A method for identifying genetic information related to wheat grain protein content
By using genome-wide association analysis and the SNP marker Whaas53100, the problem of stable identification and screening of protein content under various environments in wheat breeding was solved, achieving efficient breeding process and quality improvement.
Patent Information
- Application Number
- CN202310303996.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-27
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2043-03-27
AI Technical Summary
Existing technologies make it difficult to effectively utilize genome-wide association analysis (GWAS) in wheat breeding to stably identify and screen wheat grain protein content under various environments, resulting in a narrow genetic background and limited applicability of QTL results.
Using genome-wide association analysis, a tightly linked SNP marker, Whaas53100, located at 260,492,627 bp on the wheat 3AS chromosome was identified from 207 collected wheat materials. The A/G polymorphism at the site was used to identify wheat materials with high or low protein content, and the molecular marker qGPC3A.1 was provided for breeding.
This study enabled stable identification and screening of wheat grain protein content under various environments, providing new marker resources and improving the efficiency and quality of wheat breeding, especially the breeding of wheat varieties with high and low protein content.
Smart Images

Figure CN116287407B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for identifying genetic information related to the protein content of wheat grains, belonging to the field of wheat molecular breeding technology. Background Technology
[0002] Protein content in wheat grains is a primary evaluation criterion for classifying high-quality specialty wheat. Different uses of wheat have different protein content requirements. Generally, high-quality biscuit wheat requires a relatively low protein content (<12%), high-quality bread requires a relatively high protein content (≥14%), steamed buns and noodles are suitable for a protein content of approximately 12%-13% (He et al., 2004), and wheat used for brewing soy sauce-flavored baijiu (Chinese liquor) requires a protein content of 12-14%. Therefore, strengthening basic research on wheat grain protein content is of great significance for cultivating high-quality specialty wheat varieties.
[0003] Wheat grain proteins can be classified according to their solubility into albumin (soluble in water), globulin (soluble in dilute salt solutions), gliadin (soluble in ethanol solutions (70%)), and glutenin (soluble in dilute acid or alkali solutions). Gliadin and glutenin are the main components of wheat grain protein, accounting for approximately 80% of its content, and are key factors affecting wheat processing quality (Shewry et al., 2009). They interact in certain proportions and quantities, imparting elasticity, viscosity, and extensibility to dough. Studies have shown that glutenin content is significantly positively correlated with dough formation time, sedimentation value, bread volume, and bread score; gliadin content is significantly positively correlated with wet gluten content, but has a negative effect on dough stability time and maximum tensile resistance (Liu et al., 2005; He et al., 2005).
[0004] Current research on protein content largely focuses on QTL analysis using markers such as SSRs with limited coverage in segregating populations based on parental data. This approach results in narrow genetic backgrounds and identifies QTLs that function only in a limited number of materials. With the gradual refinement of the whole genome sequences of wheat and its closely related species, and the development of high-density SNP markers, genome-wide association analysis (GWAS) has become a research hotspot for gene mapping and mining of important wheat traits. GWAS requires collecting different types of wheat materials to construct associated populations. Compared to genetic populations based on parental data, it offers advantages such as a wider variety of varieties and a greater range of variation. Furthermore, wheat materials in associated populations are relatively stable, allowing for continuous measurement of target traits at multiple locations over several years. The significantly associated loci and genes identified are more widely applicable and stable than QTLs identified using genetic populations.
[0005] Therefore, this application utilizes 207 wheat materials collected from both domestic and international sources for genome-wide association analysis to identify loci and genes that are stably linked to wheat grain protein content under various environments. Compared with QTLs identified using genetic populations in previous studies, this approach has broader applicability and provides technical support and theoretical basis for further promoting the breeding of high and low protein content wheat, as well as improving the quality of flour products and liquor brewing. Summary of the Invention
[0006] The purpose of this application is to provide a molecular marker qGPC3A.1 (tightly linked marker Whaas53100) that can be used for breeding wheat varieties with high and low protein content, providing a theoretical basis and new marker resources for the breeding of wheat varieties with high and low protein content. The technical solution adopted in this application is detailed below.
[0007] This invention provides a major-effect QTL for controlling the protein content of wheat grains, wherein the major-effect QTL is qGPC3A.1.
[0008] This invention also provides the application of the above-mentioned major-effect QTLs in wheat breeding.
[0009] In one embodiment, the application includes breeding wheat with high protein content or breeding wheat with low protein content.
[0010] This invention also provides the application of the main-effect QTLqGPC3A.1 in the identification of protein content in wheat grains.
[0011] The present invention provides an SNP marker closely linked to the above-mentioned major QTL, the SNP marker being Whaas53100, the nucleotide sequence of which is shown in SEQ INNO:1, the 36th base from the 5' end being either A or G.
[0012] In one implementation, when the Whaas53100 genotype is AA, the wheat grain trait is characterized by high protein content; when the genotype is GG, the wheat grain trait is characterized by low protein content.
[0013] In one implementation, when the Whaas53100 genotype is AA, its nucleotide sequence is shown in SEQ INNO:2.
[0014] In one implementation, when the Whaas53100 genotype is GG, its nucleotide sequence is shown in SEQ INNO:3.
[0015] This invention provides the application of the above-mentioned SNP markers in assisted breeding.
[0016] In one embodiment, the application includes breeding or screening wheat plants, lines, strains, or varieties with relatively high protein content.
[0017] In one embodiment, the application includes breeding or screening wheat plants, lines, strains, or varieties with relatively low grain protein content.
[0018] This invention provides the application of the above-mentioned SNP markers in identifying or assisting in the identification of protein content in wheat grains.
[0019] In one embodiment, the application involves performing whole-genome sequencing on collected wheat grains and then using 660K chip technology to analyze the genotype of the aforementioned SNP marker Whaas53100.
[0020] In one implementation, when the Whaas53100 genotype is AA, the wheat grain trait is characterized by high protein content; when the genotype is GG, the wheat grain trait is characterized by low protein content.
[0021] This invention provides the application of the above-mentioned SNP markers in comparing the protein content of wheat grains.
[0022] Beneficial effects:
[0023] This invention utilizes a mixed linear model (MLM) to perform genome-wide association analysis (GWAS) on protein content in wheat grains from associated populations under different environments (2017-2018, 2018-2019, and 2019-2020), identifying a QTL qGPC3A.1 associated with protein content in wheat grains. Its tightly linked SNP marker is Whaas53100. Its nucleotide sequence is shown in SEQ INNO:1: CGTGATATTCACTCGCGGCACCGAAGCCGCCGACT[A / G]GTATCTTTCAGAACGAACGTACAACCACACAGGAG. A polymorphic site with an A / G allele mutation exists at base 36 of this sequence. According to the Chinese spring reference genome sequence information, this significant SNP marker is located at nucleotide 260,492,627 on chromosome 3AS. Genotypic data of wheat materials in associated populations were identified using the Whaas53100 polymorphism. Association analysis, combined with phenotypic data on grain protein content, revealed significant differences in wheat grain protein content among different alleles. When the Whaas53100 genotype was AA, the wheat grain protein content was higher; when the genotype was GG, the wheat grain protein content was lower. In summary, Whaas53100_AA is a favorable allele for increasing wheat grain protein content.
[0024] Compared to existing technologies, this invention utilizes genome-wide association analysis to identify a marker on wheat chromosome 3AS that is significantly correlated with grain protein content. Sequence analysis revealed an A / G allelic polymorphism site at position 36. This marker can be used to effectively identify common wheat materials, including local varieties, historical cultivars, modern cultivars, and key breeding parents. Whaas53100 in this invention can be used for screening and identifying protein content in early generations of wheat breeding, providing a new marker resource and application value for further improving wheat processing quality and breeding high-quality wheat varieties. Attached Figure Description
[0025] Figure 1 The phenotypic data of protein content in related wheat populations grown under different environments are normally distributed. Among them, the wheat was grown in Yuanyang County, Henan Province (YY) Modernization Research and Development Base in 2017-2018, 2018-2019 and 2019-2020. BLUE is the best linear unbiased estimate calculated under different environments.
[0026] Figure 2 Manhattan plot showing genome-wide association analysis of protein content in grains of wheat from associated populations grown in Yuanyang County, Henan Province, in 2017-2018. The red dashed line represents -log 10 The threshold line is P=4; the red dot and black arrow point to the significant marker Whaas53100 identified in this invention, which is located on the wheat 3AS chromosome.
[0027] Figure 3 This graph compares the protein content of wheat grains among different allelic genotypes under different environments using the Whaas53100 marker. Blue indicates genotype AA, and orange indicates genotype GG. The differences in protein content among different genotypes in wheat grains reached a highly significant level. Detailed Implementation
[0028] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following embodiments are commercially available or can be prepared by known methods.
[0029] Example 1
[0030] The protein content in grains of associated populations under different environments was determined using a near-infrared spectroscopy analyzer, and descriptive statistical analysis was performed on the calculated protein content under different environments. Genome-wide association analysis was conducted using the wheat 660K chip to analyze the genotype data of wheat materials from the associated populations, combined with the phenotypic data of protein content in wheat grains from the populations under different environments. This identified key genes and loci controlling protein content, providing genetic resources and a theoretical basis for the breeding of high-quality new wheat varieties. The specific experimental steps are as follows:
[0031] 1. Phenotypic Data Analysis
[0032] The protein content (%) in grains of 207 common wheat materials, including local varieties, historical cultivars, modern cultivars, and breeding parents, was determined using an IM9500 multi-functional near-infrared analyzer (Perten). Each sample was tested three times, and the average protein content in the wheat materials of the associated population under different environments was calculated (Table 1). Descriptive statistical analysis of the protein content in the grains of the associated population measured under different environments was performed using IBM SPSS Statistics 22. The results showed that the protein content in the grains of wheat materials planted in different years generally followed a normal distribution. Figure 1 The average protein content ranged from 13.28% to 14.65%. Specifically, the protein content in wheat grains planted in 2017-2018, 2018-2019, and 2019-2020 was 8.80%-16.07%, 9.90%-17.30%, and 12.10%-18.80%, respectively. The BLUE (Best linear unbiased estimate) of protein content in wheat grains calculated under different environments ranged from 10.45% to 15.90%, with an average of 13.43%. These results indicate that the wheat materials in the associated population exhibit broad phenotypic diversity, making them suitable for further association analysis.
[0033] Table 1. Phenotypic data of protein content in wheat materials from related populations under different environments.
[0034]
[0035]
[0036]
[0037]
[0038]
[0039] 2. Genome-wide association analysis
[0040] Genotyping of wheat materials from associated populations was performed using the wheat 660K SNP chip, and effective SNPs in the associated populations were screened and identified, yielding a total of 224,706 marker loci. Using the calculated population structure matrix and phylogenetic coefficients, a genome-wide association analysis (GWAS) was conducted on the protein content and BLUE values of wheat grains under three different environmental conditions using Tassel 5.0 software and a Q+K mixed linear model. The threshold for detecting effect sites was set to -log10(p) = 4, and SNP loci detected under all three environments were considered significant. Manhattan plots were used to represent the marker loci significantly associated with protein content on the genome after the association analysis. Figure 2 ).
[0041] 3. Major effect QTL identification
[0042] Analysis of QTLs significantly associated with protein content identified under different environments revealed a major-effect QTL, qGPC3A.1, stable across multiple environments on chromosome 3AS. This QTL was detected in 2017-2018, 2018-2019, and BLUE values, explaining 7.86-9.51%, 8.23-10.92%, and 7.67-7.81% of phenotypic variation, respectively (Table 2). Comparative analysis of effective SNPs screened within this interval identified Whaas53100 as a closely linked significant SNP. According to the Chinese Spring reference genome sequence information (IWGSC refseqv1.0), this significant site, Whaas53100, is located at nucleotide 260,492,627 on chromosome 3AS.
[0043] Table 2.1 Correlation Analysis Results under Different Environments
[0044]
[0045] Example 2
[0046] Based on wheat 660K microarray data, the significantly relevant Whaas53100 nucleotide sequence was extracted: CGTGATATTCACTCGCGGCACCGAAGCCGCCGACT[A / G]GTATCTTTCAGAACGAACGTACAACCACACAGGAG. "[A / G]" indicates that the SNP marker has two polymorphic single nucleotides, A or G, meaning that the base at this position is either A or G in the actual wheat material. Allelic identification of Whaas53100 in wheat materials from the associated population revealed that 12 wheat materials were of the Whaas53100_AA genotype, accounting for approximately 5.8%, with the sequence shown in SEQ INNO:2; and 195 wheat materials were of the Whaas53100_GG genotype, accounting for approximately 94.2%, with the sequence shown in SEQ INNO:3 (Table 3).
[0047] Analysis of protein content in wheat grains from related populations revealed significant differences in protein content among different alleles under different environments. Figure 3 Under different environmental conditions, the grain protein content of wheat materials with the Whaas53100_AA genotype was significantly higher than that of wheat materials with the Whaas53100_GG genotype. In the YY_18, YY_19, YY_20, and BLUE environments, the grain protein content of wheat materials with the Whaas53100_AA genotype was 14.38%, 15.74%, 16.77%, and 14.89%, respectively, while the grain protein content of wheat materials with the Whaas53100_GG genotype was 13.21%, 13.59%, 14.52%, and 13.34%, respectively. Comparative analysis showed that the Whaas53100_AA genotype wheat material had a protein content 9.43%, 14.35%, 11.85%, and 11.03% higher than that of the Whaas53100_GG genotype wheat material, respectively. The results showed that the Whaas53100_AA genotype is a favorable genotype for increasing the protein content in wheat grains.
[0048] Table 3. Effects of different Whaas53100 genotypes on amylopectin content in wheat grains.
[0049]
[0050] Note: The percentage increase or decrease is calculated by dividing the protein content of the AA genotype wheat material by the protein content of the GG genotype wheat material, i.e., percentage increase or decrease (%) = (AA-GG) / GG*100%.
[0051] The results in summary demonstrate that the SNP marker Whaas53100 obtained in this invention can be effectively used to identify the protein content in wheat grains and can be used for effective screening of wheat materials in the early generations of breeding. Selecting wheat materials with the Whaas53100_AA genotype for breeding high-protein wheat can shorten breeding time and improve the breeding process.
[0052] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. An SNP tag that is closely linked to the primary QTL, characterized in that, The SNP is labeled Whaas53100, and the nucleotide sequence of Whaas53100 is shown in SEQ IN NO:1; the major QTL is qGPC3A.
1.
2. The SNP marker according to claim 1, characterized in that, When the Whaas53100 genotype is AA, the wheat grains exhibit high protein content; when the genotype is GG, the wheat grains exhibit low protein content.
3. The SNP marker according to claim 2, characterized in that, When the Whaas53100 genotype is AA, its nucleotide sequence is shown in SEQ IN NO:2; when the Whaas53100 genotype is GG, its nucleotide sequence is shown in SEQ IN NO:
3.
4. The application of any of the SNP markers described in claims 1 to 3 in the breeding or screening of wheat plants, lines, strains, or varieties with high or low protein content.
5. The application of the SNP marker described in any one of claims 1 to 3 in the identification or auxiliary identification of wheat grain protein content.
6. The application of the SNP marker according to any one of claims 1 to 3 in comparing the protein content of wheat grains to be tested.
Citation Information
Patent Citations
Molecular marker of wheat gliadin content related site qGLI-7DS
CN114592084A