A CRISPR / Cas12a-based novel coronavirus nucleic acid instant detection system and method thereof
By combining CRISPR/Cas12a isothermal amplification technology with a single-stranded DNA reporter system, using lyophilization technology to preserve reagents, and combining it with lateral flow chromatography test strips, the limitations of nucleic acid detection equipment dependence and low-temperature storage and transportation have been solved, enabling rapid and convenient instant nucleic acid detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TIANJIN UNIVERSITY OF TECHNOLOGY
- Filing Date
- 2023-03-21
- Publication Date
- 2026-05-01
AI Technical Summary
Existing nucleic acid testing methods require specialized equipment and are complex to operate. Furthermore, the low-temperature storage and transportation of nucleic acid testing reagents limit their application scope, making it difficult to achieve rapid, convenient, and instant testing.
This invention combines CRISPR/Cas12a-based isothermal amplification technology with a single-stranded DNA reporter system, uses lyophilization to preserve reagents, and combines lateral flow chromatography test strips for detection, simplifying the operation process and enabling room temperature storage and transportation.
It enables rapid and visual detection at 37℃, with accurate and reliable results. It simplifies the operation process, reduces equipment dependence, is suitable for primary healthcare and home self-testing, and reduces transportation costs.
Smart Images

Figure CN116334312B_ABST
Abstract
Description
A CRISPR / Cas12a-based rapid nucleic acid detection system and method for novel coronavirus. Technical Field
[0001] This invention relates to the field of nucleic acid detection technology in biochemistry, and in particular to a CRISPR / Cas12a-based system and method for the rapid detection of novel coronavirus nucleic acid. Background Technology
[0002] The main methods for detecting COVID-19 include nucleic acid testing and antigen-antibody testing. Antigen-antibody testing is efficient and convenient, but due to the lag in antibody testing within a window period, antigen testing has poor sensitivity and low accuracy, therefore it cannot be used for early diagnosis. Nucleic acid testing, as the primary means of screening, diagnosing, and monitoring COVID-19 infection, can detect infected individuals in the window period, enabling early detection. However, the most common nucleic acid testing method currently is reverse transcription real-time quantitative PCR. This method requires a thermal cycler with high temperature control precision, and the necessary denaturation, annealing, and extension steps make the entire amplification and detection process time-consuming (~2 hours), making it difficult to achieve rapid on-site detection of nucleic acid molecules. There is an urgent need for a rapid, equipment-free, and directly interpretable testing method that can meet the needs of primary healthcare, infectious disease control, medical testing in remote areas, and personalized home diagnosis.
[0003] Isothermal amplification involves exponential amplification of the target template under the combined action of recombinases and other enzymes. It eliminates the need for temperature cycling, simplifying the requirements for specialized equipment and overcoming the limitations of traditional PCR detection techniques, such as equipment dependence and long detection cycles. Therefore, it has significant practical application value in point-of-care nucleic acid detection. However, when directly applied to point-of-care nucleic acid detection, this amplification technology still suffers from low amplification efficiency, insufficient detection sensitivity, long reaction time, and non-specific amplification. The CRISPR / Cas system, with its gene-editing capabilities, is also widely used in molecular diagnostics. crRNA guides Cas12a to specifically recognize and cleave the target nucleic acid sequence, while simultaneously activating the trans-cleavage activity of Cas12a, i.e., the non-specific cleavage of single-stranded DNA probes in the Cas12a system. By capturing the probe signal, the presence of the target virus in the sample can be determined. Combining isothermal amplification technology with a Cas12a enzyme digestion signal amplification system can improve the sensitivity and specificity of nucleic acid detection, overcoming the low efficiency of single amplification methods. However, this method requires multiple pipetting and sample loading steps, making it complex and requiring not only laboratory equipment such as pipettes and centrifuges but also trained personnel. In addition, most of the reagents required for the reaction need to be stored at -20°C, which also limits the promotion and application of this detection method.
[0004] In experiments, various nucleic acid detection reagents were stored independently in low-temperature environments, requiring on-site preparation for use, which was complex and prone to cross-contamination. Furthermore, the transportation of nucleic acid detection reagents also required low-temperature environments, limiting real-time nucleic acid testing. To overcome the limitations of low-temperature storage and transportation of nucleic acid detection reagents, continuous exploration of preservation methods is needed to achieve room-temperature storage and transportation. Summary of the Invention
[0005] To address the limitations of low-temperature storage and transportation in existing nucleic acid detection reagents, this invention provides a CRISPR / Cas12a-based system and method for rapid nucleic acid detection of the novel coronavirus.
[0006] The first aspect provides a CRISPR / Cas12a-based system for the rapid detection of novel coronavirus nucleic acid, the system comprising isothermal amplification primers and a CRISPR / Cas12a reaction system suitable for rapid detection of novel coronavirus;
[0007] The isothermal amplification primers are specific isothermal amplification primers against the N gene of the novel coronavirus; the isothermal amplification primers are NF / R, and the nucleic acid sequence is:
[0008] Primer sequences (5'-3') No.1 N-FAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAAT No.2 N-RTTGGCCTTTACCAGACATTTTGCTCTCAAGCTG surface
[0009] The CRISPR / Cas12a reaction system includes: specific crRNA targeting the N gene of the novel coronavirus, CRISPR / Cas12a protein, and a single-stranded DNA reporter system;
[0010] The specific crRNA is N-crRNA1, and the nucleotide sequence of N-crRNA1 is as follows:
[0011]
[0012] The single-stranded DNA reporter system includes a fluorescent probe FB for detection using a lateral flow chromatography test strip, wherein the fluorescent probe FB is 5'-FAM-TTATTATT-Biotin-3', or a fluorescent probe FQ for fluorescence detection, wherein the fluorescent probe FQ is 5'-FAM-CCCCCC-BHQ1-3'.
[0013] Furthermore, the lateral flow chromatography test strip includes a base plate on which a nitrocellulose membrane, a gold-labeled pad, a sample pad, and an absorbent pad are sequentially adhered. The gold-labeled pad is coated with an anti-fluorescein antibody labeled with colloidal gold. The nitrocellulose membrane is coated with a control line composed of streptavidin and a detection line composed of goat anti-mouse IgG antibody.
[0014] Furthermore, the preparation method of the side-flow chromatography test strip includes the following steps:
[0015] (1) Preparation of colloidal gold nanoparticles by reducing tetrachloroauric acid with sodium citrate;
[0016] (2) Prepare gold-labeled antibodies using the colloidal gold mixed antifluorescein antibody prepared in step (1);
[0017] (3) The gold-labeled antibody prepared in step (2) is evenly coated onto the glass fiber material to prepare a gold-labeled pad;
[0018] (4) Use a pen to pick up streptavidin and goat anti-mouse IgG antibody respectively, and draw C line and T line on nitrocellulose membrane;
[0019] (5) Assemble the test strip: Assemble the PVC substrate, nitrocellulose membrane, gold label pad, sample pad, and absorbent pad layer by layer, and cut them into appropriate sizes for direct use in testing.
[0020] The second aspect provides a method for rapid detection of novel coronavirus nucleic acid based on CRISPR / Cas12a, including the following steps:
[0021] (1) Extract nucleic acid from the sample to be tested;
[0022] (2) Amplify the target fragment in the sample to be tested using the isothermal amplification primers: using the nucleic acid extracted in step (1) as a template, add the isothermal amplification primers to the isothermal amplification system and perform isothermal amplification to obtain specific amplification products;
[0023] (3) Detection of novel coronavirus nucleic acid in samples using the CRISPR / Cas12a reaction system: The specific amplification product prepared in step (2) is added to the CRISPR / Cas12a reaction system and amplified at isothermal temperature. The reaction product is detected by side-flow chromatography test strip or fluorescence detection method.
[0024] Furthermore, both the isothermal amplification system and the CRISPR / Cas12a reaction system are lyophilized reagents.
[0025] Furthermore, the preparation method of the lyophilized reagent includes the following steps:
[0026] (1) Prepare a constant temperature amplification lyophilization system by mixing and lyophilizing the constant temperature amplification primers, enzymes, magnesium acetate and buffer under lyophilization conditions.
[0027] (2) Configure the CRISPR / Cas12a lyophilization system by mixing and lyophilizing the specific crRNA, CRISPR / Cas12a protein, single-stranded DNA reporter system, buffer and lyophilization protectant under lyophilization conditions.
[0028] Furthermore, the freeze-drying conditions include freezing at -80°C for 20 minutes, followed by freeze-drying in a freeze dryer for 5 hours.
[0029] Furthermore, the lyophilization reagent includes a lyophilization protectant, which is composed of one or both of sucrose or glycine.
[0030] Furthermore, the freeze-drying protectant is composed of sucrose and glycine, with a mass ratio of 20:1 for sucrose and glycine.
[0031] The advantages of this invention are:
[0032] The isothermal amplification-CRISPR / Cas12a lateral flow chromatography test strip detection method of the present invention can achieve visual detection in about 35 minutes, with accurate and reliable results; Negative (-): Red bands appear on both the control line and the test line, proving that there is no novel coronavirus nucleic acid in the test sample; Positive (+): A red band appears on the test line, while the control line has no red band or a very faint band, proving that there is novel coronavirus nucleic acid in the test sample; The isothermal amplification-CRISPR / Cas12a lateral flow chromatography test strip detection method has high specificity and sensitivity, and the primers only amplify the target amplification region; The mixed lyophilized isothermal amplification reagent and the mixed lyophilized CRISPR / Cas12a reagent simplify the operation process and speed up the experimental process; At the same time, the lyophilized reagent eliminates the need for cold chain transportation, saves transportation costs, and promotes the progress of point-of-care testing; The test strip is simple to make and low in cost; Overall, it has a wide range of applications. The present invention does not require large-scale instruments and equipment, and the reaction can be carried out under a constant temperature of 37°C. The results are easy to interpret and visible to the naked eye, making it suitable for home nucleic acid self-testing. Attached Figure Description
[0033] Figure 1 is a schematic diagram of the assembly structure of the side-flow chromatography test strip of the present invention;
[0034] Figure 2 shows the detection results of the side-flow chromatography test strip of the present invention in the CRISPR / Cas12a reaction system;
[0035] Figure 3 is a comparison of fluorescence detection between the isothermal amplification-CRISPR / Cas12a of the present invention and single CRISPR / Cas12a;
[0036] Figure 4 shows the lyophilized morphology of the reagents in the isothermal amplification system of the present invention.
[0037] Figure 5 is a comparison of fluorescence detection of the amplification effect of the isothermal amplification system of the present invention before and after lyophilization;
[0038] Figure 6 is a comparison of the protective effects of the CRISPR / Cas12a freeze-drying protectant of the present invention;
[0039] Figure 7 shows the detection results of the CRISPR / Cas12a lyophilized reagent of the present invention stored at 4°C;
[0040] Figure 8 shows the detection results of the CRISPR / Cas12a lyophilized reagent of the present invention stored at room temperature;
[0041] Figure 9 shows the detection results of the lyophilized isothermal amplification and lyophilized CRISPR / Cas12a side-flow chromatography test strips of the present invention.
[0042] Figure 10 shows the sensitivity detection results of the lyophilized isothermal amplification and lyophilized CRISPR / Cas12a sideflow chromatography test strips of the present invention.
[0043] Figure 11 is a schematic diagram of the overall process of a CRISPR / Cas12a-based method for rapid detection of novel coronavirus nucleic acid according to the present invention.
[0044] Explanation of reference numerals in the attached figures
[0045] 1. PVC substrate; 2. Sample pad; 3. Gold label pad; 4. Nitrocellulose membrane; 5. Absorbent pad; 6. C-line; 7. T-line. Detailed Implementation
[0046] The specific embodiments of the present invention will be described below with reference to the examples of the present invention. Unless otherwise specified, the technical means used in the following embodiments and experimental examples are conventional means well known to those skilled in the art, and the materials and reagents used can all be obtained commercially.
[0047] Example 1: A method for the immediate detection of novel coronavirus nucleic acid using a lateral flow chromatography test strip based on CRISPR / Cas12a.
[0048] 1.1. Construction of colloidal gold side-flow chromatography test strips
[0049] Referring to Figure 1, the lateral flow chromatography test strip includes a PVC substrate, a sample pad, a gold-labeled pad, a nitrocellulose membrane, and an absorbent pad. C-lines and T-lines are drawn on the nitrocellulose membrane. The C-line is coated with streptavidin, and the T-line is coated with goat anti-mouse IgG. The gold-labeled pad is coated with a gold-labeled antibody (anti-fluorescein antibody-colloidal gold).
[0050] (1) 13 nm colloidal gold nanoparticles were prepared by reducing tetrachloroauric acid with sodium citrate.
[0051] (2) Take 1 mL of the colloidal gold mixture prepared in step (1) with a concentration of 1 mg / mL and 1 μL of antifluorescein antibody to prepare gold-labeled antibody;
[0052] (3) The gold-labeled antibody prepared in step (2) is evenly coated onto the glass fiber material to prepare the gold-labeled pad;
[0053] (4) Dip a pen in streptavidin and secondary antibody respectively, and draw C line and T line on nitrocellulose membrane;
[0054] (5) Assemble the test strip: Assemble the base plate, nitrocellulose membrane, gold label pad, sample pad, and absorption pad layer by layer, and cut them into appropriate sizes for direct use in testing.
[0055] When the target nucleic acid sequence is available, the single-stranded DNA (ssDNA) fluorescent probe is cleaved after isothermal amplification-CRISPR / Cas12a reaction. The biotin and fluorescein modified at both ends of the probe are separated. The prepared lateral flow chromatography test strip is then inserted into the above reaction solution for detection. Because the probe is cleaved, the streptavidin in line C cannot capture the gold-labeled antibody through biotin, so line C is colorless. The IgG antibody in line T binds to the gold-labeled antibody and appears red.
[0056] When the target nucleic acid sequence is unavailable, after isothermal amplification-CRISPR / Cas12a reaction, the ssDNA fluorescent probe is not cleaved, and biotin and luciferin do not separate. Streptavidin in line C captures the gold-labeled antibody via biotin, resulting in color on line C. Excess gold-labeled antibody binds to the goat anti-mouse IgG antibody in line T, displaying a red color. Therefore, when the target is present, only line T appears; when the target is absent, both lines C and T appear simultaneously. If line T does not appear, the test strip is invalid.
[0057] 1.2. Synthesis of single-stranded DNA fluorescent reporter probes
[0058] The single-stranded DNA probe sequence was labeled with a FAM fluorescent group and a biotin group at both ends, respectively. The FB reporter probe sequence was 5'-FAM-TTATTATT-Biotin-3', synthesized by Shanghai Sangon Biotech Co., Ltd. 1.3. Establishment of a CRISPR / Cas12a-based lateral flow chromatography test strip detection method.
[0059] Referring to Figure 2, a CRISPR / Cas12a lateral flow chromatography test strip detection method was established using the crRNA1 complementary sequence as a positive standard.
[0060] A CRISPR / Cas12a reaction system was prepared, including Lbcas12a (60 nM), crRNA1 (100 nM), FB probe (50 nM), NEBuffer 2.1 buffer solution (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, 100 μg / mL BSA, pH 7.9), and crRNA1 complement (10 nM). The prepared system was incubated at 37°C for 10 min, and then water was added before detection using a side-flow chromatography test strip. After five minutes, the C and T lines on the test strip were observed visually.
[0061] Result interpretation: If there is no red band on line C and a red band on line T, it indicates that the test strip of the present invention can be used for detection by the CRISPR / Cas12a method.
[0062] Example 2: Construction of a novel coronavirus nucleic acid detection method based on isothermal amplification and CRISPR / Cas12a 2.1 Analysis of novel coronavirus gene sequence to identify novel coronavirus CRISPR / Cas12a detection targets
[0063] The N gene fragment of the novel coronavirus was selected as the target sequence, with a length of 316 bp. The nucleotide sequence is shown in Table 1.
[0064] Table 1 Target Sequences
[0065]
[0066] 2.2 Design and synthesis of isothermal amplification primers.
[0067] Table 2 Primer sequences for isothermal amplification
[0068]
[0069]
[0070] The isothermal amplification primer sequences were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0071] 2.3 Isothermal Amplification Reaction
[0072] The target gene was amplified using an isothermal amplification kit (AMPLIFICATION FUTURE, China). An isothermal amplification system was prepared, including primers NF (480 nM), NR (480 nM), magnesium acetate (14 mM), the target gene, buffer solution, and dry powder reagent. The mixture was thoroughly combined and incubated at 37°C for 15 min. The product was stored at 4°C. The dry powder reagent was provided with the isothermal amplification kit (AMPLIFICATION FUTURE, China).
[0073] 2.4 Design and synthesis of crRNA and crRNA1 complementary sequences
[0074] Design and synthesize the corresponding crRNA
[0075]
[0076] N-crRNA1 is used to detect the N gene of SARS-CoV-2.
[0077] crRNA1 and crRNA1 complementation are used to verify the Cas12a reaction and lyophilization conditions.
[0078] 2.5 Comparison of fluorescence detection of single CRISPR / Cas12a and fluorescence detection of isothermal amplification-CRISPR / Cas12a
[0079] 2.5.1 Single CRISPR / Cas12a fluorescence detection method
[0080] The positive plasmid of the novel coronavirus N gene was used as a standard to evaluate the fluorescence detection method of CRISPR / Cas12a.
[0081] Configure the CRISPR / Cas12a reaction system, including Lbcas12a (100 nM), N-crRNA1 (100 nM), FQ probe (2 μM), buffer, and target to be tested. Place the configured system in a gene amplification instrument (Hangzhou Baiheng GE4832T), set the temperature to 37℃, react for 30 min, then add water and measure with a fluorescence spectrophotometer.
[0082] 2.5.2 Isothermal Amplification-CRISPR / Cas12a Fluorescence Detection Method
[0083] The positive plasmid of the novel coronavirus N gene (concentration of 10) 6 Copies / μL) were used as standards to evaluate the isothermal amplification-CRISPR / Cas12a fluorescence detection method.
[0084] First, the isothermal amplification system was prepared according to 2.3. 2 μL of positive plasmid standard was added and reacted at 37℃ for 15 min. Then, the CRISPR / Cas12a reaction system was prepared, including LbCas12a (100 nM), N-crRNA1 (100 nM), FQ probe (2 μM), buffer, and amplification reaction products. The reaction was continued for 15 min. Finally, the results were detected using a fluorescence spectrophotometer and compared with the results of single CRISPR / Cas12a detection.
[0085] Referring to Figure 3, the isothermal amplification-CRISPR / Cas12a method significantly improves the detection signal of the target and can further enhance the sensitivity of nucleic acid detection.
[0086] Example 3: Method for detecting novel coronavirus based on lyophilized isothermal amplification-CRISPR / Cas12a sideflow chromatography test strips
[0087] 3.1 Lyophilization of reagents for isothermal amplification system
[0088] Referring to Figures 4 and 5, the positive plasmid of the novel coronavirus N gene was used as a standard to evaluate the mixed lyophilized isothermal amplification method.
[0089] Prepare the lyophilization system according to the isothermal amplification system in section 2.3, except for the nucleic acid to be tested. Mix the isothermal amplification reagents, divide the prepared system into three equal portions and lyophilize them. The morphology after lyophilization is shown in Figure 4. The lyophilization conditions are: freezing at -80℃ for 20 minutes, followed by lyophilization in a lyophilizer for 5 hours. The temperature during the lyophilization process is -60℃ to -50℃.
[0090] The lyophilized reagents in Figure 4 were selected as experimental items. The difference between control item 1 and the experimental item was that the un-lyophilized reagents were used. The difference between control item 2 and the experimental item was that magnesium acetate was not added. The lyophilized reagents of the experimental item, control item 1 and control item 2 were added with 1×SYBR Green I. The amplification efficiency of the enzyme before and after lyophilization was evaluated by real-time quantitative PCR instrument (QuantStudio 3) at a constant temperature of 37℃. The results are shown in Figure 5. The time period of the fluorescence signal appearance of the experimental item and control item 1 is parallel. Therefore, the lyophilization of the reagents in the isothermal amplification system does not affect the detection of fluorescence signal.
[0091] 3.2 Lyophilization of CRISPR / Cas12a System Reagents
[0092] 3.2.1 Screening of Protectants for Lyophilization of CRISPR / Cas12a System
[0093] Referring to Figure 6, the crRNA1 complementary sequence was used as a standard to evaluate the protective effect of the CRISPR / Cas12a mixed reagent lyophilization protectant.
[0094] A CRISPR / Cas12a lyophilization system was prepared, including Lbcas12a (30 nM), crRNA1 (100 nM), FQ probe (1 μM), lyophilization protectant, and NEBuffer 2.1. After freezing at -80°C for 20 min, the mixture was transferred to a freeze dryer and lyophilized for 5 hours at a temperature ranging from -60°C to -50°C. The lyophilized components were then tagged with the crRNA1 complementary sequence.
[0095] The activity of CRISPR / Cas12a enzyme was measured by real-time fluorescence analysis using a quantitative real-time PCR instrument (QuantStudio 3) at a constant temperature of 37℃. The fluorescence recovery rate was compared to evaluate the enzyme activity.
[0096] CRISPR / Cas12a lyophilization systems with three different preservatives were selected. In Experiment 1, 2 mg of sucrose was selected as the preservative. In Experiment 2, 0.1 mg of glycine was selected as the preservative. In Control 3, no lyophilization preservative was selected.
[0097] The CRISPR / Cas12a lyophilized reagents of Experiment 1-2 and Control 3 were used for real-time fluorescence analysis at 37℃ using a real-time fluorescence quantitative PCR instrument. The results are shown in Figure 6. The fluorescence signal intensity of Experiment 1 and Experiment 2 was better than that of Control 3. Since no lyophilization protectant was added, there was no fluorescence signal intensity in Control 3.
[0098] Based on the above results, Experiment 3 was designed, combining the lyophilization protectants from Experiments 1 and 2. Protectant C was a mixture of sucrose and glycine, with a sucrose to glycine mass ratio of 20:1 (2 mg sucrose and 0.1 mg glycine). Real-time fluorescence analysis was performed using a real-time quantitative PCR instrument at a constant temperature of 37℃. Compared to Experiments 1 and 2, the fluorescence signal curve of Experiment 3 was higher than that of Experiments 1 and 2, and it reached the plateau phase earlier. Therefore, both sucrose and glycine can be used as lyophilization protectants, but a mixture of sucrose and glycine is preferred.
[0099] 3.2.2 Establishment of lyophilized storage conditions for CRISPR / Cas12a mixed reagents
[0100] Referring to Figures 7 and 8, crRNA1 complementation was used as a standard to evaluate the storage conditions for lyophilized CRISPR / Cas12a mixed reagents. The CRISPR / Cas12a lyophilized system was configured as described above, with the FQ probe replaced by the FB probe. Then, crRNA1 complementation was used to measure the enzyme activity of the lyophilized CRISPR / Cas12a system stored at 4℃ and room temperature. A comparison was made between the lyophilized and non-lyophilized systems. The detection method based on CRISPR / Cas12a lateral flow chromatography strips (section 1.3) was used for testing. The results are shown in Figures 7 and 8. The lyophilized CRISPR / Cas12a systems stored at 4℃ and room temperature on days 0, 7, 14, and 28, compared to the non-lyophilized reagents, all successfully completed the detection. Therefore, the lyophilized CRISPR / Cas12a system can be stored at either 4℃ or room temperature, and the storage time within 0-28 days has no impact on the detection results.
[0101] 3.3 Detection of Novel Coronavirus Nucleic Acid using Lyophilized Isothermal Amplification-CRISPR / Cas12a Sideflow Chromatography Strip
[0102] Referring to Figure 9, the positive plasmid of the novel coronavirus N gene was used as a standard, and the nucleic acid content of the positive group was 2 × 10⁻⁶. 3 Copies were used to evaluate the feasibility of using a hybrid lyophilized isothermal amplification and lyophilized CRISPR / Cas12a lateral flow chromatography strip for the detection of the novel coronavirus.
[0103] The reagents for the isothermal amplification system in section 3.1 and the CRISPR / Cas12a system in section 3.2 were prepared by lyophilization. First, the N gene plasmid was amplified at an isothermal temperature for 15 minutes. Then, the amplification product was added to the lyophilized CRISPR / Cas12a system and reacted for 15 minutes. Finally, water was added, and the results were detected using a side-flow chromatography test strip, as shown in Figure 9. The test results were normal.
[0104] 3.4 Sensitivity of Detection of Novel Coronavirus Nucleic Acid Using Lyophilized Isothermal Amplification-CRISPR / Cas12a Sideflow Chromatography Test Strip
[0105] Referring to Figure 10, the positive plasmid of the novel coronavirus N gene was used as a standard to evaluate the sensitivity of the mixed lyophilized isothermal amplification and lyophilized CRISPR / Cas12a side-flow chromatography test strips for detecting the novel coronavirus.
[0106] Prepare the reagents according to the lyophilization methods described in 3.1 for the isothermal amplification system and 3.2 for the CRISPR / Cas12a system. Dilute the standards 10×, from 2×10⁻⁶. 2 -2×10 0The N gene plasmid was first amplified at an incubator for 15 min. Then, the amplification product was added to a lyophilized CRISPR / Cas12a system and reacted for 15 min. Finally, water was added, and the sample was detected using a side-flow chromatography test strip, as shown in Figure 10. A detection rate of 2 × 10⁻⁶ copies / μL was achieved. 0 Nucleic acid with a copy / reaction concentration.
[0107] Working principle:
[0108] Referring to Figure 11, the sample was first collected and the nucleic acid to be tested was extracted. The nucleic acid to be tested was added to the isothermal amplification reaction system and amplified at 37℃ for 15 min. The isothermal amplification reaction system was prepared according to the lyophilization method of the isothermal amplification system reagent in 3.1 to obtain specific amplification products, which were then added to the CRISPR / Cas12a system. The CRISPR / Cas12a system was prepared according to the lyophilization reagent of the CRISPR / Cas12a system in 3.2. Fluorescence signal amplification was performed in the CRISPR / Cas12a system, and the detection of novel coronavirus nucleic acid was completed according to the lateral flow chromatography test strip based on lyophilized isothermal amplification-CRISPR / Cas12a in 3.3.
[0109] For those skilled in the art, the present invention is not limited to the details of the exemplary embodiments described above, and can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention; therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Therefore, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.
[0110] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any minor modifications, equivalent substitutions, and improvements made to the above embodiments based on the technical essence of the present invention should be included within the protection scope of the present invention.
Claims
1. A CRISPR / Cas12a-based rapid nucleic acid detection system for the novel coronavirus, characterized in that, The detection system includes isothermal amplification primers and a CRISPR / Cas12a reaction system suitable for the rapid detection of the novel coronavirus; the isothermal amplification primers are specific isothermal amplification primers for the N gene of the novel coronavirus; the isothermal amplification primers are NF / R, and the nucleic acid sequences are as follows: Primer sequence (5'-3') No1 NF AGGCAGCAGTAGGGGAACTTCTCCTGCTAGAAT No2 NR TTGGCCTTTACCAGACATTTTGCTCTCAAGCTG; the CRISPR / Cas12a reaction system includes: specific crRNA for the N gene of the novel coronavirus, CRISPR / Cas12a protein, and a single-stranded DNA reporter system; the specific crRNA is N-crRNA1, and the nucleotide sequence of N-crRNA1 is as follows: Primer sequence (5'-3') No3 N-crRNA1 UAAUUUCUACUAAGUGUAGAUCUGCUGCUU GACAG AUUGA A; The single-stranded DNA reporter system includes a fluorescent probe FB for detection using a lateral flow chromatography test strip, wherein the fluorescent probe FB is 5'-FAM-TTATTATT-Biotin-3', or a fluorescent probe FQ for fluorescence detection, wherein the fluorescent probe FQ is 5'-FAM-CCCCCC-BHQ1-3'; The detection system is a lyophilized reagent, and the lyophilized reagent contains a lyophilization protectant, wherein the lyophilization protectant is composed of sucrose and glycine, and the mass ratio of sucrose to glycine is 20:
1.
2. The novel coronavirus nucleic acid rapid detection system based on CRISPR / Cas12a according to claim 1, characterized in that, The lateral flow chromatography test strip includes a base plate on which a nitrocellulose membrane, a gold-labeled pad, a sample pad, and an absorbent pad are sequentially adhered. The gold-labeled pad is coated with an anti-fluorescein antibody labeled with colloidal gold. The nitrocellulose membrane is coated with a control line composed of streptavidin and a detection line composed of goat anti-mouse IgG antibody.
3. The novel coronavirus nucleic acid rapid detection system based on CRISPR / Cas12a according to claim 2, characterized in that, The preparation method of the side-flow chromatography test strip includes the following steps: (1) preparing colloidal gold nanoparticles by reducing tetrachloroauric acid with sodium citrate; (2) preparing gold-labeled antibodies by mixing colloidal gold with antifluorescein antibodies prepared in step (1); (3) uniformly coating the gold-labeled antibodies prepared in step (2) onto glass fiber material to prepare a gold-labeled pad; (4) using a pen to dip streptavidin and goat anti-mouse IgG antibodies respectively, and drawing C-lines and T-lines on the nitrocellulose membrane; (5) assembling the test strip: assembling the PVC substrate, nitrocellulose membrane, gold-labeled pad, sample pad, and absorbent pad layer by layer, and cutting them into appropriate sizes for direct detection.
Citation Information
Patent Citations
Novel coronavirus detection kit
CN111500792A
Method for rapidly detecting microorganisms, kit and use method
CN112899396A
Immunochromatography test strip and preparation method thereof
CN113834934A
Additive-assisted one-tube nucleic acid detection method
CN114908144A