Signal peptides, nucleic acid fragments, recombinant expression vectors, host cells and their applications
Patent Information
- Application Number
- CN202211590466.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-12
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2042-12-12
AI Technical Summary
然而,利用蛋白或抗体本身的信号肽进行分泌表达存在分泌效率低、表达水平低等问题
[0018]本申请提供一种人工合成信号肽,该信号肽适用性广、分泌效率高且表达水平高,从而大大提高重组蛋白的表达水平。经验证,本申请的信号肽能够显著提升重组蛋白的表达水平,最高达到5倍以上,平均提升在3倍左右。
Smart Images

Figure CN116284246B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biotechnology, and in particular to a signal peptide, nucleic acid fragment, recombinant expression vector, host cell, and their applications. Background Technology
[0002] Bloble and Dobberstin (1975) proposed the signal peptide hypothesis, which posits that secretory proteins possess a signal peptide at their N-terminus. When the nascent peptide reaches approximately 50-70 aa, the signal peptide emerges from the large subunit of the ribosome and is immediately recognized and bound by receptors on the RER membrane. After crossing the membrane into the RER lumen, the signal peptide is hydrolyzed by signal peptidase. The synthesized nascent peptide, along with the signal peptide, passes through protein pores in the RER membrane, crosses the lipid bilayer, and enters the RER lumen. This hypothesis has undergone further development over many years of research, but its fundamental principles remain valid. Bloble was awarded the 1999 Nobel Prize in Physiology or Medicine for this achievement.
[0003] The signal peptide hypothesis posits that during the translation of mRNA encoding secretory proteins, the first synthesized component is a signal peptide with a hydrophobic amino acid residue at its N-terminus. This signal peptide is recognized and binds to receptors on the endoplasmic reticulum (ER) membrane. The signal peptide then travels through pores formed by proteins in the membrane to the ER lumen, where it is hydrolyzed by a signal peptidase located on the lumen surface. Guided by this peptidase, the newly formed polypeptide can pass through the ER membrane into the lumen and is eventually secreted extracellularly. After translation, the ribosomal subunits dissociate, the pores disappear, and the ER membrane reverts to its original lipid bilayer structure.
[0004] A signal peptide is synthesized as a precursor polypeptide during the synthesis of certain secretory proteins and cell membrane proteins. Its N-terminus contains an amino acid sequence that serves as a signal for crossing the membrane; this sequence is called the signal peptide or signal sequence. Signal peptides are generally located at the N-terminus of secretory proteins and consist of three regions: a positively charged N-terminus with 2-3 polar amino acids, called the basic amino terminus; a hydrophobic intermediate sequence, mainly composed of neutral amino acids, which is the main functional region of the signal peptide; and a longer, negatively charged C-terminus containing small amino acids, which is the cleavage site of the signal sequence, also known as the processing region. During protein synthesis, the precursor polypeptide binds to the membrane via this sequence, forming a membrane-bound polyribosome. The polypeptide chain crosses the membrane parallel to its synthesis, and the signal peptide is cleaved and removed by a peptidase present on the membrane during this process.
[0005] In modern biomedical development, in vitro recombinant expression technology has been widely developed. Many factors influence the expression of recombinant proteins in host cells, such as signal peptides, transcription and translation control factors, mRNA stability, vector construction, and host bacterial selection. Even with the same expression vector, the same protein can be secreted and expressed under the influence of different signal peptides, but the secretion efficiency can vary significantly. Selecting a signal peptide with high secretion efficiency can increase the secretory expression level of the protein. However, using the signal peptides of the protein or antibody itself for secretory expression suffers from low secretion efficiency and low expression levels. Summary of the Invention
[0006] Therefore, it is necessary to provide a protein secretion signal peptide that is widely applicable, has high secretion efficiency, and high expression level.
[0007] The technical solution to the above-mentioned technical problems in this application is as follows:
[0008] A signal peptide having the amino acid sequence shown in SEQ ID No. 15.
[0009] A nucleic acid fragment that encodes a signal peptide as described above.
[0010] In one embodiment, the nucleotide sequence of the nucleic acid fragment is shown in SEQ ID No. 33.
[0011] A recombinant expression vector comprising the aforementioned nucleic acid fragment.
[0012] In one embodiment, the 3' end of the nucleic acid fragment is linked to a coding sequence fragment of a recombinant protein.
[0013] In one embodiment, the 5' end of the nucleic acid fragment is linked to a Kozak sequence fragment.
[0014] A host cell whose genome contains the aforementioned recombinant expression vector.
[0015] This application also provides the use of the above-mentioned signal peptide, the above-mentioned nucleic acid fragment, the above-mentioned recombinant expression vector, or the above-mentioned host cell in the preparation of recombinant proteins.
[0016] In one embodiment, the recombinant protein is selected from one or more of RBD protein, ERBB2 receptor, HE4 protein, NT-proBNP protein, PSA protein, ST2 receptor, TPO protein, Bosd2 protein, and LysozymeC.
[0017] A method for preparing a recombinant protein, wherein the recombinant protein is obtained by gene expression using the aforementioned host cells.
[0018] This application provides a synthetic signal peptide that has wide applicability, high secretion efficiency, and high expression level, thereby significantly improving the expression level of recombinant proteins. Verification has shown that the signal peptide of this application can significantly increase the expression level of recombinant proteins, reaching up to 5-fold or more, with an average increase of approximately 3-fold. Attached Figure Description
[0019] Figure 1 This is a map of plasmid pcDNA3.1 from Example 1;
[0020] Figure 2 This is a diagram of the carrier signal peptide linkage structure in Example 1;
[0021] Figure 3 This is a graph showing the signal-to-noise ratio of different secretory signal peptides in Example 1;
[0022] Figure 4 This illustrates the effect of the signal peptide and the validation protein's own signal peptide on the expression level of the validation protein in Example 1.
[0023] Figure 5 This is a graph showing the fold increase in protein expression levels caused by the signal peptide in Example 1. Detailed Implementation
[0024] To facilitate understanding of this application, a more complete description will be provided below. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that the disclosure of this application will be more thorough and complete.
[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.
[0026] The terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitation, an element preceded by the phrase “comprising one…” does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element. The indefinite articles “a” and “an” preceding an element or component in this application are not restrictive in terms of the quantity (i.e., the number of times) of the element or component. Therefore, “an” or “a” should be interpreted as including one or at least one, and singular elements or components also include plural forms, unless the quantity clearly refers only to the singular. “A plurality” means at least two, such as two, three, etc., unless otherwise expressly specified.
[0027] Terminology Explanation:
[0028] A "vector" is a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of the protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well known to those skilled in the art and include, but are not limited to: plasmids; phage particles; Cos plasmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40).
[0029] "Host cell" refers to a cell that can be used to introduce the vector, including but not limited to animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells, or human cells.
[0030] One embodiment of this application provides a signal peptide, the amino acid sequence of which is shown in SEQ ID No. 15.
[0031] Specifically, the amino acid sequence shown in SEQ ID No. 15 is: MTRLTVLALLALLLASSRA.
[0032] In addition, one embodiment of this application provides a nucleic acid fragment that encodes the aforementioned signal peptide for mediating the secretory expression of recombinant proteins in host cells.
[0033] Furthermore, the nucleotide sequence of the above-mentioned nucleic acid fragment is shown in SEQ ID NO.33, specifically ATGACCAGACTGACCGTGCTGGCTCTGCTGGCTCTGCTGCTGGCAAGCTCTAGAGCT.
[0034] In some of these embodiments, the aforementioned nucleic acid fragments can be prepared by conventional chemical synthesis or other methods.
[0035] In some embodiments, the aforementioned nucleic acid fragments may be added to a recombinant expression vector to mediate the secretory expression of recombinant proteins.
[0036] In addition, one embodiment of this application provides a recombinant expression vector containing the above-mentioned nucleic acid fragment encoding the signal peptide and the nucleic acid fragment encoding the target protein.
[0037] In some embodiments, the 3' end of the nucleic acid fragment encoding the signal peptide described above is linked to a coding sequence fragment of a recombinant protein.
[0038] Furthermore, in the aforementioned recombinant expression vector, the 5' end of the nucleic acid fragment encoding the signal peptide of this application is linked to a Kozak sequence fragment.
[0039] In one optional specific example, the vector used to express the fusion protein is pcDNA3.1. A signal peptide expression vector is synthesized and constructed, double-digested with restriction endonucleases BamHI and XhoI, followed by gel electrophoresis. The target fragment is recovered, and the target sequence of the signal peptide is cloned into the restriction sites of BamHI and XhoI. The expression vector containing the signal peptide and the target protein is transformed or transfected into host cells to express the target protein. Furthermore, the signal peptide, generated by the translation of the nucleic acid fragment encoding the signal peptide, allows the protein produced by the host cell to be secreted extracellularly, facilitating the collection of the target protein.
[0040] It can be understood that the recombinant expression vectors mentioned above are eukaryotic expression vectors. Furthermore, the recombinant expression vectors mentioned above are expression vectors used for mammalian eukaryotic expression.
[0041] In addition, one embodiment of this application provides a host cell whose genome contains the above-mentioned recombinant expression vector, which can produce signal peptides and promote the secretion and expression of recombinant proteins.
[0042] In one embodiment, the host cell is HEK293. Of course, in other embodiments, the host cell is not limited to HEK293, but can also be other cells, such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, or animal cells such as human cells.
[0043] In one embodiment, after transfecting a recombinant expression vector containing the above-mentioned nucleic acid fragment encoding the signal peptide and the above-mentioned nucleic acid fragment encoding the target protein into a host cell, the transfected host cell is cultured to prepare the target protein.
[0044] After culturing transfected host cells for a period of time, the host cells or the culture medium containing them were collected to prepare a primary product containing the target protein. The primary product was then purified to obtain the purified target protein. Results showed that the signal peptide synthesized in this application increased the expression level of the target protein compared to the signal peptide of the target protein itself. This signal peptide can also be used to increase the expression level of other target proteins.
[0045] Currently, in vitro recombinant expression technology is widely developed, but many factors affect the expression of recombinant proteins in host cells. Among them, secretory expression using the signal peptide of the protein or antibody itself has problems such as low secretion efficiency, low expression level, and increased cost. The signal peptide coding rules reported in the literature are as follows: (1) The N-terminus is usually a positively or negatively charged amino acid residue; (2) The hydrophobic core is usually composed of 6-15 hydrophobic residues, forming an α-helix; (3) The C-terminal-3 and C-terminal-1 positions are small uncharged amino acid residues that can be effectively cleaved; (4) The C-terminal-2 position is usually an aromatic amino acid residue, and more commonly a hydrophobic amino acid residue; (5) The C-terminal-4 position allows hydrophobic amino acid residues such as leucine or isoleucine; (6) The C-terminal-5 position is usually proline. Wild-type signal peptides can be modified according to the above-mentioned signal peptide coding rules. However, it is not easy to obtain signal peptides with high expression levels according to the above-mentioned signal peptide coding rules. In fact, it may even lead to a decrease in expression levels. This application involved extensive modification and screening to finally obtain a protein secretion signal peptide with broad applicability, high secretion efficiency, and high expression level, which can be used for the efficient secretory expression of recombinant proteins.
[0046] An embodiment of this application also provides the use of the above-mentioned signal peptide, the above-mentioned nucleic acid fragment, the above-mentioned recombinant expression vector, or the above-mentioned host cell in the preparation of recombinant proteins.
[0047] In some embodiments, the recombinant protein is selected from one or more of RBD protein, ERBB2 receptor, HE4 protein, NT-proBNP protein, PSA protein, ST2 receptor, TPO protein, Bos d 2 protein, and Lysozyme C.
[0048] In addition, this application also provides a method for preparing a recombinant protein, wherein the recombinant protein is obtained by gene expression using the above-mentioned host cells.
[0049] In some specific examples, the preparation method of the recombinant protein includes the following steps:
[0050] The nucleic acid fragment encoding the signal peptide of this application is ligated with the nucleic acid fragment encoding the target protein and then cloned into a recombinant expression vector. The recombinant expression vector is then transformed or transfected into host cells to express the target protein.
[0051] The aforementioned signal peptides have the advantages of wide applicability, high secretion efficiency, and high expression level for the expression of recombinant proteins in vitro. Specific Implementation
[0053] The following detailed description is provided with reference to specific embodiments. Unless otherwise specified, the embodiments do not include components other than unavoidable impurities. Unless otherwise specified, the reagents and instruments used in the embodiments are conventionally selected in the art. Experimental methods not specifying specific conditions in the embodiments were implemented under conventional conditions, such as those described in literature, books, or methods recommended by the manufacturer. The recombinant protein encoding gene sequences used below are from Jiangsu Saisofe Biotechnology Co., Ltd., and the recombinant proteins are from Sanlian Biotechnology Co., Ltd.
[0054] Example 1
[0055] I. Screening for signal peptides that efficiently mediate the secretory expression of recombinant proteins
[0056] 1. Design of signal peptides
[0057] This embodiment first selects some secretion signal peptides that can mediate efficient protein expression reported in the literature, such as Seq ID No.1, Seq ID No.4, Seq ID No.7, Seq ID No.10, Seq ID No.13, and Seq ID No.16 in Table 1. Then, based on the signal peptide coding rules reported in the literature, namely: (1) the N-terminus is usually a positively or negatively charged amino acid residue; (2) the hydrophobic core is usually composed of 6-15 hydrophobic residues, forming an α-helix; (3) the C-terminal-3 and C-terminal-1 positions are small uncharged amino acid residues that can be effectively cleaved; (4) the C-terminal-2 position is usually an aromatic amino acid residue, and more commonly a hydrophobic amino acid residue; (5) the C-terminal-4 position allows hydrophobic amino acid residues such as leucine or isoleucine; (6) the C-terminal-5 position is usually proline. Partial site mutations were performed on these signal peptides (sequences such as Seq ID No.2, Seq ID No.3, Seq ID No.5, Seq ID No.6, Seq ID No.16). Seq IDs No. 8, No. 9, No. 11, No. 12, No. 14, No. 15, No. 17, and No. 18 were then used to construct the pcDNA3.1 eukaryotic expression vector. The resulting graph is shown below. Figure 1 Then according to Figure 2 The expression cassette shown links the COVID-19 (RBD) protein expression gene downstream of the signal peptide. The amino acid sequence of the COVID-19 (RBD) protein is shown in Seq ID No. 37.
[0058] Table 1
[0059]
[0060] 2. Construction of expression vectors for different signal peptides
[0061] First, an expression vector containing the Kozak sequence and the signal peptide listed in Table 1 was constructed (completed by Jiangsu Saisofe Biotechnology Co., Ltd.). The signal peptide gene sequence is shown in Table 2 (Seq ID No. 19–36). The COVID-19 (RBD) protein gene sequence (Seq ID No. 71) was fused with the Fc terminus of mouse IgG1 antibody (Seq ID No. 72), facilitating the detection and purification of the recombinant protein. The vector was digested with BamHI and XhoI restriction endonucleases, and the fragments were recovered by agarose gel electrophoresis. The target fragment was digested with BamHI and XhoI restriction endonucleases and then ligated with the digested vector. The ligation product was transformed into TOP10 competent cells and cultured at 37°C for 15 h. Single colonies were picked for electrophoretic PCR identification. Positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing identification. Plasmids with correct sequencing were subjected to plasmid extraction. The extracted plasmids were sterilized by filtration through a 0.22 μm filter and then stored at -20°C.
[0062] Table 2
[0063]
[0064]
[0065] 3. Tests on transient expression of recombinant proteins mediated by different signal peptides
[0066] Prepare suspension HEK293 cells cultured in OPM-CD05 medium (OPM), and seed the cells at a density of 1×10⁶ cells / year 24 hours before transfection. 6 On the day of transfection, preheat 1 / 15 volume of OPM-CD05 medium at 37°C. Add transfection plasmid at a rate of 1 μg DNA / mL of culture, followed by 2 times the mass of PEI (1 mg / mL) transfection reagent (Polysciences). Mix thoroughly by inversion and let stand at room temperature for 20 min. Then, slowly add the DNA and PEI mixture into the cultured cells. On days 2 and 4 of culture, supplement with 1% glucose (2M) and glutamine solution (200 mM). Collect the cell expression supernatant after 6-7 days of culture for expression level detection. To reduce experimental error, each signal peptide expression vector was tested in triplicate. After harvesting the supernatant, the expression level was then measured.
[0067] 4. Detection and analysis of expression levels of different secretory signal peptides
[0068] This experiment used the SLXP-001B instrument and its matching reagents, independently developed by Jiangsu Sanlian Biotechnology Co., Ltd., for protein quantification analysis. The basic principle involves coating a protein chip on a hard matrix with goat anti-mouse antibody, then incubating the supernatant of transiently transexpressed cells, and finally adding HRP-labeled goat anti-mouse (Jackson) antibody. After luminescence, the expression level is determined based on the signal-to-noise ratio (SNR). The basic steps are as follows: the protein chip is loaded onto the SLXP-001B instrument, then 200 μL of transiently transexpressed cell supernatant is added to the chip cup. After instrument self-test, detection begins. Finally, the true expression level of different signal peptides is studied by analyzing the SNR of different signal peptide expression vectors. The average SNR analysis of three sets of experiments shows that, for example... Figure 3 As shown, the signal peptide E2 has the highest signal-to-noise ratio, therefore the E2 signal peptide was selected for further recombinant protein expression testing.
[0069] II. Verification of the expression level of the signal peptide of the highly expressed protein
[0070] The E2 signal peptide with the highest signal-to-noise ratio was selected for further practical application research. Under the same conditions, the signal peptide of this application and the signal peptide of the verification protein itself were used for comparative verification to compare the secretory expression level of this signal peptide in HEK293 cells. The specific operation is as follows:
[0071] 1. Construction of expression vectors for high-expression protein signal peptides
[0072] First, this application includes the signal peptide (its amino acid sequence is as shown in Seq ID No. 15, and the gene sequence is as shown in Seq ID No. 33), the signal peptide of the test protein itself (its amino acid sequences are as shown in Seq ID No. 39, Seq ID No. 43, Seq ID No. 47, Seq ID No. 51, Seq ID No. 55, Seq ID No. 59, Seq ID No. 63, Seq ID No. 67, and the gene sequence is as shown in Seq ID No. 73, Seq ID No. 77, Seq ID No. 81, Seq ID No. 85, Seq ID No. 89, Seq ID No. 93, Seq ID No. 97, Seq ID No. 101), and the test protein (its amino acid sequences are as shown in Seq ID No. 40, Seq ID No. 44, Seq ID No. 48, Seq ID No. 52, Seq ID No. 56, Seq ID No. 60, Seq ID No. 64, Seq ID No. 101). The recombinant expression vector containing gene sequences such as Seq ID No. 68 (Seq ID No. 74, Seq ID No. 78, Seq ID No. 82, Seq ID No. 86, Seq ID No. 90, Seq ID No. 94, Seq ID No. 98, Seq ID No. 102) was synthesized by Jiangsu Saisofe Biotechnology Co., Ltd. The vector fused to the Fc terminus of mouse IgG1 antibody (self-signal peptide + test protein amino acid sequence such as Seq ID No. 41, Seq ID No. 45, Seq ID No. 49, Seq ID No. 53, Seq ID No. 57, Seq ID No. 61, Seq ID No. 65, Seq ID No. 69, and the signal peptide + test protein amino acid sequence of this application such as Seq ID No. 42, Seq ID No. 46, Seq ID No. 50, Seq ID No. 54, Seq ID No. 58, Seq ID No. 62, Seq ID No. 66, Seq ID No. 68). Seq ID No. 70, the gene sequences of the signal peptide + test protein are as follows: Seq ID No. 75, Seq ID No. 79, Seq ID No. 83, Seq ID No. 87, Seq ID No. 91, Seq ID No. 95, Seq ID No. 99, Seq ID No. 103; the gene sequences of the signal peptide + test protein in this application are as follows: Seq ID No. 76, Seq ID No. 80, Seq ID No. 84, Seq ID No. 88, Seq ID No. 92, Seq ID No. 70.96. (Seq ID No. 100, Seq ID No. 104) facilitates the detection and purification of recombinant proteins. The vector is synthesized and digested using BamHI and XhoI restriction endonucleases, followed by agarose gel electrophoresis to recover the vector fragments. The target fragment is digested with BamHI and XhoI restriction endonucleases, then ligated to the digested vector. The ligation product is transformed into TOP10 competent cells and cultured at 37°C for 15 hours. Single colonies are picked for electrophoretic PCR identification. Positive clones are sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing identification. Plasmids with correct sequencing are subjected to plasmid extraction. The extracted plasmids are sterilized by filtration through a 0.22 μm filter and then stored at -20°C.
[0073] Table 3
[0074]
[0075]
[0076]
[0077]
[0078] 2. Protein expression assay
[0079] Prepare suspension HEK293 cells cultured in OPM-CD05 medium (OPM), and seed the cells at a density of 1×10⁶ cells / year 24 hours before transfection. 6 On the day of transfection, preheat 1 / 15 volume of OPM-CD05 medium at 37°C. Add transfection plasmid at a rate of 1 μg DNA / mL, followed by 2 times the mass of PEI (1 mg / mL) transfection reagent (Polysciences). After inverting and mixing, incubate at room temperature for 20 min. Then, slowly add the DNA and PEI mixture to the cultured cells. On days 2 and 4, supplement with 1% glucose (2M) and glutamine solution (200 mM). Collect the cell expression supernatant after 6-7 days of culture for expression level detection. To reduce experimental error, each signal peptide expression vector was tested in triplicate. After harvesting the supernatant, the recombinant protein was purified and the average expression level was calculated.
[0080] 3. Isolation and purification of the target protein
[0081] First, the rProtein A affinity column was connected to an AKTA pure150L instrument, and the column was equilibrated with 5CV equilibration buffer (PBS, pH 7.4). Cell culture supernatant was then loaded after centrifugation, and equilibration with equilibration buffer continued until the UV baseline stabilized. Protein was eluted from the column with 20 mM citric acid (pH 3.0), and the elution peak was collected. The pH of the eluent was adjusted to 7.2 with Tris-HCl (pH 9.0). The protein buffer was then replaced with PBS (pH 7.4) using a dialysis bag. The purified protein concentration and total protein amount were then measured, and the yield was calculated. Specific results are shown in Table 4.
[0082] Table 4
[0083] signal peptide Average protein expression level (mg / L) ERBB2 auto-signal peptide 18.5 ERBB2 synthetic signal peptide 49.3 HE4 autosignal peptide 23.3 HE4 synthetic signal peptide 61.8 NT-proBNP autosignal peptide 13.7 NT-proBNP artificially synthesized signal peptide 40.6 PSA auto-signal peptide 29.3 PSA artificially synthesized signal peptide 90.0 ST2 autosignal peptide 10.2 ST2 synthetic signal peptide 41.7 TPO auto-signal peptide 4.6 TPO artificially synthesized signal peptide 26.3 Bos d2 autosignal peptide 25.4 Bos d2 synthetic signal peptide 83.4 Lysozyme auto-signal peptide 34.3 Lysozyme artificially synthesized signal peptide 91.8
[0084] 4. Analysis of the effect of artificially synthesized signal peptides on protein expression levels
[0085] Under the same conditions, protein expression tests were performed using both the artificially synthesized signal peptide and the signal peptide used to verify the protein itself. The results showed that, as Figure 4 and Figure 5 As shown, the artificially synthesized signal peptide of this application can significantly enhance the expression level of recombinant proteins, reaching up to 5 times or more, with an average enhancement of about 3 times.
[0086] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0087] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.
Claims
1. The application of a nucleic acid fragment with the nucleotide sequence shown in SEQ ID No. 33 in the preparation of recombinant proteins, characterized in that, The recombinant protein is selected from one or more of RBD protein, ERBB2 receptor, HE4 protein, NT-proBNP protein, PSA protein, ST2 receptor, TPO protein, Bos d 2 protein, and Lysozyme C; the host cell is HEK293 cell, and the amino acid sequences of the RBD protein, ERBB2 receptor, HE4 protein, NT-proBNP protein, PSA protein, ST2 receptor, TPO protein, Bos d 2 protein, and Lysozyme C are shown as Seq ID No. 37, Seq ID No. 40, Seq ID No. 44, Seq ID No. 48, Seq ID No. 52, Seq ID No. 56, Seq ID No. 60, Seq ID No. 64, and Seq ID No. 68, respectively.