A TMEM232-siRNA liposome for treating atopic dermatitis and its preparation method
The topical use of TMEM232-siRNA liposome hydrogel inhibits the expression of TMEM232, solves the effective treatment problem of atopic dermatitis and provides new treatment methods.
Patent Information
- Application Number
- CN202211166610.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-23
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2042-09-23
AI Technical Summary
Currently, there is a lack of effective means of treating atopic dermatitis, the existing technology has failed to effectively utilize the potential of targeted treatment of susceptible genes, and the application of siRNA liposomes in the skin administration route has not been reported.
TMEM232-siRNA liposomes are used to inhibit the expression of TMEM232 through the skin topical hydrogel, thereby inhibiting the type 2 inflammatory response and improving the symptoms of atopic dermatitis.
By inhibiting the expression of TMEM232, it significantly reduces the symptoms of atopic dermatitis and reduces the inflammatory response, providing a new clinical treatment option.
Smart Images

Figure CN116327938B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of drugs, and particularly to an siRNA liposome for treating atopic dermatitis. Background Art
[0002] Atopic dermatitis (AD) is a chronic recurrent inflammatory skin disease related to genetic atopy, characterized by age-stage features, manifested as pruritus, polymorphic skin lesions and an exudative tendency. The incidence of atopic dermatitis has been increasing year by year. Currently, the incidence rate among children globally is as high as 15%-20%. It is statistically shown that about one-fourth of children will develop into adult atopic dermatitis after adulthood, and about one-fifth of children with atopic dermatitis may further develop into asthma. Since there is currently no means of complete cure, clinical treatment mainly focuses on symptomatic treatment. Medical practice shows that the condition of atopic dermatitis often recurs, and its severe pruritus, sleep disorders, and social difficulties caused by extensive skin lesions greatly trouble the physical and mental health of patients and also impose a heavy burden on society. However, there is still a lack of effective treatment means and preventive measures so far.
[0003] Atopic dermatitis has strong heredity. Genome-wide association studies (GWAS) have identified multiple loci related to the risk of atopic dermatitis. These studies on atopic dermatitis susceptibility loci have also repeatedly suggested some correlations between atopic dermatitis susceptibility genes and disease phenotypes, risks, and mechanisms. Although genomic variations are the evidence-based source of the disease pathogenesis, the current research on the downstream mechanisms of the numerous discovered susceptibility genes is still lacking. Revealing the mechanism of action of susceptibility genes in the pathogenesis of atopic dermatitis can inhibit the development of the disease from the source and provide a more sufficient basis for the development of targeted therapies.
[0004] RNA interference (RNAi) has currently received increasing attention as a method for treating gene-related diseases. Using short interfering RNA (siRNA) to specifically knock out pathogenic genes has brought promising clinical research for various diseases. The skin is an attractive target for RNAi therapy because it is easily accessible, and the administration route to this tissue is simple and non-invasive, which may result in fewer side effects.
[0005] Currently, there has been no report on the method of treating atopic dermatitis with siRNA liposome targeting the susceptibility locus significantly related to atopic dermatitis. Summary of the Invention
[0006] To solve the above technical problems, the present invention includes the following aspects:
[0007] The first aspect of the present invention provides a drug for treating atopic dermatitis, and the drug is a susceptibility gene TMEM232 inhibitor.
[0008] Preferably, the TMEM232 inhibitor is siRNA selected from siRNA-1, siRNA-2 or siRNA-3. The sequence of siRNA-1 is shown in SEQ ID NO.1 and SEQ ID NO.2. The sequence of siRNA-2 is shown in SEQ ID NO.3 and SEQ ID NO.4. The sequence of siRNA-3 is shown in SEQ ID NO.5 and SEQ ID NO.6.
[0009] Preferably, the sequence of SEQ ID NO.1 is CAUCAUUGGCAGAAAGAUATT, and the sequence of SEQ ID NO.2 is UAUCUUUCUGCCAAUGAUGTT.
[0010] Preferably, the sequence of SEQ ID NO.3 is GCACAAAGGCCACACCAAATT, and the sequence of SEQ ID NO.4 is UUUGGUGUGGCCUUUGUGCTT.
[0011] Preferably, the sequence of SEQ ID NO.5 is ACGAAAUGCUGGUUGGAUUTT, and the sequence of SEQ ID NO.6 is AAUCCAACCAGCAUUUCGUTT.
[0012] Preferably, the siRNA is siRNA-1 or siRNA-2.
[0013] The second aspect of the present invention provides a liposome for treating atopic dermatitis, and the liposome is loaded with the above-mentioned drug.
[0014] Preferably, the liposome is prepared from dipalmitoylphosphatidylcholine, cholesterol and distearoylphosphatidylethanolamine-polyethylene glycol 2000.
[0015] Preferably, the liposome is prepared from dipalmitoylphosphatidylcholine, cholesterol and distearoylphosphatidylethanolamine-polyethylene glycol 2000 with a molar ratio of (4-8):(2-6):(0.3-1).
[0016] More preferably, the liposome is prepared from dipalmitoylphosphatidylcholine, cholesterol and distearoylphosphatidylethanolamine-polyethylene glycol 2000 with a molar ratio of 6:4:0.5.
[0017] The third aspect of the present invention provides a topical preparation for treating atopic dermatitis. The topical preparation is a hydrogel, and the hydrogel contains the above-mentioned liposome.
[0018] Preferably, the matrix of the hydrogel is carbomer.
[0019] The fourth aspect of the present invention provides a method for preparing the above-mentioned topical preparation, which comprises the following steps:
[0020] (1) Dissolve dipalmitoyl phosphatidylcholine, cholesterol and distearoyl phosphatidylethanolamine-polyethylene glycol 2000 in a solvent, rotary evaporate to dryness to form a film, after ultrasonic treatment, hydrate the obtained lipid film with PBS buffer, and then perform freeze-thaw cycles to prepare blank liposomes;
[0021] (2) Add siRNA to the blank liposome solution prepared above, place the liposome solution in an ice bath for ultrasonic treatment, and then co-extrude through a microextruder to obtain liposomes loaded with siRNA;
[0022] (3) Add carbomer powder to water to dissolve it fully, add the liposome solution loaded with siRNA obtained in step (2), and then add triethylamine solution and stir continuously to obtain a hydrogel containing liposomes loaded with siRNA.
[0023] Preferably, the molar ratio of dipalmitoyl phosphatidylcholine, cholesterol and distearoyl phosphatidylethanolamine-polyethylene glycol 2000 in step (1) is 6:4:0.5.
[0024] Preferably, the solvent in step (1) is chloroform.
[0025] Preferably, the hydration temperature of the lipid film and PBS buffer in step (1) is 65 °C and the hydration time is 2 hours.
[0026] Preferably, the number of freeze-thaw cycles in step (1) is 5 times.
[0027] Preferably, the siRNA in step (2) is selected from siRNA-1, siRNA-2 or siRNA-3. The sequence of siRNA-1 is shown in SEQ ID NO.1 and SEQ ID NO.2, the sequence of siRNA-2 is shown in SEQ ID NO.3 and SEQ ID NO.4, and the sequence of siRNA-3 is shown in SEQ ID NO.5 and SEQ ID NO.6.
[0028] Preferably, the siRNA concentration in step (2) is 20 μM and the siRNA content is 2.5 nmol.
[0029] Preferably, the microextruder in step (2) uses a polycarbonate membrane with a diameter of 200 nm.
[0030] Preferably, the number of co-extrusion times in step (2) is 10 times.
[0031] Preferably, the stirring time in step (3) is 2 hours.
[0032] Preferably, in step (3), carbomer powder is dissolved in water under ultrasonic conditions, and the weight-volume ratio of carbomer powder to water is 10 mg: 1 mL.
[0033] The fifth aspect of the present invention provides the use of the above-mentioned drug, liposome or topical preparation in the preparation of a drug for treating atopic dermatitis.
[0034] The sixth aspect of the present invention provides the use of the above-mentioned drug, liposome or topical preparation in the preparation of a drug for inhibiting the expression level of one or more of IL-4, IL-13, IL-33, and TSLP.
[0035] Preferably, the present invention further provides the use of the above-mentioned drug, liposome or topical preparation in the preparation of a drug for simultaneously inhibiting the expression levels of IL-4, IL-13, IL-33, and TSLP.
[0036] Technical effects produced by the present invention:
[0037] 1. Based on genetics, the present invention discovers susceptibility loci significantly associated with atopic dermatitis, and for the first time reveals the expression of the susceptibility gene TMEM232 in atopic dermatitis at the population sample, cell, and animal levels using a variety of functional techniques. It is found that TMEM232 is up-regulated in atopic dermatitis samples, and after up-regulation, it exacerbates atopic dermatitis by promoting the inflammatory response.
[0038] 2. The present invention synthesizes TMEM232-siRNA liposome hydrogel for the first time, and achieves the effect of inhibiting the expression of TMEM232 through topical application on the skin, thereby inhibiting the type 2 inflammatory response and improving the symptoms of atopic dermatitis. This preparation provides a new drug option for the clinical application and treatment of atopic dermatitis and has broad application prospects. Description of the Drawings
[0039] Figure 1 It is a result graph showing increased expression of TMEM232 in lesional skin of AD patients, lesional skin of AD mice induced by MC903, and HaCaT cells treated with TNF-α / IFN-γ. Among them, Figure 1 A and 1B are HE staining images (scale bar = 100 μm) and immunofluorescence staining images (scale bar = 50 μm) of lesional skin of AD patients (n = 9) and healthy controls (n = 7); Figure 1 C and Figure 1 D are respectively the expression of TMEM232 in skin tissues analyzed by qRT-PCR and WB;Figure 1 E shows the phenotypes of mice in each group and HE staining images after treating mice with MC903 or the control solvent; Figure 1 F and Figure 1 G respectively show the levels of TMEM232 mRNA and protein in different groups (n = 6) detected by qRT-PCR and WB; Figure 1 H and Figure 1 I respectively show the expression levels of TMEM232 in HaCaT cells detected by qRT-PCR and WB (n = 6). The above results are expressed as mean ± SEM (Mean ± SEM), and the meanings of * are as follows: *P < 0.05, **P < 0.01, and ***P < 0.001.
[0040] Figure 2 This is about the effect of topical TMEM232-siRNA liposomal hydrogel on MC903-induced AD-like lesions. Among them, Figure 2 A is a schematic diagram of the experimental protocol; Figure 2 B shows the gross appearance of skin lesions and histology of skin lesions in mice in each experimental group (original magnification, x200; scale bar = 50 μm); Figure 2 C and 2D respectively show the ear thickness and AD skin lesion scores of mice in each experimental group; Figure 2 E shows the mRNA expression of TMEM232 in ear tissues of mice in each experimental group (n = 6); Figure 2 F shows the mRNA expression levels of cytokines Il-4, Il13, Il33, and TSLP in mice in each experimental group (n = 6). The above results are expressed as mean ± SEM (Mean ± SEM), and the meanings of * are as follows: *P < 0.05, **P < 0.01, and ***P < 0.001. Specific Embodiments
[0041] Preparation Example 1. Preparation of TMEM232-siRNA Nanoliposomes
[0042] 1. Synthesis of Liposomes
[0043] Dissolve dipalmitoyl phosphatidylcholine (DPPC), cholesterol, and distearoyl phosphatidylethanolamine-polyethylene glycol 2000 (DSPE-PEG2000) with a molar ratio of 6:4:0.5 in chloroform first, and then rotary evaporate to dryness to form a thin lipid film. After ultrasonic treatment, hydrate the obtained lipid film with 4 mL of PBS buffer at 65 °C for 2 h, and then perform 5 freeze-thaw cycles. Each freeze-thaw cycle is placed in a -80 °C refrigerator to freeze solid, and then taken out to room temperature to completely thaw to prepare blank liposomes with a concentration of 10 mg / mL.
[0044] 2. Preparation of siRNA-Loaded Liposomes
[0045] 2.5 nmol each of three siRNAs, namely TMEM232 siRNA-1, siRNA-2, and siRNA-3 (with a concentration of 20 μM for each, and the specific sequences are shown in Table 1 below) were added to 1 mL of the blank liposome solution prepared above. After placing the liposome solution containing siRNA in an ice bath and sonicating it for 1 minute, it was co-extruded 10 times through a mini-extruder (Avanti) with a polycarbonate membrane having a diameter of 200 nm to load the siRNA into the liposomes, and liposomes loaded with TMEM232 siRNA-1, TMEM232 siRNA-2, and TMEM232 siRNA-3 were obtained respectively.
[0046] Table 1 Sequences of the three siRNAs of the present invention and the siRNA of the control example
[0047]
[0048] 3. Preparation of Carbomer Hydrogel Loaded with siRNA Liposomes
[0049] Under ultrasonic conditions, 50 mg of Carbomer 934 (Macklin, C886117) powder was added to 5 ml of water to dissolve it completely, and then 1 mL of the liposome solution loaded with siRNA prepared above was added under continuous stirring. Then, 200 μL of triethylamine stock solution was added dropwise to the above mixed solution, and stirring was continued for 2 h to form a carbomer hydrogel loaded with three siRNA liposomes.
[0050] Experimental Example 1. Expression of TMEM232 in Skin Lesions of AD Patients, MC903-Induced Mouse AD Skin Lesions, and AD Cell Models
[0051] 1. Experimental Method
[0052] 1.1. Treatment of Human Skin Lesion Specimens
[0053] Skin biopsy specimens from 9 AD skin lesions and 7 healthy volunteers were obtained from the First Affiliated Hospital of Anhui Medical University. The diagnosis of AD was based on the Hanifin and Rajka criteria. This experiment was approved by the Ethics Committee of Anhui Medical University and complied with the requirements of the Declaration of Helsinki Principles. All subjects signed the informed consent form for the operation.
[0054] 1.2. Construction of AD Mouse Model
[0055] C57BL / 6 wild-type (WT) mice were provided by the Animal Center of Anhui Medical University. All mice were used in experiments at 8 - 10 weeks of age and maintained under specific pathogen-free conditions with a 12-hour light-dark cycle at 22 ± 2 °C. Food and water were available ad libitum. All surgeries were performed under isoflurane anesthesia. Related animal experiments were conducted by establishing an MC903-induced AD mouse model. MC903 (from TOCRIS, UK) was dissolved in ethanol. In the blank group (WT) and the model group (WT + MC903), 4 nmol of MC903 and an equal volume of ethanol were topically applied to the bilateral ears and dorsal skin of mice daily for 10 consecutive days.
[0056] 1.3 Cell culture and treatment
[0057] The immortalized human keratinocyte cell line (HaCaT cells) was cultured in high-glucose DMEM medium containing 10% fetal bovine serum (FBS), 100 μg / mL streptomycin, and 100 U / mL penicillin, and incubated in a humidified atmosphere containing 5% CO2 at 37 °C. The cells were stimulated with TNF-α / IFN-γ (20 ng / mL, from PeproTech) as an inflammatory inducer for 24 h to simulate an AD-like microenvironment in vitro.
[0058] 1.4 HE staining and immunofluorescence
[0059] Samples were extracted from the ears of the above AD model mice and human tissues of AD skin lesions volunteers, fixed with 10% formalin, and embedded in paraffin. Then the specimens were cut into 5-μm-thick sections. After dewaxing, the tissue sections were subjected to HE staining. The sections after antigen retrieval and serum blocking were incubated with the TMEM232 antibody (from Sigma) overnight at 4 °C. The next day, the sections were incubated with AlexaFluor 488-labeled goat anti-rabbit IgG secondary antibody. Images were taken using a panoramic tissue cell quantitative analysis system (tissufaxsPlus S) and a fluorescence microscope (Leica, Germany).
[0060] 1.5 Real-time reverse transcription PCR
[0061] Total RNA was extracted from the above HaCaT cells, AD model mice, and tissues of AD skin lesions volunteers using TRIzol reagent (Invitrogen) according to the reagent instructions. Complementary DNA (cDNA) was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The relevant primer sequences are shown in Table 2 below. SYBR qPCR SuperMix Plus (novoprotetien scientific) was used to amplify cDNA, and Roche LightCycler 480 II (Roche, Switzerland) was used for analysis. The expression level of each gene was normalized with the reference gene GAPDH, and the relative mRNA level was calculated using the 2 -ΔΔCt method.
[0062] Table 2 PCR primer sequences
[0063]
[0064]
[0065] 1.6, Immunoblotting
[0066] Total proteins of the above-mentioned HaCaT cells, AD model mice, and AD skin lesion volunteers' tissues were extracted with RIPA buffer, and the total protein concentration was detected with a BCA protein assay kit. After separation by SDS-PAGE, the protein samples were transferred onto nitrocellulose membranes. Monoclonal antibodies against human TMEM232 (Novus), mouse TMEM232 (ABclonal), and GAPDH (Proteintech) were incubated overnight at 4°C. The next day, the secondary antibody was incubated at room temperature for 1 hour, and then the signal was visualized using the Super Signal West Femto Sensitivity Substrate kit (Thermo Fisher Scientific). The results were analyzed using Investigator ProImage (AL600RGB, GE) software.
[0067] 2. Experimental results
[0068] To investigate the potential role of TMEM232 in atopic dermatitis, the expression of TMEM232 in AD patients' skin lesions was detected in this experimental example. HE staining showed that the stratum spinosum of AD patients was significantly thickened, and lymphocytes and eosinophils infiltrated in the upper dermis and around blood vessels ( Figure 1 A). Immunofluorescence detection showed that TMEM232 was strongly expressed in the epidermis of AD patients, mainly distributed throughout the epidermal layer, while it was rarely expressed or even undetectable in normal skin tissues ( Figure 1 B), indicating that the expression of TMEM232 was upregulated in the epidermis of AD patients compared with that of healthy individuals. By using qRT-PCR and WB to detect the mRNA and protein levels of TMEM232 in the skin respectively, they were significantly higher in the skin lesions of AD patients than in healthy controls ( Figure 1 C and 1D).
[0069] In this experimental example, MC903 was used to induce AD-like dermatitis in mice. After topical application of MC903, visible erythema, exudation, scales, and infiltrative thickening of the AD phenotype appeared. Histopathological examination showed obvious acanthosis, acanthocyte edema, and perivascular lymphocyte infiltration in the superficial dermis, which was consistent with the pathological manifestations of dermatitis, indicating successful establishment of the AD model in this experiment. Figure 1 E). The TNF-α / IFN-γ mixed stimulation was given to HaCaT cells to simulate the in vitro AD microenvironment. Compared with their respective controls, the expression of TMEM232 was also upregulated in the AD mouse model induced by MC903 and in HaCaT cells stimulated with TNF-α / IFN-γ. Figure 1 F- Figure 1 I). These data suggest that TMEM232 may be involved in the pathogenesis of AD.
[0070] Experimental Example 2, Inhibitory effect of the TMEM232-siRNA liposome of the present invention on AD-like dermatitis
[0071] 1. Experimental method
[0072] 1.1. Experimental grouping and dosing regimen
[0073] Thirty-six mice were randomly divided into 6 groups of 6 mice each, namely the blank control group (WT group), the model group (MC903 group), the control drug group (MC903+siRNA group), and the drug groups 1-3 of the present invention (MC903+TMEM232-siRNA-1, MC903+TMEM232-siRNA-2, and MC903+TMEM232-siRNA-3, respectively). The drug groups 1-3 of the present invention and the control drug group were respectively given the liposome hydrogels loaded with TMEM232 siRNA-1, TMEM232 siRNA-2, and TMEM232 siRNA-3 and the liposome hydrogel loaded with Ctrl-siRNA (General BIOL) prepared in Preparation Example 1 (the preparation method was the same as that of Preparation Example 1). Except for the blank control group and the model group, the mice in each experimental group were topically applied with 100 μL of the above liposome hydrogel only on both ears on the day after shaving (-1d). After 24 h (0d), the liposome hydrogel was applied again. After a 1-2 h interval, 4 nmol of MC903 was applied externally. Thereafter, it was used alternately for 9 days (9d). On the last day (10d), only MC903 was applied, and the mice were sacrificed on the next day (11d). Each experimental parameter was measured according to the following method, and the total length of the whole experimental process was 11 days. The model group directly started to apply an equal amount of MC903 on the day after the second day of shaving and continued for 10 days. Figure 2 A).
[0074] 1.2. Observation of the appearance and histology of mouse skin lesions
[0075] The H&E staining method was the same as the corresponding part in 1.4 of Test Example 1.
[0076] 1.3. Ear Thickness Measurement
[0077] The thickness of the middle part of the bilateral ears of the mice was measured using a vernier caliper (Mitutoyo, Japan). The measurement was taken 3 times and the average value was used. The increased value of the ear swelling thickness was calculated using the following method: Increase in ear swelling thickness (mm) = Ear thickness at the end of the experiment (mm) - Ear thickness before modeling on Day 0 (mm).
[0078] 1.4. AD Skin Lesion Scoring
[0079] The inflammatory conditions of the skin lesions on the ears and backs of the mice in each test group were observed, specifically including erythema (bleeding), edema (papules), epidermal exfoliation (scratches), and scale (dryness), and photographs were taken for record. The specific scoring criteria are shown in Table 3.
[0080] Table 3. Scoring Table for Local Skin Lesions in Mice
[0081]
[0082] 1.5. Expression Levels of TMEM232 and Cytokine mRNAs in Ear Tissues
[0083] The real-time reverse transcription PCR method was the same as the corresponding part in 1.5 of Test Example 1. The relevant primer sequences are shown in Table 4 below.
[0084] Table 4. PCR Primer Sequences
[0085]
[0086]
[0087] 2. Test Results
[0088] The test results showed that after applying each TMEM232-siRNA liposome hydrogel group of the present invention topically, the redness and swelling of the mice's ears were reduced, and the scales were decreased; HE staining showed a slight thickening of the epidermis and a reduction in the inflammatory cells infiltrated in the dermis ( Figure 2 B). In addition, the TMEM232-siRNA-1 and TMEM232-siRNA-2 liposome hydrogel groups significantly reduced the ear thickness and AD dermatitis score of the mice, but the TMEM232-siRNA-3 liposome hydrogel group showed no obvious improvement in ear thickness and AD dermatitis score compared with the MC903 model group ( Figure 2 C and 2D).
[0089] qRT-PCR results showed that the TMEM232-siRNA-1 and TMEM232-siRNA-2 liposome hydrogel groups significantly inhibited its mRNA expression, while no such inhibitory effect was found in the TMEM232-siRNA-3 group( Figure 2 E).
[0090] qPCR results showed that topical application of TMEM232-siRNA-1 and TMEM232-siRNA-2 liposome hydrogels could significantly inhibit the expression levels of Th2 cytokines IL-4, IL-13, and epithelial-derived cytokines and chemokines IL-33 and TSLP. However, no such inhibitory effect was found in the TMEM232-siRNA-3 liposome hydrogel group, and there was no statistical significance compared with the model group( Figure 2 F).
[0091] The above experimental results indicate that the TMEM232-siRNA liposome hydrogel prepared by the present invention can achieve the effect of inhibiting TMEM232 expression through topical application on the skin, indicating that it can effectively inhibit type 2 inflammatory responses and improve the symptoms of atopic dermatitis clinically, and is expected to become a new drug option in the clinical treatment of atopic dermatitis.
[0092] Although specific embodiments of the present invention have been described, those skilled in the art should recognize that various changes and modifications can be made to the present invention without departing from the scope or spirit of the present invention. Therefore, the present invention is intended to cover all such changes and modifications that fall within the scope of the appended claims and their equivalents.
Claims
1. A drug for treating atopic dermatitis, characterized in that, The drug is a susceptibility gene TMEM232 inhibitor, the TMEM232 inhibitor is siRNA selected from siRNA-1 or siRNA-2, the sequence of siRNA-1 is shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the sequence of siRNA-2 is shown in SEQ ID NO. 3 and SEQ ID NO.
4.
2. A liposome for treating atopic dermatitis, characterized in that, The liposome encapsulates the drug according to claim 1.
3. The liposome according to claim 2, characterized in that, The liposome is prepared from dipalmitoyl phosphatidylcholine, cholesterol and distearoyl phosphatidylethanolamine-polyethylene glycol 2000.
4. The liposome according to claim 3, characterized in that, The liposome is prepared from dipalmitoyl phosphatidylcholine, cholesterol and distearoyl phosphatidylethanolamine-polyethylene glycol 2000 with a molar ratio of 6:4:0.
5.
5. A topical preparation for treating atopic dermatitis, characterized in that, The topical preparation is a hydrogel, and the hydrogel contains the liposome according to any one of claims 2-4.
6. A method for preparing the topical preparation according to claim 5, characterized in that, Comprising the following steps: (1) Dissolve dipalmitoyl phosphatidylcholine, cholesterol and distearoyl phosphatidylethanolamine-polyethylene glycol 2000 in a solvent, rotate and evaporate to dryness to form a film, after ultrasonic treatment, hydrate the obtained lipid film with PBS buffer solution, and then perform freeze-thaw cycles to prepare blank liposomes; (2) Add siRNA to the blank liposome solution prepared above, place the liposome solution in an ice bath for ultrasonic treatment, and then co-extrude through a mini-extruder to obtain liposomes loaded with siRNA; (3) Add carbomer powder to water to dissolve it fully, add the liposome solution loaded with siRNA obtained in step (2), and then add triethylamine solution and continuously stir to obtain a hydrogel containing liposomes loaded with siRNA.
7. Use of the drug according to claim 1, the liposome according to any one of claims 2-4 or the topical preparation according to claim 5 in the preparation of a drug for treating atopic dermatitis.
Citation Information
Patent Citations
Application of microRNA-210 inhibitor in preparing medicine treating inflammatory dermatosis
CN108144061A
Construction method and application of keratin gene modified mouse animal model
CN114045290A