Exoglucanase mutant and its encoding gene, recombinant vector, recombinant bacteria and enzyme preparation and their applications

Through the directional evolution of exoglucanase, mutants with improved ethanol resistance were developed, which solved the problem of high concentration of ethanol inhibition, achieved efficient bioethanol production in synchronous fermentation of corn starch and fiber, and improved the utilization rate and ethanol production of corn cellulose biomass.

CN116334045BActive Publication Date: 2025-08-19NANJING NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211543049.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-02
Publication Date
2025-08-19
Estimated Expiration
2042-12-02

AI Technical Summary

Technical Problem

In the bioethanol production process, high concentration of ethanol inhibits the activity of exoglucanase, resulting in low conversion efficiency of corn fibers. It is difficult for the prior art to effectively use corn fibers and starch to produce ethanol.

Method used

The exoglucanase was transformed by KnowVolution directional evolution technology. Through high-throughput screening and directional evolution, an exoglucanase mutant with ethanol resistance was developed to improve its catalytic efficiency and stability, and was applied to the synchronous fermentation process of corn starch and corn fiber.

Benefits of technology

It significantly improves the utilization rate of corn starch and corn fiber, increases the yield and yield of bioethanol, and reduces production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116334045B_ABST
    Figure CN116334045B_ABST
Patent Text Reader

Abstract

The present invention relates to renewable energy and bioengineering technology, and discloses an exoglucanase mutant, its encoding gene, recombinant vector, recombinant bacteria, enzyme preparation, and applications thereof. The exoglucanase mutant is: an enzyme having the amino acid sequence shown in SEQ ID NO. 1; or an enzyme having the amino acid sequence shown in SEQ ID NO. 1 with one or more amino acid residues substituted, deleted, or added at position 311 and still exhibiting exoglucanase mutant activity; or an enzyme having a tag attached to the amino and / or carboxyl termini of the amino acid sequence; or an enzyme having a signal sequence attached to the amino terminus of the amino acid sequence. The exoglucanase mutant has improved ethanol resistance and high catalytic efficiency, thereby increasing the efficiency of bioethanol production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to renewable energy and bioengineering technology, and in particular to an exoglucanase mutant, a gene encoding the exoglucanase mutant, a recombinant vector, a recombinant strain, a method for preparing the exoglucanase mutant, an enzyme preparation, and applications of the same in degrading cellulose and / or preparing bioethanol. Background Art

[0002] As a renewable bioenergy source, bioethanol has broad application prospects in meeting growing energy demands and promoting sustainable economic development. However, in traditional corn ethanol production, the fiber in the corn is not fully utilized and is mostly recycled as a byproduct, thereby reducing the value of the underutilized biomass. If corn components can be effectively utilized to jointly produce starch ethanol and cellulosic ethanol, the utilization rate of raw materials and bioethanol yield can be greatly improved. A representative technology with this concept has been developed in the prior art, called ADISET (acid distillation combined with online enzymatic hydrolysis technology). Based on existing distillation equipment and conditions, the ADISET method simulates the cellulose pretreatment process by adding an appropriate amount of dilute acid during the distillation process, simultaneously handling corn fiber pretreatment and corn starch ethanol distillation.

[0003] Saccharification is a key and rate-limiting step in the conversion of cellulosic biomass, such as corn fiber, into ethanol. Besides chemical (primarily acid) hydrolysis, enzymatic catalysis is an efficient and attractive alternative to saccharification. Cellulase, a glycoside hydrolase, hydrolyzes (hemi)cellulose into glucose monomers at relatively low temperatures, contributing to biomass degradation. Complete cellulose degradation requires the synergistic action of three different cellulase enzymes: endoglucanases, which create gaps within the cellulose, opening reducing and non-reducing ends; exoglucanases, which act on reducing and non-reducing ends to release cellulose; and β-glucosidases, which cleave the cellulose to release glucose. The simultaneous conversion of corn starch and corn fiber produces ethanol at concentrations as high as 100-140 g / L (12%-17% (v / v)). This significantly inhibits cellulase activity, severely impacting corn fiber conversion efficiency. Therefore, there is an urgent need to develop cellulases that can tolerate high ethanol concentrations. Summary of the Invention

[0004] The purpose of the present invention is to overcome the problem that the increased ethanol concentration inhibits the activity of exoglucanase during the bioethanol production process, and to provide an exoglucanase mutant and its encoding gene, recombinant vector, recombinant bacteria and enzyme preparation and their applications. The exoglucanase mutant has improved ethanol resistance and high catalytic efficiency, effectively improving the production efficiency of bioethanol.

[0005] In order to achieve the above object, the first aspect of the present invention provides an exoglucanase mutant, wherein the exoglucanase mutant is an enzyme described in any one of (a) to (d):

[0006] (a) an enzyme having the amino acid sequence shown in SEQ ID NO.1;

[0007] (b) an enzyme represented by an amino acid sequence in which one or more amino acid residues are substituted, deleted, or added at position 311 of amino acid sequence shown in SEQ ID NO. 1 and which still has exoglucanase mutant activity;

[0008] (c) an enzyme represented by an amino acid sequence having a tag linked to the amino terminus and / or carboxyl terminus of the amino acid sequence described in (a) or (b);

[0009] (d) An enzyme represented by an amino acid sequence in which a signal sequence is linked to the amino terminus of the amino acid sequence described in (a) or (b).

[0010] Preferably, the exoglucanase mutant is an enzyme having the amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0011] The second aspect of the present invention provides a gene encoding an exoglucanase mutant, wherein the gene has a nucleotide sequence encoding the aforementioned exoglucanase mutant.

[0012] Preferably, the gene has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO.1.

[0013] More preferably, the gene has the nucleotide sequence shown in SEQ ID NO.3.

[0014] Preferably, the gene has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO.2.

[0015] More preferably, the gene has the nucleotide sequence shown in SEQ ID NO.4.

[0016] The third aspect of the present invention provides a recombinant vector comprising the aforementioned gene.

[0017] Preferably, the expression vector of the recombinant vector is at least one selected from the group consisting of pBSYA1S1Z plasmid, pET22b plasmid and pET28a plasmid; more preferably, it is pBSYA1S1Z plasmid.

[0018] A fourth aspect of the present invention provides a recombinant strain containing the aforementioned gene or the aforementioned recombinant vector.

[0019] Preferably, the recombinant strain is selected from at least one of Pichia pastoris, Escherichia coli and Saccharomyces cerevisiae; more preferably, it is Pichia pastoris BSYBG11.

[0020] A fifth aspect of the present invention provides a method for preparing an exoglucanase mutant, which comprises: inoculating the aforementioned recombinant strain into a fermentation medium for fermentation to obtain a fermentation broth, and separating and purifying the fermentation broth to obtain the exoglucanase mutant.

[0021] In a sixth aspect, the present invention provides an enzyme preparation, which comprises the exoglucanase mutant prepared by the aforementioned method.

[0022] The seventh aspect of the present invention provides the use of at least one of the aforementioned exoglucanase mutant, the aforementioned gene, the aforementioned recombinant vector, the aforementioned recombinant strain, the exoglucanase mutant prepared by the aforementioned method, and the aforementioned enzyme preparation in degrading cellulose and / or preparing bioethanol.

[0023] Through the above technical solution, the beneficial effects of the present invention are:

[0024] The present invention adopts the KnowVolution directed evolution technology in combination with an established high-throughput screening scheme to transform exoglucanases, and screen out exoglucanase mutants with improved ethanol resistance. The exoglucanase mutants are applied to the process of synchronous fermentation of corn starch and corn fiber to produce ethanol, can effectively improve the utilization rate of corn starch and corn fiber, significantly increase the yield and output of bioethanol, reduce the production cost of bioethanol, and have good economic benefits.

[0025] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is an SDS-PAGE analysis of the fermentation supernatant in Example 1, wherein the box indicates the band of wild-type CBHI;

[0027] Figure 2 1 is a diagram showing the establishment of the CBHI screening system in Example 1, wherein a is the resistance of wild-type CBHI to different ethanol concentrations, b is the robustness analysis of the activity of wild-type CBHI at 0% ethanol concentration (v / v), c is the robustness analysis of the activity of wild-type CBHI at 30% ethanol concentration (v / v), and d is the robustness analysis of the resistance of wild-type CBHI at 30% ethanol concentration (v / v);

[0028] Figure 3 is a diagram of potential improved variants identified by screening the CBHI cepPCR library in Example 1;

[0029] Figure 4 is a diagram of beneficial amino acid substitution sites determined by screening the CBHI SSM library in Example 1;

[0030] Figure 5 This is a visualization diagram of the beneficial amino acid substitution sites of CBHI with additive effects determined by recombination in Example 1. DETAILED DESCRIPTION

[0031] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0032] The first aspect of the present invention provides an exoglucanase mutant, wherein the exoglucanase mutant is an enzyme described in any one of (a) to (d):

[0033] (a) an enzyme having the amino acid sequence shown in SEQ ID NO.1;

[0034] (b) an enzyme represented by an amino acid sequence in which one or more amino acid residues are substituted, deleted, or added at position 311 of amino acid sequence shown in SEQ ID NO. 1 and which still has exoglucanase mutant activity;

[0035] (c) an enzyme represented by an amino acid sequence having a tag linked to the amino terminus and / or carboxyl terminus of the amino acid sequence described in (a) or (b);

[0036] (d) An enzyme represented by an amino acid sequence in which a signal sequence is linked to the amino terminus of the amino acid sequence described in (a) or (b).

[0037] During the research process, the inventors of the present invention combined protein engineering with directed evolution and rational design to quickly and directedly modify a heterologously expressed exoglucanase (having the amino acid sequence shown in SEQ ID NO.5), thereby improving the ethanol resistance of the exoglucanase mutant. At the same time, the exoglucanase mutant can be efficiently and stably applied to cellulose degradation processes (such as the degradation of corn starch and corn fiber) or the simultaneous fermentation of corn starch and corn fiber to produce ethanol, thereby effectively improving the utilization rate of corn starch and corn fiber, significantly increasing the yield and output of bioethanol, and reducing the production cost of bioethanol.

[0038] In the present invention, in the amino acid sequence of the exoglucanase mutant having the amino acid sequence shown in SEQ ID NO.1, an amino acid residue at position 311 can be substituted, deleted or added, and the role played by the residue in the protein domain (such as providing a positive charge or forming a hydrophobic pocket structure) is unchanged, and the three-dimensional structure of the protein is not affected, so the function of the protein can still be achieved. Preferably, the phenylalanine at position 311 of the amino acid sequence of the exoglucanase mutant shown in SEQ ID NO.1 of the present invention is substituted with asparagine to obtain an exoglucanase mutant having the amino acid sequence shown in SEQ ID NO.2.

[0039] According to the present invention, preferably, the exoglucanase mutant is an enzyme having an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2. In this case, the exoglucanase mutant has higher ethanol resistance and better catalytic efficiency, which is more conducive to improving the efficiency of simultaneous fermentation of corn starch and corn fiber to produce ethanol.

[0040] To facilitate purification, (a) or (b) can also be modified using tags commonly used in the art. For example, a tag-containing amino acid sequence can be attached to the amino terminus and / or carboxyl terminus of (a). Such tags will not affect the activity of the exoglucanase mutant of the present invention. In actual applications, the addition of tags can be selected based on actual needs.

[0041] In the present invention, the amino terminus of the exoglucanase mutant may be connected to a signal sequence, which may be derived from, but not limited to, Pichia pastoris, Escherichia coli, and Saccharomyces cerevisiae.

[0042] The exoglucanase mutants can be obtained by artificial synthesis, or their encoding genes can be synthesized first and then obtained by biological expression. Preferably, the exoglucanase mutants provided by the present invention are mutated by KnowVolution directed evolution combined with InSiReP technology to modify the wild-type exoglucanase encoding gene whose amino acid sequence is shown in SEQ ID NO. 5, and the specific process includes:

[0043] (1) Heterologous expression of exoglucanase (CBHI): The expression plasmid containing the wild-type exoglucanase coding gene was transformed into Pichia pastoris competent cells and spread on YPD plates containing a certain level of bleomycin resistance (bleomycin content was 20-100 μg / mL). Transformants were obtained after 2-3 days. The transformants grown on the plates were picked and inoculated into YPD 96-well plates containing a certain level of bleomycin resistance (bleomycin content was 20-100 μg / mL) and fermented to produce enzymes under appropriate conditions;

[0044] (2) Establishment of a CBHI high-throughput screening system: After fermentation, the supernatant enzyme solution was obtained by centrifugation. An empty plasmid without the CBHI gene was used as a control. Enzyme activity was detected using a high-throughput screening substrate. The ethanol concentration at which the residual enzyme activity was between 30% and 40% was selected as the screening concentration to establish a screening system.

[0045] (3) KnowVolution directed evolution phase I: Generate diversity of CBHI gene by Casting epPCR (cepPCR). According to the cepPCR method, CBHI gene was evenly divided into several gene segments of about 200 bp. 2+ The concentration (0.1-0.5 mM) regulates the mutation rate, and after obtaining the mutants, they are screened through a high-throughput screening system to obtain high-throughput beneficial mutants;

[0046] (4) KnowVolution directed evolution phase II: By sequencing the high-throughput beneficial mutants obtained in phase I, the beneficial potential sites that affect the enzyme's ethanol resistance were obtained. The tang-method technology was used to perform site-saturation mutagenesis (SSM) on each site in turn and screened to obtain several confirmed beneficial sites that affect the enzyme's ethanol resistance;

[0047] (5) KnowVolution directed evolution phase III: stability analysis (including site distance analysis and stability analysis) of the beneficial sites obtained in phase II is performed by computer to obtain the optimal recombination strategy;

[0048] (6) KnowVolution directed evolution stage IV: The optimal recombination strategy (including 2GeneRep and InSiRep) obtained by computer analysis was experimentally verified, and recombinants with greater improved ethanol resistance were selected and their tolerance to different organic solvents was verified to obtain exoglucanase mutants with high ethanol resistance and high organic solvent resistance.

[0049] According to the present invention, preferably, in step (1), the expression plasmid can be a pBSYA1S1Z plasmid, a pET22b plasmid, or a pET28a plasmid; the expression plasmid is transformed into a Pichia pastoris competent cell by electroporation, and the electroporation conditions may include: a voltage of 1.5-5KV, a capacitance of 10-20μF, and a resistance of 180-200Ω; and the conditions for fermentation and enzyme production include: a temperature of 20-30°C, a rotation speed of 700-900rpm, and a time of 48-96h.

[0050] According to the present invention, preferably, in step (2), the high-throughput screening substrate for the exoglucanase (CBHI) can be fluorescent resorcinol, CMC microcrystalline cellulose, or carboxymethyl cellulose sodium salt; the screening method comprises: mixing 10-40 μL of enzyme solution with 10-40 μL of sodium acetate buffer (0.1 M, pH 7), adding an excess of the high-throughput screening substrate, reacting for 30-60 minutes, terminating the reaction, and measuring the fluorescence of the reaction solution (ex: 550 nm and em: 590 nm); and calculating the relative enzyme activity based on the fluorescence values. In the present invention, the selected screening ethanol concentration can be 20-40% (v / v).

[0051] The second aspect of the present invention provides a gene encoding an exoglucanase mutant, wherein the gene has a nucleotide sequence encoding the aforementioned exoglucanase mutant.

[0052] According to the present invention, preferably, the gene has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO. 1, or has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO. 2.

[0053] As described above, accordingly, the 5' end and / or 3' end of the nucleotide sequence may also be connected to a coding sequence of a modified tag.

[0054] It is well known in the art that, of the 20 different amino acids that make up proteins, with the exception of Met (ATG) and Trp (TGG), which are each encoded by a single codon, the other 18 amino acids are encoded by 2-6 codons (Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd edition, 1989, see Appendix D on page 950). Because of the degeneracy of the genetic code, there is often more than one codon specifying an amino acid. Substitution of the third nucleotide in a triplet codon generally does not change the amino acid composition, and therefore, the nucleotide sequences of genes encoding the same protein can differ.

[0055] More preferably, the gene encoding the enzyme having the amino acid sequence shown in SEQ ID NO.1 has the nucleotide sequence shown in SEQ ID NO.3, and the gene encoding the enzyme having the amino acid sequence shown in SEQ ID NO.2 has the nucleotide sequence shown in SEQ ID NO.4.

[0056] The nucleotide sequences provided herein can generally be obtained using polymerase chain reaction (PCR) amplification, recombinant methods, or synthetic methods. Once the nucleotide sequence is obtained, the amino acid sequence can be obtained in large quantities using recombinant methods. The resulting nucleotide sequence is typically cloned into a vector, then transferred into genetically engineered bacteria, and then the nucleotide sequence is isolated from the propagated host cells using conventional methods.

[0057] In addition, the relevant nucleotide sequences can also be synthesized using known artificial chemical synthesis methods.

[0058] The third aspect of the present invention provides a recombinant vector comprising the aforementioned gene.

[0059] The "vector" used in the recombinant vector can be selected from various vectors known in the art, such as commercially available plasmids, cosmids, phages, and retroviruses. Preferably, the expression vector of the recombinant vector is selected from at least one of the pBSYA1S1Z plasmid, the pET22b plasmid, and the pET28a plasmid; more preferably, the pBSYA1S1Z plasmid.

[0060] The recombinant vector can be constructed by Gibson assembly to connect the gene fragments to obtain a recombinant plasmid. The present invention preferably uses the pBSYA1S1Z plasmid and the gene fragment connected thereto, and connects them by seamless cloning ligase to construct the recombinant vector pBSYA1S1Z-CBHI.

[0061] A fourth aspect of the present invention provides a recombinant strain containing the aforementioned gene or the aforementioned recombinant vector.

[0062] In the present invention, the recombinant vector can be transformed, transduced, or transfected into a host cell (strain) by conventional methods in the art, such as chemical transformation using the calcium chloride method or high-voltage electroporation, to obtain a recombinant strain. The recombinant strain can be a prokaryotic cell or a eukaryotic cell, preferably at least one selected from Pichia pastoris, Escherichia coli, and Saccharomyces cerevisiae. More preferably, the recombinant strain is Pichia pastoris, for example, Pichia pastoris BSYBG11.

[0063] In the present invention, the exoglucanase mutant can be used in the form of recombinant bacterial strain full cells, or can be used in the form of crude enzyme separated from the recombinant bacterial strain cells, unpurified, or purified. If desired, the exoglucanase mutant of the present invention can also be made into an immobilized enzyme or immobilized cells using immobilized techniques known in the art.

[0064] A fifth aspect of the present invention provides a method for preparing an exoglucanase mutant, which comprises: inoculating the aforementioned recombinant strain into a fermentation medium for fermentation to obtain a fermentation broth, and separating and purifying the fermentation broth to obtain the exoglucanase mutant.

[0065] The method for preparing an exoglucanase mutant provided by the present invention comprises: culturing the recombinant strain provided by the present invention to induce expression of a gene encoding the exoglucanase mutant; and isolating and purifying the expressed exoglucanase mutant. The culture conditions are conventional culture conditions, such as using YPD medium (the solvent is water, and the solutes and their final concentrations are: peptone 15-25 g / L, yeast extract 5-15 g / L, glucose 15-25 g / L), culturing at a temperature of 25-35° C. and a rotation speed of 120-180 rpm.

[0066] Since the recombinant strain provided by the present invention contains a gene encoding an exoglucanase mutant, it can efficiently express the exoglucanase mutant. After cultivation, high-purity exoglucanase mutants can be obtained by separation and purification. Specifically, separation and purification can be carried out by methods known to those skilled in the art, which will not be described in detail here.

[0067] Based on the fermentation broth of the recombinant strain, a starter containing the exoglucanase mutant can be prepared in liquid or solid form. The starter can contain auxiliary materials conventionally added when preparing bacterial agents in the art, and those skilled in the art can select them as needed. Preferably, the content of the recombinant strain is 10 5 -10 10 CFU, more preferably 10 7 -10 9 CFU.

[0068] In a sixth aspect, the present invention provides an enzyme preparation, which comprises the exoglucanase mutant prepared by the aforementioned method.

[0069] The enzyme preparation may be in solid, semi-solid or liquid form, and may contain auxiliary materials or additives for preparing the enzyme preparation. Those skilled in the art may select the appropriate materials as needed, which will not be elaborated herein.

[0070] The seventh aspect of the present invention provides the use of at least one of the aforementioned exoglucanase mutant, the aforementioned gene, the aforementioned recombinant vector, the aforementioned recombinant strain, the exoglucanase mutant prepared by the aforementioned method, and the aforementioned enzyme preparation in degrading cellulose and / or preparing bioethanol.

[0071] The exoglucanase mutant provided by the present invention not only has exoglucanase activity and high stability, but also has a high ability to tolerate ethanol. It can continuously exert the activity of the exoglucanase in the process of producing bioethanol from lignocellulosic biomass, improve the utilization rate of lignocellulosic biomass raw materials, and significantly improve the yield and output of bioethanol.

[0072] The present invention will be described in detail below through examples.

[0073] In the following examples, CBHI activity was measured by the fluorescent resorcinol (Res-CB) method, and the ethanol resistance factor was calculated as follows:

[0074] Resistance multiple = residual activity of CBHI mutant at a certain ethanol concentration / residual activity of wild-type CBHI at the same ethanol concentration,

[0075] Residual activity = CBHI enzyme activity in ethanol / CBHI enzyme activity in buffer, where the buffer is sodium acetate buffer (0.1 M, pH 7);

[0076] Pichia pastoris was purchased from Bisy (Austria) with the code BSYBG11; Saccharomyces cerevisiae was purchased from Angel Yeast with the code 80000194; DpnI was purchased from Shanghai Biyuntian Biotechnology Co., Ltd. with the code D6257; commercial cellulase was purchased from Shandong Weilan Bio-Cellulase with the code GFY-4309, and corn flour was purchased from COFCO Corporation. Unless otherwise specified, the remaining reagents or raw materials were conventional commercial products.

[0077] The formula of YPD medium is: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L.

[0078] Example 1

[0079] (1) Heterologous expression of wild-type exoglucanase CBHI

[0080] Pichia pastoris was inoculated into YPD medium and cultured until OD 600 When the pH reaches 1.3-1.5, the cells are naturally precipitated and the Pichia pastoris cells are collected. The Pichia pastoris cells are suspended in a mixture of 100 mM lithium acetate solution, 10 mM dithiothreitol solution, 0.6 M sorbitol solution and 10 mM Tris-HCl (pH 7.5) at room temperature and incubated at 30°C and 110 rpm for 30 min. After incubation, the cells are centrifuged and resuspended in ice-cold sterile water. The cells are centrifuged and the supernatant is discarded. The operation is repeated and the cells are resuspended in ice-cold 1 M sorbitol solution. The supernatant is removed by centrifugation and the cells are finally resuspended in ice-cold 1 M sorbitol solution to obtain competent cells.

[0081] The construction of the recombinant plasmid pBSYA1S1Z-wild-type CBHI was carried out using a seamless cloning kit, specifically including the cloning of the target gene and vector: according to the map of the target gene wild-type CBHI and the vector pBSYA1S1Z, primers CBHI-P1 (nucleotide sequence shown in SEQ ID NO.23), CBHI-P2 (nucleotide sequence shown in SEQ ID NO.24), Vector-P3 (nucleotide sequence shown in SEQ ID NO.25), and Vector-P4 (nucleotide sequence shown in SEQ ID NO.26) were designed, and PrimeSTAR high-fidelity enzyme was used to amplify the wild-type CBHI gene (amino acid sequence shown in SEQ ID NO.5, nucleotide sequence shown in SEQ ID NO. 6) and linearized vector, the PCR program was as follows: CBHI gene—98°C for 1 s; 98°C for 10 s, 55°C for 15 s, 72°C for 30 s, 31 cycles; 72°C for 5 min; vector—98°C for 1 s; 98°C for 10 s, 55°C for 15 s, 72°C for 90 s, 31 cycles; 72°C for 5 min;

[0082] CBHI-P1: AGAGAGGCCGAAGCTCAGTCGGCCTGCACTCTC (SEQ ID NO. 23);

[0083] CBHI-P2: TTGAGCGGCCGCTTAGCCGCTAGGGTTGCCGT (SEQ ID NO. 24);

[0084] Vector-P3:TAAGCGGCCGCTCAA(SEQ ID NO.25);

[0085] Vector-P4: AGCTTCGGCCCTCT (SEQ ID NO. 26);

[0086] Ligation of the target gene and vector: Based on the basic principle of homologous recombination, the 2X Seamless Cloning Mix provided in the seamless cloning kit was used, with a ratio of CBHI gene to linearized vector of 2:1. The system was made up to 20 μL with double-distilled water, and the above system was incubated at 50°C for 15 minutes. 5 μL was added to Escherichia coli DH5α competent cells, mixed and placed on ice for 30 minutes, and immediately heat-shocked at 42°C for 90 seconds. The cells were quickly returned to ice and allowed to stand for 3-5 minutes. After adding culture medium and culturing for 1 hour, most of the supernatant was discarded, and the pellet was resuspended and spread on a plate. After transformants grew, the plasmid was extracted and tested to confirm the successful construction of the recombinant plasmid, resulting in the recombinant plasmid pBSYA1S1Z-wild-type CBHI (nucleotide sequence shown in SEQ ID NO. 27);

[0087] The Pichia competent cells prepared above were mixed with 3 ng of the recombinant plasmid pBSYA1S1Z-wild-type CBHI (1 μL, the amino acid sequence of the wild-type CBHI is shown in SEQ ID NO. 5, and the nucleotide sequence is shown in SEQ ID NO. 6), transferred to an electroporation cuvette (pre-cooled in advance), incubated on ice for 5 min, and electroporated under the conditions of a voltage of 1.5 KV, a capacitance of 10 μF, and a resistance of 186 Ω. Immediately, 1 mL of a 1 M sorbitol solution (pre-cooled in advance) was added and mixed, and the mixture was spread on a YPD plate containing resistance (bleomycin content of 50 μg / mL), cultured at 37° C. for 2-3 days, and the transformants grown on the plate were picked and inoculated on a YPD plate containing resistance. In a 96-well plate (bleomycin content of 50 μg / mL), the culture was cultured and fermented at 25°C and 900 rpm for 96 hours. The supernatant was collected by centrifugation at 4000 rpm for 25 minutes to obtain the supernatant enzyme solution. The fermentation supernatant was subjected to SDS-PAGE analysis. The protein bands on the gel image were compared with the molecular size of the wild-type CBHI gene of the target gene to confirm normal protein expression. Figure 1 .

[0088] (2) Establishment of CBHI high-throughput screening system

[0089] Fluorescent resorcinol (Res-CB) was used as a substrate to detect CBHI activity. 0-20 μL of sodium acetate buffer (0.1 M, pH 7), 0-20 μL of ethanol, 20 μL of supernatant enzyme solution, and 10 μL of substrate solution containing Res-CB (at a concentration of 375 μM) were added to each well to determine CBHI activity. Resorufin fluorescence turnover was recorded by measuring the fluorescence on a microplate reader (ex: 550 nm and em: 590 nm) within 30 min at room temperature. The release of resorufin (CBHI reacts with fluorescent resorcinol to release resorufin, and the fluorescence value is measured by a microplate reader to define the activity of CBHI); the standard deviation of the assay was determined by measuring the activity in a 96-well MTP containing only wild-type CBHI (WT) and another 96-well MTP containing only an empty vector (EV, with the empty plasmid pBSYA1S1Z without the CBHI gene as a control). In order to determine the ethanol concentration for high-throughput screening, sodium acetate buffer (0.1 M, pH 7) was used as a supplementary solvent to obtain different concentrations of ethanol (see Table 1 for concentrations). The ethanol concentration that can make the residual activity of wild-type CBHI (WT) reach 30-40% was selected to screen the mutant library. The results are shown in FIG. Figure 2 The ethanol concentration for high-throughput screening was determined to be 30% (v / v), and sodium acetate buffer (0.1 M, pH 7) was used as the supplementary solvent.

[0090] Table 1

[0091]

[0092] (3) KnowVolution directed evolution phase I: Generate diversity of the CBHI gene by Casting epPCR (cepPCR), and divide the CBHI gene into 8 almost uniform cepPCR fragments (f1: 190 bp, f2: 200 bp, f3: 200 bp, f4: 200 bp, f5: 214 bp, f6: 214 bp, f7: 206 bp, f8: 215 bp); amplify the 8 cepPCR fragments using the primer pairs in Table 2, and then use the cepPCR products as large primers to amplify the entire plasmid; the entire plasmid amplification mixture (50 μL) contains: 25 μL PrimeSTAR Mix DNA polymerase, 500 ng of the cepPCR fragment obtained as described above, 60 ng of the vector template pBSYA1S1Z-wild-type CBHI; the PCR program was: 94°C for 2 min (1 cycle); 94°C for 30 s, 55°C for 30 s, 68°C for 3 min (25 cycles); 68°C for 10 min (1 cycle); the PCR product was digested with DpnI (20 U, 37°C, overnight) and purified; subsequently, 3 ng of the purified plasmid product was transformed into 80 μL of Pichia pastoris competent cells according to the method in step (1), and the cells were plated on YPD plates containing 100 μg / mL bleomycin. A single clone from each library was selected in a 96-well plate, and after culture and expression, it was screened by a high-throughput screening system (ethanol concentration of 30%, v / v) to obtain mutant strains with improved ethanol resistance; after screening 3500 clones, 6 beneficial CBHI variants with 1-5 amino acid substitutions were identified, as shown in Tables 3 and Figure 3 Compared with wild-type CBHI (WT), all CBHI variants showed 1.05-1.25-fold improvement in ethanol resistance.

[0093] Table 2 Primers used for cepPCR of CBHI gene in pBSYA1S1Z

[0094]

[0095]

[0096] Table 3

[0097] Variants Substitution site Ethanol resistance relative to wild-type CBHI I1 P227T / C243G / G244S / T255I / P258S 1.05 I2 E335G 1.09 I3 T271A / F273S / T292A / Q306R / F311L 1.11 I4 I203N / H206R / I221V 1.15 I5 G53R 1.16 I6 F273L / G298C 1.25

[0098] (4) KnowVolution directed evolution phase II: A site-saturation mutagenesis library was generated at P227, C243, G244, T255, P258, I203, H206, I221, F273, G298, G53, T271, F273, T292, Q306, F311, and E335 of wild-type CBHI by the 20c-Tang method; by designing a combination of primers to create codons encoding 20 standard amino acids, each of which contains exactly one codon, it is possible to construct an SSM library with minimal redundancy. According to the number of amino acids encoded, the four linked codons of NDT (N, S, I, H, R, L, Y, C, F, D, G, and W), VMA (E, A, Q, P, K, and T), ATG (M), and TGG (W) were mixed in a ratio of 12:6:1:1; SSM The PCR mixture system (50 μL) contained: 2 μL F / R mixed primers, 25 μL PrimeSTAR Mix DNA polymerase (purchased from Takara, product number R045Q) and 30 ng pBSYA1S1Z-wild-type CBHI template; for each target amino acid position, the reaction mixture was divided into two tubes, and the forward primer or reverse primer (10 μm) was added to each tube. The PCR was first performed using the following program: 98°C for 3 min, 98°C for 10 s, 55°C for 30 s, and 72°C for 120 s (3 cycles). The forward and reverse reaction products were combined, and the PCR was continued: 98°C for 3 min, 98°C for 10 s, 55°C for 30 s, and 72°C for 3 min (15 cycles), and 72°C for 10 min. The PCR product was then digested with DpnI (20 U, 37°C, overnight). Subsequently, 3 ng The PCR product was transformed into 80 μL Pichia pastoris competent cells according to the method in step (1), and the cells were placed on YPD plates containing 100 μg / mL bleomycin. The CBHI activity was determined using the substrate Res-CB in 0.1 M sodium acetate buffer adjusted to pH 7. The results are shown in Figure 4 As shown in Table 4, eight substitutions (I203Y, I203N, P258R, Q306T, F311N, E335Y, E335N, E335Q) at five beneficial positions of CBHI were obtained, which enhanced the ethanol resistance of CBHI variants compared with the wild-type CBHI (WT).

[0099] Table 4

[0100]

[0101] (5) KnowVolution directed evolution phase III: The CBHI beneficial substitution sites (I203, P258, Q306, F311, E335) determined from step (4) were visualized in the CBHI structure, see Figure 5 , and are likely to be selected for recombination studies, among which P258 is located in the loop, I203, Q306 and F311 are located at the junction of the β-sheet and the loop, E335 is located in the α-helix, Q306 and F311 are adjacent to each other, and the rest are far apart, and polar and / or charged amino acids are mainly introduced into the most favorable replacements; in detail, I203 and F311 are both mutated from non-polar amino acids to polar amino acids, P258 is mutated from a non-polar amino acid to a positively charged amino acid, and E335 is mutated from a negatively charged amino acid to a polar uncharged amino acid; based on the positional characteristics, the double gene recombination process (2GenReP) is used for replacement recombination, because 2GenReP, as a recombination method, can minimize the experimental workload and maximize the improvement effect, and is an ideal strategy for exploring the recombination potential of amino acid positions / substitutions determined in directed evolution and / or rational design.

[0102] (6) KnowVolution directed evolution stage IV: According to the 2GenReP rule, beneficial substitutions will be placed in the following two subsets: isolated substitutions: grouping substitutions of amino acids with a distance greater than 9 on the sequence; clustered substitutions: grouping substitutions of amino acids with a distance less than or equal to 9 on the sequence; According to the above classification method, the 8 substitutions obtained are divided into the following two subsets: Subset 1 includes 6 isolated substitutions (I203Y, I203N, P258R, E335Y, E335N, E335 Q); subset 2 included two clustered substitutions (Q306T, F311N); in 2GenReP, the "best" recombinant Q3 (E335Q / I203N / P258R) determined from subset 1 was selected as the parent for the next step of recombination with subset 2, resulting in the highly improved CBHI recombinants Q4 (E335Q / I203N / P258R / Q306T) and CBHI recombinants Q5 (E335Q / I203N / P258R / Q306T / F311N).

[0103] Recombination was performed using the SDM method. The SDM PCR mixture system (50 μL) contained: 25 μL PrimeSTAR Mix DNA polymerase (purchased from Takara, product number R045Q) and 30 ng of pBSYA1S1Z-wild-type CBHI template; for each target amino acid position, the reaction mixture was divided into two tubes, and a forward primer or a reverse primer (10 μM) was added to each tube, as shown in Table 5. First, PCR was performed using the following program: 98°C for 3 min, 98°C for 10 s, 55°C for 30 s, and 72°C for 120 s (3 cycles). The forward and reverse reaction products were combined, and PCR was continued: 98°C for 3 min, 98°C for 10 s, 55°C for 30 s, and 72°C for 3 min (15 cycles), and 72°C for 10 min. The PCR product was then digested with DpnI (20 U, 37°C, overnight). Subsequently, 3 ng The PCR product was transformed into 80 μL of Pichia pastoris competent cells according to the method in step (1), and the cells were cultured on YPD plates containing 100 μg / mL bleomycin. The cells were then inoculated into 96-well plates and fermented at 900 rpm, 25°C for 96 h. The supernatant enzyme solution was obtained after centrifugation. The ethanol resistance of CBHI was determined according to the method in step (2) using the substrate Res-CB in 0.1 M sodium acetate buffer adjusted to pH 7. As shown in Table 6, compared with wild-type CBHI (WT), the ethanol resistance of recombinant Q4 (amino acid sequence shown in SEQ ID NO. 1, nucleotide sequence shown in SEQ ID NO. 3) was increased by 1.57 times, and the ethanol resistance of recombinant Q5 (amino acid sequence shown in SEQ ID NO. 2, nucleotide sequence shown in SEQ ID NO. 4) was increased by 2.05 times.

[0104] Table 5 Table 6

[0105]

[0106] Example 2

[0107] After seed culture, yeast S. cerevisiae was inoculated into 120 mL of YPD medium containing 100 g / L glucose at an inoculum size of 2% (v / v), and grown at a temperature of 30° C. and a rotation speed of 150 rpm for 24 h to obtain a yeast culture solution; corn flour was mixed with a certain amount of water to a solution with a dry matter concentration of 30 wt%, α-amylase was added (the addition amount was 0.012% of the dry weight of the corn), the pH was adjusted to 4.3-4.4, and the solution was liquefied at a temperature of 89° C. for 3 h to obtain Corn liquefaction liquid; the pH of the corn liquefaction liquid was adjusted to 3.8-4.0, and a mixed enzyme formed by CBHI recombinant Q4 and commercial blue cellulase (purchased from Blue Biotechnology Co., Ltd., No. GFY-4309) was added (the amount of the mixed enzyme added was 0.0325% of the dry weight of the corn, wherein the ratio of CBHI enzyme activity of CBHI recombinant Q4 to commercial blue cellulase was 1:1) and urea (added at 0.12% of the dry weight of the corn), and a cerevisiae culture solution was added to make the concentration of cerevisiae 2.5×10 8 / mL, and fermented at a temperature of 30°C and a rotation speed of 150 rpm for 72 h to obtain a fermentation liquid;

[0108] The fermentation broth was treated with 11% (w / w) dilute sulfuric acid for 90 minutes at a temperature of 82°C and a pressure of 0.05-0.06 MPa to obtain vinasse. The vinasse containing 30% glucan was mixed with 4.5% (w / w) and returned to the initial liquefaction stage. α-amylase was added for liquefaction for 3 hours, and then saccharifying enzyme, urea and brewer's yeast were added for simultaneous fermentation and conversion of corn starch and corn fiber.

[0109] Example 3

[0110] Solid-state fermentation of Saccharomyces cerevisiae was carried out according to the method of Example 2, except that the CBHI recombinant Q4 (E335Q / I203N / P258R / Q306T) was replaced by CBHI recombinant Q5 (E335Q / I203N / P258R / Q306T / F311N).

[0111] Example 4

[0112] Solid-state fermentation of Saccharomyces cerevisiae was carried out according to the method of Example 2, except that the mixed enzyme was replaced with a mixed enzyme of CBHI recombinant Q4, CBHI recombinant Q5 and commercial cerulean cellulase, wherein the ratio of the total CBHI enzyme activity of CBHI recombinant Q4 and Q5 to the CBHI enzyme activity of commercial cerulean cellulase was 1:1, and the ratio of the CBHI enzyme activity of CBHI recombinant Q4 to Q5 was 1:1.

[0113] Comparative Example 1

[0114] Solid-state fermentation of Saccharomyces cerevisiae was carried out according to the method of Example 2, except that the CBHI recombinant Q4 (E335Q / I203N / P258R / Q306T) was replaced by wild-type CBHI.

[0115] Comparative Example 2

[0116] Solid-state fermentation of Saccharomyces cerevisiae was carried out according to the method of Example 2, except that the enzyme mixture formed by CBHI recombinant Q4 (E335Q / I203N / P258R / Q306T) and commercial cerulean cellulase was not added.

[0117] Comparative Example 3

[0118] Solid-state fermentation of Saccharomyces cerevisiae was carried out according to the method of Example 2, except that the mixed enzyme was replaced with commercial blue cellulase (purchased from Blue Biotechnology Co., Ltd., No. GFY-4309), and the addition amount of commercial blue cellulase was 0.0325% of the dry weight of corn.

[0119] Test Case

[0120] For Examples 2-4 and Comparative Examples 1-3, the glucose and ethanol concentrations in the fermentation broth after fermentation were analyzed by high-performance liquid chromatography, and the ethanol yield was calculated according to the following formula. The results are shown in Table 7. The theoretical glucose yield of glucan is 1.111 g glucose / g glucan, and the ethanol yield is determined based on the theoretical ethanol yield of the consumed glucose, i.e., 0.51 g ethanol / g sugar. The glucan content in the corn flour raw material was determined as follows: 0.3 g corn flour was mixed with 3 mL of a 72 wt% sulfuric acid solution, stirred at 30° C. and 50 rpm for 1 hour, and then 84 mL of water was added. The mixture was reacted at 121° C. for 1 hour, and the glucan content in the corn flour was determined by high-performance liquid chromatography.

[0121]

[0122] Table 7

[0123]

[0124] As can be seen from the data in Table 7, compared with Comparative Example 2 (non-cellulase fermentation), the ethanol concentration and relative ethanol yield in Examples 2-4 were significantly improved. Glucose was almost completely consumed after 72 hours of fermentation. The final ethanol concentration of Comparative Example 1 was 82.45 g / L, which was 2.45 g / L higher than that of Comparative Example 3. The ethanol concentrations of Examples 2 and 3 were 88.34 g / L and 90.02 g / L, respectively, which were 8.34 g / L and 10.02 g / L higher than those of Comparative Example 3, respectively. It is reasonable to observe that the CBHI recombinants Q4 and Q5 have high ethanol resistance, which in turn significantly increases the relative ethanol yield. In Example 4, the simultaneous use of CBHI recombinants Q4 and Q5 increased the ethanol concentration by 14.66 g / L and the relative ethanol yield by 9% compared with the commercial blue cellulase in Comparative Example 3, indicating that the powerful CBHI recombinants designed by Know Volution promote cellulose hydrolysis by offsetting the adverse effects of accumulated ethanol in the fermentation environment, thereby increasing ethanol yield.

[0125] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention.

Claims

1. An exoglucanase mutant, characterized in that The amino acid sequence of the exoglucanase mutant is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. A gene encoding the exoglucanase mutant according to claim 1.

3. The gene according to claim 2, characterized in that The gene encodes an enzyme with an amino acid sequence as shown in SEQ ID NO.1, and a nucleotide sequence as shown in SEQ ID NO.

3.

4. The gene according to claim 2, characterized in that The gene encodes an enzyme with an amino acid sequence as shown in SEQ ID NO.2, and a nucleotide sequence as shown in SEQ ID NO.

4.

5. A recombinant vector, characterized in that The recombinant vector contains the gene according to any one of claims 2 to 4.

6. The recombinant vector according to claim 5, characterized in that The expression vector of the recombinant vector is pBSYA1S1Z plasmid.

7. A recombinant strain, characterized in that The recombinant strain contains the gene according to any one of claims 2 to 4 or the recombinant vector according to claim 5 or 6.

8. The recombinant strain according to claim 7, characterized in that The host bacteria of the recombinant strain is Pichia pastoris BSYBG11.

9. A method for preparing an exoglucanase mutant, characterized in that: The preparation method comprises: inoculating the recombinant strain according to claim 7 or 8 into a fermentation medium for fermentation to obtain a fermentation liquid, and separating and purifying the fermentation liquid to obtain an exoglucanase mutant.

10. An enzyme preparation, characterized in that The enzyme preparation comprises the exoglucanase mutant prepared by the method according to claim 9.

11. Use of the exoglucanase mutant according to claim 1, the gene according to any one of claims 2 to 4, the recombinant vector according to claim 5 or 6, the recombinant strain according to claim 7 or 8, the exoglucanase mutant prepared by the method according to claim 9, or the enzyme preparation according to claim 10 in degrading cellulose and / or producing bioethanol.