A molecular marker associated with immune traits in sheep and use thereof

Abstract

The application provides a molecular marker related to sheep immunity traits and application thereof. The application uses a method for detecting a PLEKHH2 gene SNP site of Lake sheep by combining DNA pool sequencing with KASPar technology. A primer is designed according to a PLEKHH2 gene sequence, DNA is extracted from sheep blood, and PCR amplification, DNA sequencing and sequence analysis are carried out, so that a C / G polymorphic site at the 368th position of the amplified fragment is found. Further, KASPar primers are used to detect the polymorphic site of 889 Lake sheep and to establish a least square model, and correlation analysis is carried out on the genotype and immunity trait indexes, so that it is found that the site is significantly related to the platelet count (PLT) and the mean corpuscular hemoglobin concentration (MCHC) of sheep. Through detection of the molecular marker of the application, the application can be used in marker-assisted disease-resistant breeding of sheep and can accelerate the breeding process of sheep.

Description

Technical Field

[0001] This invention belongs to the field of sheep molecular marker screening and application technology, specifically involving the PLEKHH2 gene polymorphism as a molecular marker affecting sheep immune traits, its detection methods and applications. Background Technology

[0002] In sheep farming, diseases not only reduce sheep productivity but can also lead to mass sheep deaths, causing significant economic losses to the sheep industry. Currently, against the backdrop of a global ban on antibiotics, disease control still relies primarily on vaccination and drug treatment. However, these measures cannot completely solve the problem of sheep diseases. Extensive use of drugs can lead to the development of drug resistance and may also pose potential risks to the quality and safety of livestock products due to drug residues (Ahmed et al. 2020; Iramiot et al. 2020). Furthermore, the increasing proportion of intensive, large-scale sheep farming places higher demands on sheep's disease resistance under crowded feeding and management conditions. Therefore, there is an urgent need to fundamentally enhance sheep's disease resistance through genetic breeding measures. However, many difficulties remain in directly improving disease resistance. This can be indirectly improved by selecting immune indicators, and with the development of molecular biology techniques, marker-assisted selection (MAS) has been widely applied in livestock and poultry breeding.

[0003] As a primary herbivore, sheep are increasingly valued for disease resistance breeding. Hematological characteristics in mammals consist of three components: white blood cells, red blood cells, and platelets, which are important indicators of animal immune function, disease resistance, and overall health (Dal Colletto et al., 1993) (Wang et al., 2022). Understanding the genetic background and control of variation in these traits will contribute to disease detection, germplasm utilization, and breeding improvement. To date, research on candidate genes and quantitative trait loci (QTLs) for hematological parameters has been limited to humans (Vasquez et al., 2016) and some important farm animals, including pigs (Bovo et al., 2019; Zhao et al., 2011; Jung et al., 2014; Luo et al., 2012), cattle (Chipmunk-Vargas et al., 2020; Hu et al., 2019), and poultry (Sun et al., 2016). However, candidate genes and QTLs relevant to sheep hematological trait research are still in their infancy.

[0004] PLEKHH2 is a cytoplasmic protein in the G protein-coupled receptor signaling pathway, highly enriched in glomerular podocytes, and associated with the development of several human immune diseases, such as diabetic nephropathy (DN) (Greene et al., 2008) and focal segmental glomerulosclerosis (Perisic et al., 2012). Interestingly, PLEKHH2 has also been identified as differentially expressed in peripheral tissue fibroblasts of healthy individuals and patients with schizophrenia (Etemadikhah et al., 2020). However, in farm animals, no association between the PLEKHH2 gene and performance or immunophenotype has been reported, and it is unclear whether or how the PLEKHH2 gene is related to immune capacity. Therefore, this invention uses the PLEKHH2 gene as a candidate gene and, through PCR amplification, DNA sequencing, and sequence analysis, explores the association between different genotypes and immune-related traits in sheep, aiming to provide a new molecular marker for improving disease resistance in sheep. Summary of the Invention

[0005] In response to the current problems of the extensive use of drugs and vaccines in sheep farming, the purpose of this invention is to provide a molecular marker related to sheep immune traits, its detection method, and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention provides a molecular marker associated with sheep immune traits. This molecular marker is obtained by amplifying the sheep PLEKHH2 gene. Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where the S at position 368 bp represents C or G. Because there is a C / G mutation at position 368 of the above sequence, the sheep PLEKHH2 gene exhibits C / G polymorphism at this site.

[0008] A primer pair for detecting the above-mentioned molecular markers, comprising a forward primer F and a reverse primer R, wherein the nucleotide sequence of the forward primer F is shown in SEQ ID NO.2 and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.3.

[0009] The KASPar primer pair used to detect the above molecular markers includes forward primer AX, forward primer AY, and reverse primer C. The nucleotide sequence of forward primer AX is shown in SEQ ID NO.4, the nucleotide sequence of forward primer AY is shown in SEQ ID NO.5, and the nucleotide sequence of reverse primer C is shown in SEQ ID NO.6.

[0010] A detection kit for detecting the above-mentioned molecular markers, the detection kit comprising primer pairs or KASPar primer pairs for detecting the above-mentioned molecular markers.

[0011] A method for detecting molecular markers associated with immune traits in sheep, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the base S at position 368 bp represents C or G, the method comprising detecting sheep whole blood genomic DNA using the primer pairs or detection kit described above.

[0012] Specifically, the method includes amplifying sheep whole blood genomic DNA using primer pairs or KASPar primer pairs as described above, or a kit as described above; and identifying the polymorphic sites of the obtained amplification products by typing.

[0013] Preferably, the typing and identification methods are direct sequencing, probe method, gene chip method and KASP genotyping technology.

[0014] Furthermore, the method for detecting molecular markers related to sheep immune traits using the above primer pairs includes the following steps:

[0015] S1. Genomic DNA was extracted from sheep whole blood. The extracted genomic DNA was then amplified by PCR using primer pairs as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0016] S2. Sequencing and sequence analysis of the PCR amplification products were performed to determine the genotype of the polymorphic sites.

[0017] Furthermore, this invention also relates to a method for detecting molecular markers associated with sheep immune traits using KASPar primer pairs, comprising the following steps:

[0018] a) Genomic DNA was extracted from sheep whole blood samples and amplified by high-throughput water bath PCR using primers shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

[0019] b) After amplification, KASP genotyping technology was used, and fluorescence signals were detected and genotyping results were viewed using a BMG PHERAstar instrument.

[0020] This invention also provides the application of molecular markers related to sheep immune traits, primer pairs or detection kits or detection methods for detecting molecular markers related to sheep immune traits in sheep-assisted breeding. By using the primer pairs or kits of this invention to amplify and detect the PLEKHH2 gene, the genotype of the sample to be tested can be determined, thereby enabling the selection of sheep breeds with better immunity.

[0021] The application described above is preferably used in sheep breeding. The purpose of this breeding is to select sheep breeds with high immunity.

[0022] The beneficial effects of this invention are as follows:

[0023] This invention provides a molecular marker associated with sheep immune traits, and also provides primer pairs, detection kits, or detection methods for detecting this molecular marker in the detection of sheep immune traits. By using the primer pairs or kits of this invention to amplify and detect the PLEKHH2 gene, the genotype of the sample to be tested can be determined, thereby enabling the selection of sheep breeds with strong immunity. This provides an effective detection method for breeding highly immune and healthy sheep. This invention, through the detection of molecular markers and polymorphic sites, can be used to select GG homozygous sheep for breeding, thereby improving sheep immunity and contributing to increased economic benefits in sheep farming. Attached Figure Description

[0024] Figure 1 This is a gel electrophoresis result of the amplification of the sheep PLEKHH2 gene fragment.

[0025] Figure 2 This is the sequencing result of the sheep PLEKHH2 gene mutation site in this invention.

[0026] Figure 3 The results of KASPar SNP typing of the g.38384C>G mutation site in the sheep PLEKHH2 gene in this invention. Detailed Implementation

[0027] This invention involves PCR amplification, sequencing, and analysis of the PLEKHH2 gene. Using 889 Hu sheep as the experimental population, the association between different genotypes in the PLEKHH2 gene and immune trait indicators was analyzed. Genotypes favorable for immune traits were screened, and a molecular marker associated with sheep immune traits was developed. This provides a basis for marker-assisted breeding of sheep immune traits, offers genetic material for promoting sheep genetic improvement, and accelerates the breeding of high-quality meat sheep. The results revealed a C / G polymorphism at position 368 of the amplified fragment. By detecting the polymorphism in 889 Hu sheep and establishing a least-squares model, a molecular marker associated with sheep immune traits was identified. This molecular marker can provide an effective genetic engineering tool for genetic improvement of sheep trait development and has certain practical application value.

[0028] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0029] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0030] Example 1

[0031] (1) Primer design

[0032] Using sheep PLEKHH2 gene DNA (GenBank accession number: NC_056056.1) as a template, a pair of primers, including forward primer F and reverse primer R, was designed using Oligo 7.0 software. The primer sequences are as follows.

[0033] Forward primer F (SEQ ID NO.2): 5'-TTGGCACAAATAGAAACGC-3', Reverse primer R (SEQ ID NO.3): 5'-GTTTTATCAGTAATAAAGGCAAC-3'

[0034] (2) Amplification and sequencing of the PLEKHH2 gene

[0035] The PCR reaction system was prepared using a total volume of 25 μL, including 1 μL of DNA template, 0.8 μL of forward primer F (10 μmol / L), 0.8 μL of reverse primer R (10 μmol / L), 12.4 μL of 2×PCR Master Mix, and 10 μL of ddH2O. Genomic DNA was extracted from sheep blood and used as a DNA template for PCR amplification.

[0036] The conditions for PCR amplification are:

[0037] Pre-denaturation at 94℃ for 5 minutes;

[0038] 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, cycled 35 times;

[0039] Finally, extend at 72°C for 5 minutes.

[0040] The PCR amplification products obtained above were detected by electrophoresis on a 1.5% agarose gel. Figure 1 As shown, the results yielded an amplified fragment of 477 bp. The sequencing results were analyzed using Chormas (v2.3.0.0) and DNAMAN (6.0.3.99) software. See the sequencing results below. Figure 2 The specific nucleotide sequence is shown in SEQ ID NO.1. A polymorphic site exists within this 368 bp fragment, specifically where the S at position 368 bp is mutated from C to G. This means that the amplified PLEKHH2 gene fragment exhibits a C / G polymorphism at position 368 bp. This site is located at position 38384 in the NC_056056.1 sequence, i.e., g.38384C>G (see [link to SEQ ID NO.1]). Figure 2), where SEQ ID NO.1:

[0041] TTGGCACAAATAGAAACGCTATAAGCATGATACGGCCACTGAGACCTCAGGAAACAGATCTTGATCTCGTTGATGGCGACAATACAGAAATTTTAGAGACTATGGACACTAATTGTGATGATGGATTATTTTCCTACGACTGCTTGGAATCCCCATGTTCAGAGGACCAGGAAGCCTGCGACTTGGCAAAGAAAGCAGCCTGTGGCAAACCTCCAACTCCACCTCTGCACCGGTTTCCC TCTTGGGTAAATTATGTTGCTGTGTGCAGTGCGCACACGTTTGTTTTCTCTCAGCACTCATTTTCAGGTTTTACTTTACTTTCTTTTCCTGTTTCTTTTCCACTCCAGCTTTGTTCTGACAATTCCCASTTTTTAGAATTCAGTTTTCCCTTCTCTTTTCCTCTGAATCAGTTGAGAAATAAGACACAAGGGTAAGACAAACAGGAGATCTAGATGTTGCCTTTATTACTGATAAAAC.

[0042] DNA sequence homology retrieval and identification:

[0043] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using BLAST software from the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a partial sequence of the sheep PLEKHH2 gene DNA (GenBank accession number: NC_056056.1).

[0044] Example 2: Establishment of a genotyping detection method

[0045] (1) Primer sequence design

[0046] KASPar primer pairs were designed for the C / G polymorphism site of the amplified fragment in Example 1, for the specific detection of this polymorphism site. The nucleotide sequence of the KASPar primer pairs is as follows:

[0047] The forward primer AX used for detecting AlleleX has the nucleotide sequence shown in SEQ ID NO.4.

[0048] SEQ ID NO.4: GAAGGTGACCAAGTTCATGCTCAGCTTTGTTCTGACAATTCCCAC;

[0049] The forward primer AY used to detect AlleleG is shown in SEQ ID NO.5.

[0050] SEQ ID NO.5: GAAGGTCGGAGTCAACGGATTCAGCTTTGTTCTGACAATTCCCAG;

[0051] Universal reverse primer C, as shown in SEQ ID NO.6,

[0052] SEQ ID NO. 6: GAGGAAAAGAGAAGGGAAAACTGAATTC.

[0053] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of primer AX: primer AY: primer C of 12:12:30 for later use.

[0054] (2) DNA quality control

[0055] The quality of genomic DNA extracted from sheep whole blood was tested using 1% agarose gel electrophoresis and Nanodrop 2100. Acceptable DNA samples met the following criteria: 1. Agarose gel electrophoresis showed a single DNA band without significant dispersion; 2. Nanodrop 2100 A260 / 280 ratio was between 1.8 and 2.0 (indicating no protein contamination in the DNA sample); 3. A260 / 230 ratio was between 1.8 and 2.0 (indicating low salt ion concentration in the DNA sample); 4. No significant light absorption at 270 nm (indicating no phenol contamination in the DNA sample).

[0056] Based on the KASP detection technology and genome size calculation from LGC UK, the required DNA dosage is 10–20 ng / sample, and the DNA template concentration is diluted to 10–20 ng / μL for later use.

[0057] (3) Genotyping

[0058] First, using a K-pette dispensing workstation, 1.5 μL of diluted whole blood DNA template and a blank control (NTC using water as the template) were added to separate 384-well reaction plates. The plates were then dried at 60°C for 30 min (using an LGC drying oven) until the DNA became a dry powder. Next, using a Meridian dispensing workstation under the Kraken operating system, 1×Master mix (part no. KBS-1016-011 for 1536-well microplates) and primer mixture were added to each well. Immediately after mixing, the microplates were sealed using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler high-throughput water bath system. The specific procedure was as follows:

[0059] Pre-denaturation at 94℃ for 15 minutes;

[0060] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplify in touch-down order for 10 cycles, decreasing the temperature by 0.6℃ per cycle;

[0061] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.

[0062] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3 As shown in the figure, each dot represents a sample to be tested. The red (dark gray) dots near the upper left indicate a homozygous genotype "GG"; the blue (dark gray) dots near the right indicate a homozygous genotype "CC"; the light green dots near the center indicate a heterozygous genotype "GC" or "CG"; and the black dots indicate NTC (Neutral Toxic / ... Figure 3 (If it cannot be displayed), it is a blank control.

[0063] (4) Application of the molecular markers of the present invention in the correlation analysis of hematological parameters in sheep

[0064] The polymorphism of 889 Hu sheep was detected using the above method, their genotypes were determined, and association analysis between genotype and immune traits was performed. A least-squares model was established as described below to conduct association analysis between genotype and immune traits.

[0065] Y ijk =μ+G i +B j +S k +ε ijk,

[0066] Y imjkl=μ+G i +G m +B j +S k +C l +ε imjkl

[0067] Among them, Y ijk and Y imjkl These are the raw numerical data of hematological traits, where μ is the population mean and G is the mean. i and G m For the genotypic effects of the i and m digits, B j For the birthplace effect, S k Due to seasonal effects, C l This is a genotype combination effect, ε ijk and ε imjkl For residuals, when the linear model indicates significant differences between genotypes, the least significant difference (LSD) is used to assess the differences.

[0068] Hematological parameters measured in sheep at 180 days of age using a hematological analyzer (ProCyte Dx, IDEXX, Westbrook, ME, USA) were evaluated using a linear regression model to assess the effect of the molecular marker PLEKHH2g.38384C>G on hematological traits in 180-day-old sheep. Association analysis was performed in R soft, and genotyping was conducted using the KASPar method. The results showed that among 889 individuals, there were 519 individuals with the GG genotype, 79 individuals with the CG genotype, and 291 individuals with the CC genotype. The results of the association analysis between genotype and traits are shown in Table 1 below. In the table, RBC represents red blood cell count (M / uL); HGB represents hemoglobin concentration (g / dL); HCT represents hematocrit (%); MPV represents mean platelet volume (fL); PLT represents platelet count (K / uL); WBC represents white blood cell count (K / uL); LYMPH represents... Lymphocyte count (K / uL); MONO (monocyte count, K / uL); EO (eosinophil count, K / uL); NEUT (neutrophil count, K / uL); BASO (basophil count, K / uL); MCHC (mean corpuscular hemoglobin concentration, g / dL); MCV (mean corpuscular volume, fL); MCH (mean coronary hemoglobin, pg); RDW_SD (standard deviation of mean corpuscular volume distribution width, fL); RDW_CV (coefficient of variation of mean corpuscular volume distribution width, %).

[0069] Table 1. Association analysis of PLEKHH2 gene polymorphism and some immune traits in sheep.

[0070]

[0071] Note: Different lowercase superscripts in the same row indicate significant differences (P<0.05), while the same superscript indicates no significant differences (P>0.05).

[0072] Detailed hematological parameters of 889 animals were obtained. Results showed that all sheep's hematological parameters remained within the normal range, which will not be elaborated upon here for brevity. Platelets are generally considered cellular mediators of thrombosis, but they are also an important component of the immune system, playing a direct role in regulating and inducing tissue damage and pathogen responses. Normal or high hemoglobin levels indicate abundant iron in the body. Low hemoglobin levels indicate iron deficiency, which in turn affects hemoglobin synthesis and oxygen-carrying capacity, leading to anemia and hindering normal physiological activities in animals. Furthermore, the results in the table above show that the C / G polymorphism site at position 368 of the PLEKHH2 g.38384C>G mutation site (i.e., position 368 of the amplified fragment SEQ ID NO. 1) was significantly correlated with platelet count (PLT) and mean corpuscular hemoglobin concentration (MCHC) (P<0.05). Specifically, sheep carrying the GG genotype had significantly higher PLT and MCHC than those carrying the CG and CC genotypes. Therefore, the PLEKHH2g.38384C>G mutation site can serve as a potential molecular marker affecting sheep's immune traits. Selecting the GG genotype can improve the immune performance of individual sheep and provide a detection technique for identifying sheep with high immune performance in breeding.

Claims

1. The application of a primer pair for detecting molecular markers associated with immune traits in Hu sheep in assisted breeding of Hu sheep, characterized in that, It includes a forward primer F and a reverse primer R. The nucleotide sequence of the forward primer F is shown in SEQ ID NO.2, the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.3, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The S at position 368 bp represents C or G. This mutation leads to the C / G polymorphism of the PLEKHH2 gene of Hu sheep at this site. Among them, the PLT and MCHC of Hu sheep carrying the GG genotype are significantly higher than those of individuals with the CG and CC genotypes. The application is to select Hu sheep breeds with high immunity.

2. The application of KASPar primer pairs for detecting molecular markers associated with immune traits in Hu sheep in assisted breeding of Hu sheep, characterized in that, It includes forward primers AX and AY, and reverse primer C. The nucleotide sequence of forward primer AX is shown in SEQ ID NO.4, the nucleotide sequence of forward primer AY is shown in SEQ ID NO.5, and the nucleotide sequence of reverse primer C is shown in SEQ ID NO.

6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where S at position 368 bp represents C or G. This mutation leads to C / G polymorphism in the PLEKHH2 gene of Hu sheep at this site. Among them, the PLT and MCHC of Hu sheep carrying the GG genotype are significantly higher than those of individuals with the CG and CC genotypes. The application is to select Hu sheep breeds with high immunity.

3. The application of a detection kit for detecting immune traits associated with Hu sheep in assisted breeding of Hu sheep, characterized in that, The detection kit includes primer pairs as shown in SEQ ID NO.2 and SEQ ID NO.3 or SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where the S at position 368 bp represents C or G. This mutation leads to C / G polymorphism in the PLEKHH2 gene of Hu sheep at this site. Among them, the PLT and MCHC of Hu sheep carrying the GG genotype are significantly higher than those of individuals with the CG and CC genotypes; the application is to select Hu sheep breeds with high immunity.

4. The application of a method for detecting molecular markers associated with immune traits in Hu sheep in assisted breeding of Hu sheep, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where the base S at position 368 bp represents C or G. The method includes amplifying and detecting whole blood genomic DNA of Hu sheep using primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 or SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; identifying the polymorphic sites of the obtained amplification products; wherein, the PLT and MCHC of Hu sheep carrying the GG genotype are significantly higher than those of individuals with the CG and CC genotypes; the application is to select Hu sheep breeds with high immunity.

5. The application as described in claim 4, characterized in that, The typing and identification methods include direct sequencing, probe method, gene chip method, and KASP genotyping technology.

6. The application as described in claim 4, characterized in that, The method includes the following steps: S1. Genomic DNA was extracted from whole blood of Hu sheep. The extracted genomic DNA was then amplified by PCR using primer pairs as shown in SEQ ID NO.2 and SEQ ID NO.

3. S2. Sequencing and sequence analysis of the PCR amplification products were performed to determine the genotype of the polymorphic sites.

7. The application as described in claim 5, characterized in that, The process includes the following steps: a) Genomic DNA was extracted from whole blood of Hu sheep and amplified by high-throughput water bath PCR using primers shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; b) After amplification, KASP genotyping technology was used to detect fluorescence signals and view the genotyping results.

Images