Method for exogenous expression of COQ3 by recombinant pichia pastoris engineering bacteria
By constructing the recombinant plasmid pPICZAC in Pichia pastoris GS115 and inducing fermentation with methanol, the problems of high production cost and low purity of COQ3 were solved, realizing low-cost large-scale production of COQ3 and meeting the needs of the pharmaceutical and cosmetic fields.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-25
- Publication Date
- 2026-04-14
AI Technical Summary
Existing COQ3 production methods suffer from high costs, low purity, and difficulty in scaling up. In particular, chemical synthesis methods are cumbersome, natural strain screening methods have low yields and strains are prone to inactivation, and microbial heterologous synthesis methods have poor host compatibility, making it difficult to meet the needs of the pharmaceutical and cosmetic fields.
By using Pichia pastoris GS115 engineered strain and constructing the recombinant plasmid pPICZAC, COQ3 was efficiently expressed and accumulated through inducible promoter PAOX1 and methanol fermentation, simplifying the purification process and reducing production costs.
It enables low-cost, large-scale production of COQ3 with high product purity, meeting the needs of the pharmaceutical and cosmetic fields, and providing an industrial production solution for high-purity COQ3 raw materials.
Smart Images

Figure CN121852433A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the construction of a recombinant Pichia pastoris engineered strain, its fermentation method, and the process of producing COQ3 using the engineered strain. Background Technology
[0002] The core structure of COQ3 is a quinone ring connected to three isoprene side chains (molecular formula C). 24 H 36 O4), belonging to the short-chain ubiquinone class of compounds, is a key intermediate in the coenzyme Q biosynthesis pathway. It serves as an important metabolite in the quinone ring modification pathway of the Antroquinonol (AQ) biosynthesis pathway from Antrodia camphorata.
[0003] The Coenzyme Q family are key lipid-soluble quinone cofactors in the mitochondrial respiratory chain, responsible for electron transport and membrane-phase antioxidant functions, and participating in ferroptosis inhibition through the FSP1-CoQ-NAD(P)H axis. Compared to its long-chain homologues, COQ3 possesses moderate hydrophobicity, making it suitable as a reference compound for electron acceptor / red oxygen mediator research and quality control in mitochondrial function studies. With the growth of the COQ10 industry and advancements in cutting-edge research on ferroptosis, high-purity, scalable, and sustainable production solutions for COQ3 will meet the stable supply demands for short-chain ubiquinone materials in scientific research reagents, food / pharmaceutical quality control, and electrochemical applications.
[0004] Existing production methods for COQ3 all have significant shortcomings. Chemical synthesis is cumbersome, relies on toxic reagents, yields products with purity below 90%, and incurs high costs for treating high-salt wastewater and exhaust gases, placing significant environmental pressure on the industry. Natural strain screening yields less than 5 mg / L, strains are prone to inactivation during passage, require complex separation, and are difficult to scale up. Microbial heterologous synthesis suffers from poor host compatibility (significant losses during E. coli extraction, slow growth of Saccharomyces cerevisiae, and a lack of modification options for Pichia pastoris), low activity of key enzymes, metabolic imbalance, and low gene editing efficiency. All three methods share the common characteristics of difficult separation and purification, high preparation costs, and inability to meet the needs of the pharmaceutical and cosmetic fields.
[0005] The Pichia pastoris expression system has many advantages, such as high-density fermentation, a potent alcohol oxidase (AOX1) promoter, good genetic stability, low culture cost, ability to perform correct folding and post-translational modification of eukaryotic proteins, and easy accumulation and enrichment of intracellular proteins.
[0006] In summary, existing COQ3 production pathways all suffer from insurmountable bottlenecks, while the core advantages of Pichia pastoris (especially strain GS115) precisely address these pain points: its strong promoter can efficiently regulate the expression of key genes in COQ3 synthesis, overcoming rate-limiting steps; its high-cell-density fermentation capacity increases yield per unit volume; its low-background metabolism and eukaryotic modification system simplify purification processes and ensure product activity; and its genetic stability and low-cost culture characteristics are more suitable for long-term industrial production. Therefore, constructing modified strains of Pichia pastoris and producing COQ3 through heterologous synthesis is the optimal path to overcome current technological bottlenecks and achieve large-scale and economical COQ3 production. It also provides a feasible solution for the subsequent industrial production needs of high-purity COQ3 raw materials and other ubiquinones in the pharmaceutical and food industries. Summary of the Invention
[0007] In view of the shortcomings of existing technologies for producing COQ3, the purpose of this invention is to provide a method for producing COQ3 efficiently, at low cost, and on a large scale, and also to provide a new approach for the industrial production of other quinone substances.
[0008] To achieve the above objectives, the present invention adopts the following technical solution: A method for exogenous expression of COQ3 in recombinant Pichia pastoris engineered strains, characterized by comprising the following steps: The COQ2 gene sequence was constructed into plasmid pPICZA to obtain recombinant plasmid pPICZAC. Recombinant plasmid pPICZAC (a recombinant plasmid containing the AOX1 promoter) was inserted into the genome of Pichia pastoris GS115 to obtain recombinant Pichia pastoris engineered strain. The recombinant Pichia pastoris engineered strain was fermented with methanol using the inducible promoter PAOX1 to obtain the intracellular product COQ3.
[0009] The COQ2 gene sequence was constructed into plasmid pPICZA to obtain recombinant plasmid pPICZAC, which specifically includes: First, using the empty pPICZA plasmid as a template, the linearized vector was amplified by reverse PCR to obtain the pPICZA fragment. The COQ2 gene sequence was amplified by PCR using the primer pair COQ2-F / R. The fragment size was checked by gel electrophoresis. The template was eliminated with DpnI enzyme and purified. The COQ2 gene was inserted into the pPICZA plasmid using a one-step cloning kit to obtain the recombinant plasmid pPICZAC.
[0010] The primer pair COQ2-F / R is: COQ2-F: atgtctccgagtcgttctactgt; COQ2-R: tcatgcaagctgcgggtgctgcg.
[0011] The recombinant plasmid pPICZAC (containing the AOX1 promoter) was inserted into the Pichia pastoris GS115 genome, specifically including: First, Pichia pastoris GS115 chemically competent cells were prepared. After linearizing the recombinant plasmid pPICZAC, it was added to the Pichia pastoris GS115 chemically competent cells, and recombinant Pichia pastoris engineered strains were obtained through homologous recombination.
[0012] The recombinant Pichia pastoris engineered strain was used to obtain the intracellular product COQ3 via methanol fermentation using the inducible promoter PAOX1. Specifically, it includes: Recombinant Pichia pastoris engineered strains were inoculated into YPD liquid medium to obtain seed culture; the seed culture was transferred to BMGY medium for culture, and after culture, the bacterial cells in BMGY were collected by centrifugation and washing; then the bacterial cells were resuspended in BMMY medium and COQ0 was added, with methanol added every 10-14 h for culture. During the culture, the product COQ3 was obtained by fermentation using the inducible promoter PAOX1.
[0013] The ratio of COQ0 to BMMY culture medium is 0.09~0.11g:50mL.
[0014] The volume ratio of methanol to BMMY medium added each time is 0.4~0.8:100.
[0015] Further optimization involved constructing the COQ2 gene sequence into plasmid pPICZA to obtain recombinant plasmid pPICZAC. The recombinant plasmid containing the AOX1 promoter was then inserted into the Pichia pastoris GS115 genome, and methanol-induced fermentation was performed using the inducible promoter PAOX1 to obtain the intracellular product COQ3.
[0016] (1) Construction of pPICZAC plasmid: First, using the empty pPICZA plasmid as a template, the linearized vector was amplified by reverse PCR to obtain the pPICZA fragment. The COQ2 gene fragment was amplified by PCR using the primer pair COQ2-F / R. The fragment size was checked by gel electrophoresis, and the template was removed by DpnI enzyme and purified. The COQ2 gene was inserted into the pPICZA plasmid using a one-step cloning kit.
[0017] (2) Construction of GS / pPICZAC strain: After linearizing the pPICZAC plasmid, it was transformed into Pichia pastoris. Transformants were selected for verification. The transformation was successful when the pPICZAC plasmid was integrated into the GS115 genome.
[0018] (3) Fermentation of GS / pPICZAC strain: A single colony that was successfully verified was inoculated into 5 mL of YPD liquid medium and cultured at 30℃ and 200 rpm for 12 h to obtain seed culture; the bacterial culture in YPD was transferred to 50 mL of BMGY medium and cultured at 30℃ in a shaker until the OD600 was 2-6; the bacterial cells in BMGY were collected by centrifugation (4℃, 5000 rpm, 5 min), washed twice with sterile water (pre-cooled) and collected by centrifugation (4℃, 5000 rpm, 5 min), resuspended in 50 mL of BMMY medium, and 0.1 g of COQ0 was added. 0.5% methanol was added every 12 h and cultured at 30℃ and 200 rpm for 72 h.
[0019] Compared with the prior art, the present invention has the following advantages: This invention inserts the target gene COQ2 into the Pichia pastoris secretory expression vector pPICZA to construct a recombinant expression plasmid. This plasmid is then transformed into the Pichia pastoris GS115 host cell to obtain a recombinant Pichia pastoris engineered strain capable of expressing COQ3. Through methanol-induced fermentation, this engineered strain can accumulate COQ3 intracellularly. The method provided by this invention has advantages such as low cost and ease of scale-up production, offering a new approach for the industrial production of COQ3 and other ubiquinone compounds. Compared with existing technologies, this invention has the following significant advantages: (1) Low production cost: Pichia pastoris GS115 strain grows rapidly and is highly tolerant, and the culture medium components are inexpensive; at the same time, the methanol induction system does not require expensive antibiotic screening, which greatly reduces the fermentation cost. (2) Precise expression regulation: Using methanol as a bifunctional factor (which is both a carbon source and an inducer), the expression timing of COQ2 enzyme can be precisely controlled, avoiding the metabolic burden on cell growth caused by early expression and ensuring that the product reaches its peak accumulation in the later stage of fermentation.
[0020] (3) Easy to scale up production: High-Density Fermentation technology of Pichia pastoris is very mature. In particular, the GS115 strain has extremely high protein expression capacity in Fed-Batch mode, which is very suitable for scaling up directly from laboratory scale to ton-level industrial production scale.
[0021] (4) Product purity is controllable: Compared with plant extraction methods, which are easily contaminated by pesticide residues, this invention directly generates COQ3 through biosynthesis. Furthermore, the yeast cell wall structure helps the product to accumulate intracellularly, providing a high concentration of initial substrate for subsequent extraction, which is conducive to obtaining a high-purity final product.
[0022] In summary, this invention provides a novel technical route for the green and large-scale production of COQ3 and other ubiquinone compounds. Attached Figure Description
[0023] Figure 1 Map of the recombinant expression plasmid pPICZAC.
[0024] Figure 2 Electrophoresis diagram for COQ2 fragment identification.
[0025] Figure 3 Electrophoresis diagram for ZA fragment identification.
[0026] Figure 4 Electrophoresis image of PCR identification of recombinant expression plasmid pPICZAC.
[0027] Figure 5 Electrophoresis image of PCR identification of recombinant Pichia pastoris strain GS / pPICZAC.
[0028] Figure 6 High-performance liquid chromatogram of recombinant Pichia pastoris fermentation products.
[0029] Figure 7 Mass spectrum of recombinant Pichia pastoris fermentation products. Detailed Implementation
[0030] Example 1: Construction of recombinant plasmid pPICZAC 1. Construction of linearized vectors Using the empty pPICZA plasmid as a template, the linearized vector was amplified by reverse PCR using the primer pair zac-F / R to obtain the pPICZA fragment. The fragment size was then determined by gel electrophoresis. Figure 3 As shown, the fragment size is correct. The template was eliminated using DpnI enzyme, and the fragment was purified. The PCR system and PCR reaction procedure are shown in Tables 1 and 2, and the DpnI reaction system is shown in Table 3.
[0031] zac-F: AGCACCCGCAGCTTGCATGAACGTGGCCCAGCCGGCCGTC zac-R: TAGAACGACTCGGAGACATGAATTCCTCGTTTCGAAT Table 1 PCR system Table 2 PCR reaction procedure Table 3 DpnⅠ Reaction System The DpnⅠ reaction steps are as follows: The above system is prepared on ice; Gently suck or tap the tube wall to mix (do not vortex), then centrifuge briefly to collect the droplets clinging to the wall; 37℃ metal bath for 30~60 minutes; Incubation at 80℃ for 20 minutes will inactivate the enzyme and stop the reaction.
[0032] In addition, the agarose gel electrophoresis verification steps are as follows: 1) Gel preparation: Weigh 0.25g agarose into an Erlenmeyer flask, add 25mL of TAE buffer solution, heat in a microwave oven to boiling, remove and cool to about 50℃, add 2.5μL of fluorescent dye, mix well and quickly pour into the mold, being careful not to have air bubbles, and wait for solidification, about 40min.
[0033] 2) Electrophoresis: Place one drop of loading buffer on your glove, add 4 μL of PCR product, mix well by pipetting, and load the sample; add 3 μL of marker to the first well. Replace the pipette tip after each sample is added. Turn on the electrophoresis apparatus, set it to 150V, and run for 20 minutes.
[0034] 2. Obtaining COQ2 fragments The COQ2 gene fragment was amplified by PCR using primer pair COQ2-F / R, and the fragment size was determined by gel electrophoresis. Figure 2 As shown, the fragment size is correct. The template was eliminated using DpnI enzyme, and the fragment was purified.
[0035] COQ2-F: atgtctccgagtcgttctactgt; COQ2-R: tcatgcaagctgcgggtgctgcg.
[0036] 3. Recombination reaction The linearized vector and the inserted fragment were mixed in proportion and reacted at 50°C for 5 min under Exnase catalysis, and then immediately placed on ice.
[0037] Optimal fragment amount for cloning vector = [0.02 × number of base pairs in cloning vector] ng (0.03 pmol) The optimal amount of cloning fragment used = [0.04 × number of base pairs in the cloning vector] ng (0.06 pmol) Note: The amount of insert fragment used should be greater than 20 ng. When the insert fragment length is greater than the cloning vector, the calculation methods for the optimal cloning vector and insert fragment usage should be interchanged, i.e., the insert fragment should be treated as the cloning vector, and the cloning vector should be treated as the insert fragment in the calculation.
[0038] 4. Transformation of recombinant products (1) Preparation of Escherichia coli DH5α competent cells: 1) Resuscitation and activation: DH5α glycerol bacteria (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) frozen at -80℃ were streaked onto LB agar plates and incubated overnight at 37℃ (12-16h) to obtain single colonies; 2) Primary culture: Pick a single colony and inoculate it into 5 mL of LB liquid medium. Incubate at 37°C with shaking at 200 rpm for about 3 hours until the OD reaches 0.3-0.4 (early logarithmic growth stage). Stop the culture immediately when the OD reaches 0.3-0.4. 3) Secondary culture: Inoculate the primary culture at a ratio of 1:100 (e.g., take 100 μL of primary culture) into a 500 mL Erlenmeyer flask containing 100 mL of LB liquid medium. Incubate at 37 °C with shaking at 200 rpm. Stop the culture immediately when the OD600 reaches 0.3-0.4 (early logarithmic growth stage).
[0039] 4) Cooling and collection: Dispense 100 mL of cooled bacterial culture into two 50 mL pre-chilled sterile centrifuge tubes, allowing the culture to cool to 4°C. Centrifuge at 4000 rpm for 10 minutes at 4°C, and discard the supernatant.
[0040] 5) CaCl2 treatment: Resuspend the bacterial cells in 10 mL of pre-cooled 0.1 M CaCl2 and incubate on ice for 30 min.
[0041] 6) Centrifuge at 4℃ and 4000rpm for 10 minutes, then discard the supernatant.
[0042] 7) The bacterial cells were resuspended in 4 ml of 0.1 M CaCl2.
[0043] 8) Dispense 100 μL / tube. Can be used directly for conversion or stored at -80°C.
[0044] (2) Transformation 1) Thaw the DH5α competent cells on ice; 2) Add 10 μL of recombinant product to 100 μL of competent cells, gently pipette to mix, and let stand on ice for 30 min; 3) After heat shock in a 42℃ water bath for 40 seconds, immediately place it on ice to cool for 2 minutes; 4) Add 900 μL of LB liquid culture medium (without antibiotics), and shake at 37°C and 220 rpm for 1 hour; 5) Preheat the LB solid medium containing ampicillin resistance in a 37°C incubator; 6) Centrifuge at 5000 rpm for 5 min, discard 900 μL of supernatant. Resuspend the bacteria in the remaining culture medium and spread it on a plate; 7) Incubate at 37 degrees Celsius for 12-16 hours.
[0045] 5. Identification of bacteria P from recombinant expression plasmids Select a healthy single colony and transfer it to a PCR tube containing 20 μL of ddH2O. Mix well by pipetting and use as a template. Amplify the sample using primer pair yz.AOX / COQ2-R. Then, determine the correct fragment size by gel electrophoresis. Figure 4 As shown, the fragment size is correct.
[0046] yz.AOX:GCTTACTTTCATAATTGCGAC COQ2-R: TCATGCAAGCTGCGGGTGCTGCG 6. Plasmid extraction: Take 2 mL of overnight cultured bacterial solution and add it to a 2 mL centrifuge tube. Centrifuge at 12000 rpm for 1 min and remove as much supernatant as possible. Take 600 μL of pre-cooled Buffer QLB (Rapid Lyse Mix has been added to Buffer QLB) and add it to the centrifuge tube containing bacterial precipitate. Vortex immediately for 30 s and incubate at room temperature for 3 min.
[0047] Transfer the entire solution from the previous step to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the filtrate. Place the adsorption column back into the collection tube, add 600 μL of Buffer QWB around the perimeter of the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the filtrate.
[0048] Place the adsorption column back into the collection tube, centrifuge at 12000 rpm for 1 min, place the adsorption column in a clean 1.5 mL centrifuge tube, add 60 μL of Buffer QEB to the center of the membrane of the adsorption column, centrifuge at 12000 rpm for 1 min, and send the obtained plasmid DNA solution to Qingke sequencing. If the result is correct, you can prepare for transformation. Store the plasmid at -20℃.
[0049] The pPICZAC plasmid was linearized by inverse PCR using primer pair Sac1 F / R, and the fragment size was determined by gel electrophoresis. Figure 5 As shown, the fragment size is correct. The template was eliminated using DpnI enzyme, and the fragment was purified.
[0050] Example 2: Transformation of Pichia pastoris GS115 1. Preparation of GS115 chemocompetents: (1) Activated strain GS115 (purchased from Shanghai Beyotime Biotechnology Co., Ltd.). The frozen strain was streaked on YPD solid medium and incubated at 30°C for 2 days.
[0051] (2) Pick a single colony of Pichia pastoris GS115 and inoculate it into 5 mL of YPD liquid medium. Incubate overnight at 200 rpm and 30 °C.
[0052] (3) The next day, it was transferred to 30 mL of YPD liquid culture medium and cultured until the OD600 was in the range of 0.5-0.6.
[0053] (4) Collect cells, take 1 mL of bacterial culture, centrifuge at 4000 rpm for 5 min, and remove the supernatant.
[0054] (5) The precipitate was resuspended in 1 mL of sterile deionized water. Centrifuged at 4000 rpm for 5 min and the supernatant was discarded.
[0055] (6) The precipitate was suspended in 100 μL of LiAc competent cell preparation solution. It was dispensed into a 50 μL tube for plasmid transformation.
[0056] Note: Competent cells should be prepared and used immediately or stored at 4 ℃ for no more than 12 hours.
[0057] 2. Chemical transformation of GS115 (1) Take a 1.5ml sterile centrifuge tube, add 2ug of linearized plasmid, 5μL of salmon extract, 50μL of GS115 competent cells, and 500μL of PEG / LiAc transformation solution, and gently invert and mix 6-8 times.
[0058] (2) Incubate at 30℃ for 30 min, gently turning and mixing 6-8 times every 10 min.
[0059] (3) Add 20 μL of DMSO.
[0060] (4) Heat shock at 42 ℃ for 15 min, gently turn and mix 6-8 times every 5 min.
[0061] (5) Centrifuge briefly at 12000 rpm and discard the supernatant. Add 1 ml of YPD Plus to each vial and revive at 30℃ and 200 rpm for 1 h.
[0062] (6) Centrifuge briefly at 12000 rpm, discard the supernatant, resuspend in 100 μL of 0.9% NaCl, spread on YPD plates containing zeocin resistance, screen for a concentration of 100 μL / mL, and incubate at 30℃ for 48-96 h.
[0063] Example 3: Identification of positive recombinants Pick several single colonies from the plates and add them to 20 μL of 20 mM NaOH solution. Treat at 95°C for 5 min, then freeze at -80°C for 1 h. After removing from the freezer, treat at 95°C for 5 min, and after a short centrifugation, use the supernatant as a template for PCR reaction.
[0064] The primers for colony PCR are as follows: SacI-F: GCTCATTCCAATTCCTTCTATTAGG COQ2-R: tcatgcaagctgcgggtgctgcg The colony PCR reaction system is shown in Table 4, and the PCR reaction procedure is shown in Table 2. Fragment size was determined by gel electrophoresis. Figure 5 As shown, the fragment size is correct.
[0065] Table 4 Colony PCR Reaction System Example 4: Fermentation-induced expression The successfully verified single colony was inoculated into 5 mL of YPD liquid medium and cultured at 30°C and 200 rpm for 12 h to obtain the seed culture. The bacterial culture from YPD was transferred to 50 mL of BMGY medium and cultured at 30°C in a shaker until the OD600 reached 2-6. The bacterial cells in BMGY were collected by centrifugation (4°C, 5000 rpm, 5 min), washed twice with sterile water (pre-cooled) and collected by centrifugation (4°C, 5000 rpm, 5 min), resuspended in 50 mL of BMMY medium, and 0.1 g of COQ0 was added. 0.5% methanol was added every 12 h, and the culture was carried out at 30°C and 200 rpm for 72 h.
[0066] Note: Be sure to check the volume of the culture and add methanol accordingly, as evaporation will reduce the culture volume.
[0067] The culture medium preparation method is as follows: YPD liquid medium: 1% Yeast Extract, 2% Peptone, 2% Dextrose (glucose) BMGY medium: 1% yeast extract, 2% peptone, 100mM potassium phosphate pH=6.0, 1.34% YNB, 4×10 -5Biotin, 1% glycerol; prepare 10×YNB stock solution, 500×Biotin stock solution, and 10×GY solution; then prepare 1M pH=6.0 potassium phosphate buffer by mixing 132mL of 1M K2HPO4 solution and 868mL of 1M KH2PO4 solution, adjusting the pH to 6.0±0.1 with phosphate or potassium hydroxide, autoclaving at 121℃ for 15min, and storing at room temperature; finally, dissolve 10g of yeast extract and 20g of peptone in 700ml of water, autoclave at 121℃ for 15min, cool to room temperature, and then add 100mL of 1M potassium phosphate buffer (pH=6.0), 100mL of 10×YNB stock solution, 2mL of 500×Biotin stock solution, and 100mL of 10×GY solution in sequence, mix thoroughly before use.
[0068] BMMY medium: The solution consisted of 1% yeast extract, 2% peptone, 100mM potassium phosphate (pH 6.0), 1.34% YNB, 4×10⁻⁵ biotin, and 1% methanol. Specifically, a 10×YNB stock solution (13.4g YNB dissolved in 100mL water, filtered sterile) and a 500×Biotin stock solution (20mg biotin dissolved in 100mL water, filtered sterile) were prepared, along with a 5% methanol solution (5mL methanol mixed with 95mL water, filtered sterile). Then, a 1M pH 6.0 potassium phosphate buffer was prepared by mixing 132mL of 1M K₂HPO₄ solution with 868mL of 1M potassium phosphate buffer. Mix the KH2PO4 solution, adjust the pH of the solution to 6.0±0.1 with phosphoric acid or potassium hydroxide, autoclave at 121℃ for 15 min, and store at room temperature; finally, dissolve 10g of yeast extract and 20g of peptone in 700ml of water, autoclave at 121℃ for 15 min, cool to room temperature, and then add 100mL of 1M potassium phosphate buffer (pH=6.0), 100mL of 10×YNB stock solution, 2mL of 500×Biotin stock solution, and 100mL of 5% methanol solution in sequence, mix thoroughly before use.
[0069] Example 5: Extraction and verification of products from fermentation cells The fermentation products of Pichia pastoris were identified using liquid chromatography-mass spectrometry (HPLC-MS). The specific procedures are as follows: Sample preparation: Take 2 mL of fermentation material, centrifuge at 5000 rpm for 5 min. Since the fermentation material is an intracellular product, discard the supernatant directly. Add 2 mL of anhydrous ethanol to the lower layer of cells and sonicate at 50℃ and 50 kHz for 1 h, inverting the sample every 15 min. Transfer 1 mL of the solution through a 0.22 μm organic filter membrane to a liquid chromatography vial.
[0070] The high-performance liquid chromatography (HPLC) conditions were as follows: Zorbax SB-C column.18 (4.6×250 mm, 5 μm), flow rate 1 mL / min, injection volume 20 μL, UV detection wavelength 254 nm, gradient elution method, the mobile phase consists of water (phase A, ultrapure water adjusted to pH=3 with trifluoroacetic acid) and acetonitrile (phase B), the gradient elution ratio is shown in Table 5.
[0071] Table 5 Mass spectrometry conditions: Positive mode voltage 2 kV; ion source temperature 110℃; desolvation temperature 400℃; nitrogen flow rate: 800 L / h; mass number range 50-1200; collision voltage: 20-40 V; Negative mode voltage 2 kV; ion source temperature 110℃; desolvation temperature 400℃; nitrogen flow rate: 800 L / h; mass number range 50-1200; collision voltage: 20-40 V.
[0072] The fermentation cells were analyzed using a liquid chromatography-mass spectrometry (LC-MS) system to obtain the following chromatograms: Figure 7 As shown, material analysis was performed on each peak, and the elution time of the fermentation product was finally determined to be 20.798 min. The main peak solution was collected and its components were analyzed, and the target product was finally determined to be COQ3.
Claims
1. A method for exogenous expression of COQ3 in recombinant Pichia pastoris engineered strains, characterized in that, Includes the following steps: The COQ2 gene sequence was constructed into plasmid pPICZA to obtain recombinant plasmid pPICZAC. Recombinant plasmid pPICZAC was inserted into the genome of Pichia pastoris GS115 to obtain recombinant Pichia pastoris engineered strain. The recombinant Pichia pastoris engineered strain was fermented with methanol using the inducible promoter PAOX1 to obtain the intracellular product COQ3.
2. The method for exogenous expression of COQ3 by recombinant Pichia pastoris engineered strain according to claim 1, characterized in that, The COQ2 gene sequence was constructed into plasmid pPICZA to obtain recombinant plasmid pPICZAC, which specifically includes: First, using the empty pPICZA plasmid as a template, the linearized vector was amplified by reverse PCR to obtain the pPICZA fragment. The COQ2 gene sequence was amplified by PCR using the primer pair COQ2-F / R. The fragment size was checked by gel electrophoresis. The template was eliminated with DpnI enzyme and purified. The COQ2 gene was inserted into the pPICZA plasmid using a one-step cloning kit to obtain the recombinant plasmid pPICZAC.
3. The method for exogenous expression of COQ3 in recombinant Pichia pastoris engineered strains according to claim 2, characterized in that, The primer pair COQ2-F / R is as follows: COQ2-F: atgtctccgagtcgttctactgt; COQ2-R: tcatgcaagctgcgggtgctgcg.
4. The method for exogenous expression of COQ3 by recombinant Pichia pastoris engineered strain according to claim 2, characterized in that, The recombinant plasmid pPICZAC was inserted into the Pichia pastoris GS115 genome, specifically including: First, Pichia pastoris GS115 chemically competent cells were prepared. After linearizing the recombinant plasmid pPICZAC, it was added to the Pichia pastoris GS115 chemically competent cells, and recombinant Pichia pastoris engineered strains were obtained through homologous recombination.
5. The method for exogenous expression of COQ3 by recombinant Pichia pastoris engineered strain according to claim 2, characterized in that, The recombinant Pichia pastoris engineered strain was used to obtain the intracellular product COQ3 by fermentation with the inducible promoter PAOX1 and methanol, specifically including: Recombinant Pichia pastoris engineered strains were inoculated into YPD liquid medium to obtain a seed culture; the seed culture was then transferred to BMGY medium for cultivation. After cultivation, the bacterial cells in the BMGY medium were collected by centrifugation and washing; subsequently, the bacterial cells were resuspended in BMGY medium, and COQO was added. Methanol was added every 10–14 h for further cultivation. During the culture process, the product COQ3 was obtained by fermentation using the inducible promoter PAOX1.
6. The method for exogenous expression of COQ3 in recombinant Pichia pastoris engineered strains according to claim 5, characterized in that, The ratio of COQ0 to BMMY culture medium is 0.09~0.11g:50mL.
7. The method for exogenous expression of COQ3 in recombinant Pichia pastoris engineered strains according to claim 5, characterized in that, The volume ratio of methanol to BMMY medium added each time is 0.4~0.8:100.