promoters of multiple myeloma cell apoptosis.

[0007] Preferably, the multiple myeloma cells include one or more of H929, RPMI-8226, MM.1S, and U266.

[0008] This invention provides the application of a reagent that induces abnormal splicing of the MEK5 gene in the preparation of drugs for the prevention and / or treatment of multiple myeloma.

[0009] Preferably, the abnormal splicing of the MEK5 gene includes partial deletion of the MEK5 gene.

[0010] Preferably, the partial deletion of the MEK5 gene is either a deletion of exon 18 or a combined deletion of exons 17 and 18.

[0011] Preferably, the reagent includes indexsulfanilamide.

[0012] This invention provides a pharmaceutical composition for treating multiple myeloma, comprising indexsulfanilamide and bortezomib;

[0013] The mass ratio of indexsulfanilamide to bortezomib is 9–11:1.

[0014] This invention provides the use of the pharmaceutical composition in the preparation of drugs for the prevention and / or treatment of multiple myeloma.

[0015] Preferably, the multiple myeloma is a bortezomib-sensitive multiple myeloma.

[0016] This invention provides the application of indexsulfanilamide in the preparation of drugs for the prevention and / or treatment of multiple myeloma. Experimental results of this invention show that indexsulfanilamide has significant anti-multiple myeloma effects in various multiple myeloma cell lines, primary cells, and multiple myeloma mouse models, and inhibits tumor growth in multiple myeloma model mice; thus, indexsulfanilamide can exert good inhibitory and cytotoxic effects on tumors both in vivo and in vitro. Further molecular mechanism studies show that indexsulfanilamide achieves its tumor-killing effect by inducing abnormal splicing of the MEK5 gene in multiple myeloma cells, thereby leading to cell death. Simultaneously, the indexsulfanilamide exhibits good safety and has promising clinical application prospects.

[0017] This invention provides a pharmaceutical composition for treating multiple myeloma, comprising indexsulfanilamide and bortezomib; the mass ratio of indexsulfanilamide to bortezomib is 9-11:1. This invention combines indexsulfanilamide and bortezomib in the treatment of multiple myeloma. Experiments have shown that the synergistic index of the inhibitory effect of the combined administration of indexsulfanilamide and bortezomib on multiple myeloma cells is greater than 10, indicating that the combined use of the two drugs has a synergistic effect and no toxic side effects. The pharmaceutical composition provided by this invention offers a new approach for the clinical treatment of multiple myeloma. Attached Figure Description

[0018] Figure 1 To illustrate the inhibition of MM cell line and primary cell proliferation by indexsulfanilamide, where A is the molecular formula of indexsulfanilamide; B is the CCK-8 assay result of the inhibitory effect of indexsulfanilamide on MM cell lines; and C is the IC50 assay result. 50 Statistical results; D shows the changes in intracellular RBM39 protein levels detected by Western blotting; E shows the inhibitory effect of indexsulfanilamide concentration gradient treatment on H929 cells; F shows the apoptosis levels of H929 and MM.1S cells after indexsulfanilamide treatment; G and H show the cell cycle distribution of MM cell lines after indexsulfanilamide treatment detected by PI; IK shows the CD138 levels in the bone marrow of newly diagnosed MM patients treated with indexsulfanilamide. + Inhibitory effect on cells, where *, p < 0.05, **, p < 0.01, ***, p < 0.001, ****, p < 0.001;

[0019] Figure 2The images show the antitumor effect of indexsulfanilamide in a subcutaneous xenograft model of multiple myeloma (MM). A shows the growth of MM.1S tumors after subcutaneous tumor formation in BALB / c Nude mice; B shows the tumor volume after indexsulfanilamide treatment in mice with subcutaneous MM.1S tumors; C shows the weight of subcutaneous tumors after euthanasia in mice with MM.1S tumors; D shows the body weight of mice treated with indexsulfanilamide for subcutaneous MM.1S tumors; E shows the growth of H929 tumors after subcutaneous tumor formation in NOD SCID mice; F shows the tumor volume after indexsulfanilamide treatment in mice with subcutaneous H929 tumors; G shows the tumor weight after euthanasia in mice with H929 tumors; H shows the body weight of mice treated with indexsulfanilamide for subcutaneous H929 tumors; I and J show HE staining and immunohistochemical detection of Ki67 and c-caspase 3 in subcutaneous MM.1S and H929 tumors in mice (×200); (****, p<0.001).

[0020] Figure 3 The antitumor effect of indexsulfamethoxazole in a systemic MM tumor model is shown in the following table: A: HE staining and histochemical immunoassay results of human CD138 expression; B: in vivo imaging results of tumor burden in mice; C: quantitative statistical results of fluorescence values ​​of MM tumors in mice; D: mouse weight at the end of treatment; E: results of spleen size comparison after euthanasia of mice after treatment. (ns, no significant, *, p < 0.05, ****, p < 0.001)

[0021] Figure 4 To assess the synergistic anti-MM effect of indexsulfamethoxazole combined with bortezomib, A and B represent the synergistic index calculated for H929 and MM.1S cells; C represents the tumor formation results of MM.1S cells after subcutaneous inoculation in BALB / c Nude mice; D represents the statistical results of subcutaneous tumor volume in mice; E represents the tumor results in mice; and F represents the body weight of mice at different time points after drug administration. *, p < 0.05, **, p < 0.01, ****, p < 0.001;

[0022] Figure 5 The results are as follows: A represents the number and proportion of alternative splicing variants induced by indexsulfonamide treatment in MM.1S cells; B represents the number of alternative splices retained and spliced ​​induced by indexsulfonamide treatment in MM.1S cells; C represents the proportion of RBM39 binding genes that underwent alternative splicing induced by indexsulfonamide; D represents the results of GO functional enrichment analysis; and E represents the results of KEGG pathway enrichment analysis of differentially expressed genes induced by indexsulfonamide treatment in MM.1S cells.

[0023] Figure 6Treatment of MM cells with indexsulfanilamide induced abnormal MEK5 splicing, leading to cell death. A shows the visualization of RNA-seq data after indexsulfanilamide treatment of MM.1S cells, indicating a significant decrease in the expression abundance of MEK5 exon 18 compared to the control group. B and C show the results of PCR detection of MEK5 alternative splicing induced by indexsulfanilamide. D shows the alignment results of the lost sequence analysis. E shows the results of qPCR quantitative detection of the expression levels of different splice variants of MEK5 in indexsulfanilamide-treated MM.1S cells. F shows the RBM39 expression level in cells overexpressing RBM39 treated with indexsulfanilamide. G and H show the results of MEK5 alternative splicing after indexsulfanilamide treatment of MM cells overexpressing RBM39. I shows the morphology of tumor cells after inoculation with cells overexpressing different genes. J shows the statistical results of subcutaneous tumor volume in mice. K shows the statistical results of subcutaneous tumor biomass. *, p < 0.05, **, p < 0.01, ***, p < 0.001.

[0024] Figure 7 A schematic diagram of primer design for overlap PCR. Detailed Implementation

[0025] This invention provides the use of indexsulfanilamide in the preparation of drugs for the prevention and / or treatment of multiple myeloma.

[0026] In this invention, the molecular weight of indexsulfanilamide is 385.85, and its molecular structure is shown below. Figure 1 A.

[0027] In this invention, in vitro experiments at the cellular level demonstrated that indexsulfanilamide effectively inhibited MM cell viability at low concentrations, IC50. 50 The concentration ranged from 12.83 to 23.14 μM. The indexsulfanilamide degraded RBM39 protein, simultaneously inhibiting the proliferation of multiple myeloma cells, promoting apoptosis, and arresting the cell cycle at the G2 / M phase, demonstrating its effective inhibition of multiple myeloma cell growth. Furthermore, this invention used multiple myeloma model mice as experimental subjects to study the effects of indexsulfanilamide on MM.1S and H929 subcutaneous tumors. The results showed that indexsulfanilamide not only effectively inhibited tumor growth but also significantly reduced the volume of subcutaneous tumors compared to the initial treatment. This indicates that indexsulfanilamide not only exerts a good inhibitory effect on tumor growth in vivo but also exhibits a tumor-killing effect. Therefore, this invention demonstrates at both the cellular and animal levels that indexsulfanilamide can exert an anti-multiple myeloma effect, providing a pharmacological basis for the treatment and / or prevention of multiple myeloma.

[0028] Given that the present invention has demonstrated through experiments that indexsulfanilamide can effectively affect the proliferation and apoptosis of multiple myeloma cells under in vitro conditions, the present invention provides the application of indexsulfanilamide in the preparation of a drug that inhibits the proliferation of multiple myeloma cells and / or promotes the apoptosis of multiple myeloma cells.

[0029] In this invention, the multiple myeloma cells preferably include a variety of multiple myeloma cells, such as human myeloma cell lines NCI-H929, RPMI-8226, MM.1S, OPM2, and LP-1, and the IC50 of indexsulfanilamide on the above-mentioned cells is [not specified]. 50 The concentrations were 12.83 μM, 22.86 μM, 19.59 μM, 23.14 μM, and 17.72 μM, respectively. Furthermore, this invention verifies that the indexulamide inhibits cell proliferation and induces apoptosis by degrading the RBM39 protein in cells.

[0030] This invention provides the application of a reagent that induces abnormal splicing of the MEK5 gene in the preparation of drugs for the prevention and / or treatment of multiple myeloma.

[0031] In this invention, the abnormal splicing of the MEK5 gene preferably includes a partial deletion of the MEK5 gene. The deleted portion of the MEK5 gene is preferably exon 18 or a combination of exons 17 and 18. The reagent preferably includes indexsulfanilamide. Experiments of this invention show that overexpression of MEK5Δ17-18 and MEK5Δ18 cannot reverse the growth of MM tumors, while a full-length overexpression vector of the MEK5 gene can reverse cell death. Therefore, indexsulfanilamide induces multiple myeloma cell death by causing abnormal MEK5 splicing.

[0032] This invention provides a pharmaceutical composition for treating multiple myeloma, comprising indexsulfanilamide and bortezomib; wherein the mass ratio of indexsulfanilamide to bortezomib is 9–11:1, more preferably 10:1. Indexsulfanilamide is preferably administered intraperitoneally, and bortezomib is preferably administered intravenously.

[0033] This invention provides the use of the pharmaceutical composition in the preparation of drugs for the prevention and / or treatment of multiple myeloma.

[0034] In this invention, the multiple myeloma is preferably a bortezomib-sensitive multiple myeloma. Indexsulfanilamide monotherapy is more effective than BTZ monotherapy, and the combined administration of indexsulfanilamide and bortezomib significantly outperforms either drug alone in inhibiting multiple myeloma, indicating that indexsulfanilamide is used as an synergist for bortezomib. Furthermore, the combined use of the two drugs has no significant toxic side effects in mice, providing a basis for the clinical treatment of multiple myeloma.

[0035] The following examples illustrate the application of indexsulfanilamide provided by the present invention in the preparation of drugs for the prevention and / or treatment of multiple myeloma, but these examples should not be construed as limiting the scope of protection of the present invention.

[0036] Material source and related processing instructions

[0037] 1. Cell treatment

[0038] Human MM cell lines NCI-H929, RPMI-8226, MM.1S, and U266 were purchased from ATCC (Manassas, VA, USA). LP1 and OPM2 were purchased from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany). Cells were cultured in DMEM medium (Sigma-Aldrich, St. Louis, MO) containing 10% inactivated fetal bovine serum (FBS, Gibco BRL, Gaithersburg, ML), penicillin (100 U / ml), and streptomycin (100 g / ml), and incubated at 37°C in a 5% CO2 incubator, passaged every 2–3 days. Indexsulfanilamide was dissolved in DMSO at a storage concentration of 50 mM. Cell viability was assessed using the trypan blue rejection assay.

[0039] 2. Western blot analysis

[0040] Cells were treated with different concentrations of indexsulfanilamide, collected by centrifugation, and proteins were extracted by lysis. Equal volumes of proteins were loaded onto 6-12% SDS-PAGE gels for electrophoresis and then transferred to NC membranes. The membranes were blocked with 5% skim milk, incubated with primary antibody (4°C overnight), washed, incubated with secondary antibody (2 h), washed again, developed, and subsequently image acquired and analyzed.

[0041] 3. RNA extraction analysis

[0042] Total RNA was extracted from cells according to the TRIzol kit (Invitrogen) instructions: 5 × 10⁶ cells were collected, resuspended in 1 mL of TRIzol, and repeatedly pipetted to lyse the cells thoroughly; the cells were then incubated at room temperature to fully lyse the nucleoprotein complex; 0.265 mL of chloroform was added, and the mixture was vigorously vortexed for 15 seconds, then incubated at room temperature for 2-3 minutes; the cells were centrifuged at 12000 g at 4°C for 15 minutes; the supernatant was carefully transferred to another centrifuge tube, 0.5 mL of isopropanol was added, and the mixture was thoroughly and slowly mixed, incubated at room temperature for 10 minutes to precipitate the RNA, and centrifuged at 12000 g at 4°C for 10 minutes; the supernatant was discarded, and the RNA precipitate was washed with 75% ethanol and centrifuged. The dried RNA precipitate was dissolved in an appropriate amount of DEPC water, quantified, and stored at -80°C.

[0043] 4. Statistical Analysis

[0044] The data used for statistical analysis were obtained from three trials with three samples each time. The Student's t-test was used to evaluate the differences between the two groups, and p < 0.05 was considered to be statistically significant.

[0045] Example 1

[0046] Indexsulfanilamide inhibits the proliferation of MM cell lines and primary cells.

[0047] First, indexsulfanilamide was applied to various MM cell lines (NCI-H929, RPMI-8226, MM.1S, OPM2, and LP-1) with drug concentration gradients of 0, 0.01, 0.05, 0.1, 0.5, 1, 10, 25, 50, and 100 μM. Cell viability was assessed using a CCK-8 assay, and the half-maximal inhibitory concentration (IC50) of indexsulfanilamide in the MM cell lines was calculated. 50 ).

[0048] The results showed that indexsulfanilamide could effectively inhibit MM cell viability at low concentrations, IC50. 50 Between 12.83 and 23.14 μM ( Figure 1 (B, C)

[0049] Based on the half-maximal inhibitory concentration (IC50) of indexsulfanilamide in the MM cell line, we treated MM cells with indexsulfanilamide at concentrations of 10, 20, and 30 μM to determine whether indexsulfanilamide could degrade RBM39 in the MM cell line at these effective concentrations. We used Western blotting to detect the intracellular protein level of RBM39, using actin protein as an internal control.

[0050] The results showed that indexsulfanilamide could degrade RBM39 protein in a concentration-dependent manner. Figure 1 (D).

[0051] Next, MM cell lines were treated with 20 μM and 30 μM indexsulfanilamide. The effect of indexsulfanilamide on the proliferation of MM cell lines was detected by the CCK-8 assay, the effect of indexsulfanilamide on apoptosis of MM cell lines was detected by the Annexin V-PI kit, and the effect of indexsulfanilamide on the cell cycle of MM cell lines was detected by the PI reagent. DMSO solvent was used as a blank control.

[0052] The results showed that indexsulfanilamide could effectively inhibit the proliferation of MM cells. Figure 1 E), induces apoptosis in MM cells ( Figure 1 In the middle F phase, the cell cycle also arrests at the G2 / M phase ( Figure 1Indexsulfanilamide (MSV) has a significant inhibitory effect on MM cell lines, and these inhibitory effects are concentration gradient dependent.

[0053] Next, CD138 was isolated from BMMCs of 3 MM patients. + MM cells ( Figure 1 Treatment with different concentrations (0–50 μM) of indexsulfanilamide for 48 h showed that indexsulfanilamide inhibited CD138 in patients in a dose-dependent manner. + MM cell viability.

[0054] Example 2

[0055] Antitumor effects of indexsulfonamide in a subcutaneous xenograft model of multiple myeloma (MM)

[0056] Based on the proven ability of indexsulfanilamide to inhibit the growth and proliferation of MM cell lines and primary MM cells in vitro, and considering factors such as drug metabolism and targeting in vivo, this invention applies indexsulfanilamide to treat subcutaneous MM tumors in mice to further explore its clinical application in the treatment of MM. MM cell lines were inoculated subcutaneously into immunodeficient mice. After subcutaneous tumor formation, the mice were randomly divided into a control group and a treatment group. Mice in the treatment group were treated with indexsulfanilamide 10 mg / kg via intraperitoneal injection for 9 consecutive days. Mouse weight was monitored daily, and the length and width of the subcutaneous tumor were measured every other day. After treatment, the mice were euthanized, and the subcutaneous tumors were harvested, measured, and weighed.

[0057] Experimental results showed that indexsulfonamide had a significant inhibitory effect on MM.1S and H929 subcutaneous tumors. Not only was tumor growth inhibited, but the volume of subcutaneous tumors was also significantly reduced compared to the initial treatment volume. Figure 2 Mice (A-C, E-G) remained at normal levels during the monitoring period, with no significant change in body weight. Figure 2 The presence of D and H in the sample suggests that indexsulfanilamide has no significant toxicity in mice.

[0058] Subcutaneous tumors from the control and treatment groups were removed, fixed with paraformaldehyde, and subjected to immunohistochemistry. The inhibitory effect of indexsulfonamide on MM subcutaneous tumors was evaluated by detecting HE staining, Ki67, and c-caspase3.

[0059] The test results showed that the tumor cell density decreased in the treatment group, the Ki67 positivity rate decreased significantly, while the c-caspase3 positivity rate increased. Figure 2 (I, J) This result further illustrates that indexsulfanilamide can exert a good inhibitory and killing effect on tumors in vivo.

[0060] Example 3

[0061] Antitumor effects of indexsulfonamide in a whole-body xenograft model of multiple myeloma

[0062] Based on the previous experimental results, it has been clearly established that indexsulfanilamide also has a good tumor-suppressive effect in mice, and can significantly inhibit the growth of subcutaneous MM tumors. MM is a disease characterized by the abnormal clonal proliferation of plasma cells in the bone marrow, and some patients may exhibit plasmacytoma manifestations with extramedullary organ infiltration. To further establish a mouse model of systemic MM and simulate the characteristics of MM cell infiltrative growth in the bone marrow and other organs, this invention injects the LP-1 cell line (LP-1-luc) with stable expression of luciferase (luc) into mice via the tail vein, and monitors the onset of disease in mice using in vivo imaging. Approximately 60 days after the tail vein injection of MM cells, the mice showed obvious tumor symptoms. Dissection of the mice revealed obvious nodules in the neck, axilla, abdominal cavity, and groin, and significant tumor infiltration in the spleen and liver. Immunohistochemical staining was performed on the nodules, spleen, liver, kidneys, and femur of the mice to detect human CD138 expression.

[0063] The results showed that the nodules in the mice were MM cell tumors, and that MM cells extensively infiltrated the bone marrow, spleen, liver, and kidneys. Figure 3 (A). The above results demonstrate the successful establishment of a mouse whole-body MM tumor model.

[0064] Monitoring results during model establishment showed that tumor burden could be detected by in vivo imaging 30 days after tail vein injection of MM cells. Indexsulfanilamide treatment of diseased mice was initiated at this time. Diseased mice were randomly divided into a control group and a treatment group. Mice in the treatment group were administered indexsulfanilamide 20 mg / kg via intraperitoneal injection daily for 20 consecutive days. MM tumor burden was measured on days 5, 10, and 20 of administration.

[0065] The experimental results showed that, compared with the control group, the indexsulfonamide treatment group exhibited a better tumor-suppressive effect as early as day 10, with a reduced range and decreased brightness of tumor fluorescence values ​​in mice. At day 20, the difference between the control and treatment groups was more pronounced; the control group showed significant, high-intensity tumor infiltration in multiple sites throughout the body, while the treatment group showed almost no detectable tumor burden. Figure 3 (B, C)

[0066] During the treatment, monitoring showed no significant abnormalities in the mice's diet and excretion. There was no significant difference in body weight between the treatment and control groups. Figure 3 (D). Mice were euthanized after treatment, and autopsies revealed that the spleens of the treatment group were significantly smaller than those of the control group. Figure 3 (E).

[0067] The above results show that indexsulfonamide can effectively inhibit the growth of systemic MM tumors and has no obvious toxic side effects in mice, indicating its potential for clinical application.

[0068] Example 4

[0069] Indexsulfanilamide and bortezomib exert a synergistic anti-MM effect

[0070] To further promote the application of indexsulfanilamide in the clinical treatment of multiple myeloma (MM), this invention examines the anti-MM effect of indexsulfanilamide combined with bortezomib (BTZ), which is a first-line drug for the clinical treatment of MM.

[0071] MM.1S and H929 cells were treated with indexsulfanilamide at concentration gradients of 0, 10, 20, 30, and 40 μM, bortezomib at concentration gradients of 0, 0.5, 1, and 1.5 nM, and a combination of both drugs. Cell viability was assessed using CCK-8 assays, and inhibition rates were calculated. The synergy score was calculated using the online website synergyfinder (https: / / synergyfinder.fimm.fi / synergy / ). A synergy score greater than 10 indicated a synergistic effect between the two drugs.

[0072] Experimental results showed that when indexsulfamethoxazole and BTZ were used in combination to treat MM, the synergistic index of the inhibitory effect on MM cells was greater than 10, indicating that the combination of the two drugs had a synergistic effect. Figure 4 In the case of drugs A and B), the combined effect of the two drugs is greater than the effect of either drug alone.

[0073] The combined effect of the two drugs was then tested using a mouse subcutaneous multifocal tumor (MM) model. Control groups, single-drug treatment groups, and combined-drug treatment groups were established. Indexsulfanilamide was administered intraperitoneally every other day at a dose of 10 mg / kg. BTZ was administered intravenously via the tail vein on days 1, 4, 8, and 11 (day 1 was counted as the first intraperitoneal administration), at a dose of 1 mg / kg. Subcutaneous tumor size and body weight were measured every other day, and mice were euthanized on day 13.

[0074] The results showed that the combination therapy of the two drugs had a better inhibitory effect on subcutaneous multifocal tumors in mice. The volume and weight of subcutaneous tumors in the combination therapy group were significantly smaller than those in the single-drug group. Moreover, the effect of indexsulfonamide monotherapy was superior to that of BTZ monotherapy. Figure 4 (CE). Records showed no significant change in mouse body weight. Figure 4 The combined use of BTZ and indexsulfonamide showed no significant toxic side effects in mice. These experimental results provide a basis for the clinical application of BTZ combined with indexsulfonamide.

[0075] Example 5

[0076] Indexsulfonamide treatment of MM cells induces widespread alternative shearing abnormalities.

[0077] This invention also analyzes the alternative splicing of cells treated with indexsulfanilamide.

[0078] We treated MM.1S cells with indexsulfanilamide (20 μM concentration) for 48 h, extracted RNA, performed RNA sequencing (RNA-seq), and analyzed the RNA-seq data using rMATS software to study alternative splicing induced by indexsulfanilamide.

[0079] The results showed a total of 15,070 splicing abnormalities, more than in the RBM39 knockout group, but the proportions of each type of splice were similar to those in the RBM39 knockout group: 65.64% CE, 6.42% A5SS, 9.55% A3SS, 11.33% MXE, and 7.05% RI. Figure 5 In the middle (A), the splicing mode is still mainly based on cut-skip (). Figure 5 In the middle B), approximately 49.09% of RBM39-binding RNAs underwent alternative splicing. Figure 5 (C)

[0080] This invention statistically analyzed genes that underwent alternative splicing after indexsulfanilamide treatment of cells, selected a gene set with an absolute ΔPSI value greater than 0.4, and performed GO functional enrichment analysis on these genes. The results showed that the functions of these genes undergoing alternative splicing were mainly enriched in transcriptional regulation, apoptosis, protein phosphorylation, GTPase regulation, cell cycle, DNA damage and repair pathways, etc. Figure 5 (D). After alternative splicing, these genes extensively affect gene expression within cells. Differentially expressed genes in the RBM39 indexsulfanilamide treatment group compared to the control group were analyzed, and KEGG pathway analysis was performed on these genes.

[0081] The results showed that differentially expressed genes in the indexsulfanilamide-treated group were mainly enriched in pathways such as DNA damage and repair, cell cycle, cytokine regulation, and MAPK signaling pathway. Figure 5 (China)

[0082] Example 6

[0083] Treatment of MM cells with indexsulfonamide induced abnormal MEK5 cleavage, leading to MM cell death.

[0084] We used IGV (Integrative Genomics Viewer) software to perform gene visualization analysis on the above RNA-seq data. The results showed that when MM.1S cells were treated with indexsulfanilamide (20 μM), exon 18 deletion occurred in MEK5 cells. Figure 6 (A)

[0085] H929 and MM.1S cells were treated with DMSO, 10 μM and 20 μM indexsulfanilamide for 48 hours, respectively. RNA was extracted and cDNA was obtained by reverse transcription. PCR primers were designed to amplify the MEK5 fragment (primer F: CATAGAGACGTGAAGCCCTCC (SEQ ID NO:1), primer R: GACGGGCGAATCCTCATCAA (SEQ ID NO:2)). The PCR reaction system is shown in Table 1.

[0086] Table 1. PCR reaction system for amplifying the MEK5 fragment

[0087]

[0088] The above system was mixed thoroughly by pipetting and then subjected to a programmed reaction in a PCR instrument. Details are shown in Table 2.

[0089] Table 2. PCR reaction procedure for amplifying the MEK5 fragment.

[0090]

[0091] The PCR reaction system was subjected to agarose gel electrophoresis. Agarose gel electrophoresis showed that after RBM39 knockout, MEK5 was partially lost, resulting in a shorter band. Figure 6 (B, C)

[0092] The two bands from agarose gel electrophoresis were cut together and recovered from the gel. The recovered PCR product was ligated into a T vector, transformed, and multiple single clones were selected for sequencing. The sequenced sequences were then compared with MEK5 mRNA to analyze the specific lost sequences. Sequencing results of 50 clones in each group were analyzed.

[0093] Sequence alignment showed that knocking out RBM39 decreased the proportion of full-length MEK5 transcripts (MEK5-FL), increased the proportion of transcripts with exon 18 loss (MEK5Δ18), and slightly increased the proportion of transcripts with co-loss of exons 17-18 (MEK5Δ17-18). Figure 6 (D).

[0094] qPCR was used to quantify the total MEK5 transcript pairs (MEK5-T), MEK5-FL, and MEK5Δ18, and the results were consistent with the sequencing alignment results described above. Figure 6 (E). The primer sequences for detecting different transcripts are shown in Table 3.

[0095] Table 3 Primers for detecting different transcripts

[0096]

[0097] The qPCR reaction system is prepared as follows. cDNA can be diluted 5 to 10 times for use. See Table 4 for details.

[0098] Table 4 qPCR reaction system

[0099]

[0100] The above system was mixed thoroughly by pipetting and then subjected to a programmed reaction in a PCR instrument. See Table 5 for details.

[0101] Table 5 qPCR reaction procedure

[0102]

[0103] After the reaction was complete, the RT-PCR amplification curve and melting curve were evaluated. 2 -ΔΔCT Calculate the relative expression level of the target gene.

[0104] Furthermore, when indexsulfanilamide was added to cells overexpressing RBM39, MEK5 cleavage was slightly reduced in the overexpression group compared to the control group. Figure 6 The presence of RBM39 (F~H) further illustrates that the influence of RBM39 on the alternative splicing of MEK5 and the correlation between RBM39 and indexsulfanilamide-induced MEK5 shearing are related to RBM39.

[0105] A shRNA (CCGTCGCCCTTCTCCGTATGC, SEQ ID NO:11) was designed to target the MEK5-3'UTR region to knock out endogenous MEK5 in cells. Different MEK5 isoforms were amplified using overlap PCR.

[0106] We constructed the expression vector using homologous recombination. First, we amplified the full-length MEK5 isoform.

[0107] (1) Enzyme digestion of the overexpression vector

[0108] The enzyme digestion reaction system is shown in Table 6.

[0109] Table 6 Enzyme digestion reaction system

[0110]

[0111] Mix the above system thoroughly by pipetting and incubate in a 37°C water bath for 2-3 hours. After enzyme digestion, add 10× loading buffer to terminate the reaction. Perform agarose gel electrophoresis on the enzyme digestion reaction system to detect the digestion efficiency and recover the target band from the gel. Quantify the recovered enzyme digestion vector and store it at -20°C.

[0112] (2) MEK5 gene PCR

[0113] a. Design amplification primers with homologous arms. Referring to the sequence information of human MEK5 mRNA in GenBank, design PCR primers for MEK5 amplification, adding homologous arms based on the vector sequence and the 5'EcorI and 3'BamHI restriction sites. Specific primer sequences are shown in Table 7; the lowercase parts represent the homologous arm sequences.

[0114] Table 7. PCR primers for MEK5 amplification

[0115]

[0116] b. Amplify the target fragment by PCR. The library plasmid was used as the PCR template, and the reaction system is shown in Table 8.

[0117] Table 8 PCR reaction system for MEK5 amplification

[0118]

[0119] The above system was mixed thoroughly by pipetting and then subjected to a programmed reaction in a PCR instrument. Details are shown in Table 9.

[0120] Table 9 PCR reaction procedure for MEK5 amplification

[0121]

[0122] c. Perform agarose gel electrophoresis on the PCR reaction system, detect the PCR amplification efficiency, and recover the target band from the gel.

[0123] (3) Homologous recombination of vector and target fragment

[0124] The homologous recombination reaction system is shown in Table 10.

[0125] Table 10 Homologous recombination reaction system

[0126]

[0127]

[0128] Mix the above system by pipetting, incubate at 37°C for 30 min in a PCR instrument, and then cool to 4°C after the reaction is complete.

[0129] Construction of different spliceosomal vectors for overexpressing MEK5

[0130] a. First, primers are designed for different spliceosomes.

[0131] MEK5Δ18: First, primers were designed to amplify exon1-exon17 and exon19-stop codons respectively. Overlap primers were designed to repeat PCR so that the PCR products have overlap sequences. Finally, the overlap reaction was used to ligate exon17-exon19.

[0132] MEK5Δ17-18: First, primers were designed to amplify exon1-exon16 and exon19-stop codons respectively. Overlap primers were designed for repeated PCR to ensure the PCR products have overlapping sequences. Finally, the overlap reaction was used to ligate exon16-exon19. (See schematic diagram below.) Figure 7 As shown.

[0133] Since the target vector needs to be cloned into the vector, homologous arms of the target vector can be added directly to both sides of F1 and R1. The specific primer sequences are shown in Table 11, with the lowercase parts representing the homologous arm sequences.

[0134] Table 11 Primers for homologous recombination

[0135]

[0136] b. In the first PCR reaction, the two truncated portions were amplified separately. The specific reaction system is shown in Table 12.

[0137] Table 12 PCR reaction system

[0138]

[0139] Mix the above system thoroughly by pipetting, and then perform the programmed reaction in a PCR instrument. See Table 13 for details.

[0140] Table 13 PCR reaction procedure

[0141]

[0142] The PCR reaction system was subjected to agarose gel electrophoresis to detect the PCR amplification efficiency, and the target band was recovered from the gel. The recovered PCR product was quantified and used as a template for the next reaction.

[0143] c. For the second PCR reaction, overlap sequences were added to amplify the two truncated portions. The reaction system is shown in Table 14.

[0144] Table 14 Second PCR Reaction System

[0145]

[0146] Mix the above system thoroughly by pipetting, and then perform the programmed reaction in a PCR instrument. The reaction conditions are the same as above. Perform agarose gel electrophoresis on the PCR reaction system to detect the PCR amplification efficiency and recover the target band from the gel. Quantify the recovered PCR product and use it as a template for the next reaction.

[0147] c. The third PCR reaction, an overlap reaction, connects the two truncated portions. Note: Primers should be added after pausing the reaction at the end of the first 8 cycles. The reaction system is shown in Table 15.

[0148] Table 15 Third PCR reaction system

[0149]

[0150] Mix the above system thoroughly by pipetting, and then perform a programmed reaction in a PCR instrument. See Table 16 for details.

[0151] Table 16. Procedure for the third PCR reaction

[0152]

[0153] The PCR reaction system was subjected to agarose gel electrophoresis to detect the PCR amplification efficiency, and the target band was recovered from the gel. The recovered PCR products were then quantified.

[0154] d. The recovered PCR product is subjected to homologous recombination with enzyme-digested pCDH-GFP. Transformation can then proceed after the reaction is complete.

[0155] After successfully constructing the overexpression vector, lentiviruses were packaged and used to infect H929 or MM.1S cells to obtain overexpressing cells. Subsequently, endogenous MEK5 was knocked out in the empty vector group, the MEK5 overexpression group, the MEK5Δ18 overexpression group, and the MEK5Δ17-18 overexpression group. The results showed that MEK5 knockout in the empty vector group increased cell death, while exogenous MEK5 overexpression could reverse this cell death. Overexpression of MEK5Δ17-18 and MEK5Δ18 could not reverse the cell death induced by MEK5 knockout.

[0156] The four types of cells were inoculated subcutaneously into NOG mice, and the growth of solid tumors was recorded.

[0157] The results showed that knocking out endogenous MEK5 inhibited tumor growth, while exogenous overexpression of full-length MEK5 eliminated this growth inhibition. However, exogenous overexpression of MEK5Δ17-18 and MEK5Δ18 could not restore the growth of MM tumors. Figure 6 (Medium IK). This indicates that MEK5Δ17-18 and MEK5Δ18 do not possess the function of full-length MEK5. Therefore, indexsulfanilamide induces MM cell death by causing abnormal MEK5 cleavage.

[0158] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A pharmaceutical composition for treating multiple myeloma, characterized by comprising, Indanocine and bortezomib; the mass ratio of the indanocine and bortezomib is 9-11:

1.

2. The use of the pharmaceutical composition of claim 1 in the preparation of a drug for preventing and / or treating multiple myeloma.

3. Use according to claim 2, characterized in that, The multiple myeloma is multiple myeloma sensitive to bortezomib.