Use of atractylenolide in preparation of a medicament for preventing or treating white spot syndrome in aquatic animals
By using drugs prepared with atractylodesin in aquatic animals, the problem of prevention and treatment of white spot syndrome virus in aquatic animals has been solved, efficient and safe virus inhibition and survival rate improvement have been achieved, and the application of atractylodesin in aquaculture has been expanded.
Patent Information
- Application Number
- CN202211674365.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-26
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2042-12-26
AI Technical Summary
Existing technologies are difficult to effectively prevent and control white spot syndrome virus in aquatic animals, and traditional drugs may have problems such as high toxicity, strong residual effects, and easy development of drug resistance.
Atractylodesin and its derivatives are used as active ingredients to prepare drugs for preventing or treating white spot syndrome in aquatic animals. The drugs can be injected into the abdomen to exert antiviral effects in aquatic animals, thereby improving immunity and inhibiting viral replication.
Atractylodesin significantly inhibits the replication of white spot syndrome virus in aquatic animals and improves survival rate. It has the characteristics of low toxicity, low residue, low cost, green and safe, providing a new path for green biological agents.
Smart Images

Figure CN116392468B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant-derived antiviral drugs, and specifically relates to the use of atractylodesin in preparing a drug for preventing or treating white spot syndrome in aquatic animals. Background Art
[0002] White spot syndrome is a major infectious disease of aquatic animals caused by white spot syndrome virus (WSSV)
[0003] In recent years, a range of environmentally friendly preparations and drugs, including immunopotentiators, Chinese herbal extracts, probiotics, and aquatic vaccines, have been widely used to prevent and control aquatic viruses. my country boasts abundant resources of Chinese herbal medicine, which have been a vital component of the development of Chinese medicine since ancient times. Many Chinese herbal medicines contain natural active ingredients such as organic acids, flavonoids, terpenes, saponins, and alkaloids. These herbs possess antiviral, immune-enhancing, and anti-stress properties, and can synergistically inhibit and kill pathogens through multiple targets and pathways. They are characterized by high safety, low residue levels, and resistance to drug resistance.
[0004] Therefore, innovative research on natural antiviral active ingredients is of great significance to meeting the urgent needs of the industry and ensuring the safety and environmental friendliness of aquatic products. Summary of the Invention
[0005] The purpose of the present invention is to provide a drug for preventing or treating white spot syndrome in aquatic animals, so as to effectively inhibit the white spot syndrome virus.
[0006] According to one aspect of the present invention, there is provided a method for preparing a drug for preventing or treating white spot syndrome in aquatic animals. Atractylodesin not only has multiple pharmacological activities such as promoting gastric emptying, anti-inflammatory, anti-tumor, hypoglycemic, and diuretic, but also has a simple structure and is cheap and easily available. Therefore, atractylodesin has broad prospects for developing new drugs as a lead compound. The purpose of the present invention is to explore the feasibility of atractylodesin in antiviral aquaculture and to open up new avenues for innovative research on antiviral green fishery medicines. The present invention provides an important theoretical basis for atractylodesin as an efficient and practical anti-WSSV drug, and therefore it is expected that atractylodesin can be developed into a drug for preventing or treating white spot syndrome in aquatic animals, and provides a meaningful reference for the evaluation of the antiviral effect of atractylodesin on other aquatic animal viruses and the study of its mechanism of action.
[0007] Preferably, it also includes the use of atractylodesin derivatives in the preparation of drugs for preventing or treating white spot syndrome in aquatic animals; the atractylodesin derivatives are selected from at least one of atractylodesin's pharmaceutically acceptable salts, esters, ethers, stereoisomers, and prodrug molecules.
[0008] Preferably, the aquatic animal is a crustacean aquatic animal.
[0009] Preferably, the crustacean aquatic animal is Procambarus clarkii.
[0010] Preferably, the dosage of the drug for preventing or treating white spot syndrome in aquatic animals is 25 to 50 mg per kg of aquatic animals.
[0011] According to another aspect of the present invention, a drug for preventing or treating white spot syndrome in aquatic animals is provided, comprising an active ingredient, wherein the active ingredient is at least one of atractylodesin and atractylodesin derivatives.
[0012] Preferably, a pharmaceutically acceptable carrier is also included. Those skilled in the art will readily appreciate that, based on the fact that atractylodesin can be used to prevent and treat white spot syndrome in aquatic animals, the drug can be formulated into a preparation or vaccine convenient for use in aquaculture by combining it with a pharmaceutically acceptable carrier or adjuvant. The present invention does not limit the pharmaceutically acceptable carrier or adjuvant.
[0013] Preferably, the drug for preventing or treating white spot syndrome in aquatic animals is an injection.
[0014] Compared with the prior art, the present invention has the following beneficial effects or advantages:
[0015] The present invention verifies and reveals for the first time the biological activity of atractylodesin against white spot syndrome virus. In animal experimental studies, it was found that atractylodesin can significantly inhibit the replication of white spot syndrome virus in the body of Procambarus clarkii, and at the same time improve the survival rate of Procambarus clarkii infected with white spot syndrome virus. Atractylodesin has a good anti-white spot syndrome virus effect in crustacean aquaculture, so atractylodesin can be used to prevent and treat aquatic animal diseases caused by white spot syndrome virus. At the same time, as a natural active ingredient, atractylodesin has the characteristics of low toxicity, low residue, low cost, and green safety. The use of its biological activity to prevent and treat white spot syndrome virus that harms crustacean aquaculture provides a new path for the development and research of green biological agents for aquaculture, and expands the new use of atractylodesin. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 The chemical structure diagram of atractylodesin;
[0017] Figure 2 This is the absolute quantitative standard curve of WSSV virus;
[0018] Figure 3 is the inhibition rate of WSSV virus at different atractylodesin concentrations;
[0019] Figure 4 The survival rate of Procambarus clarkii affected by different atractylodesin concentrations. DETAILED DESCRIPTION
[0020] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.
[0021] Unless otherwise specified, the experimental materials and reagents used in the following examples can be obtained from commercial sources.
[0022] White spot syndrome virus was provided by the Third Institute of Oceanography, State Oceanic Administration and preserved by the Aquatic Disease Laboratory of Northwest Agriculture and Forestry University.
[0023] Atractylodin (CAS: 55290-63-6) was purchased from Shanghai MacLean Biochemical Technology Co., Ltd. Its structural formula is as follows: Figure 1 shown.
[0024] The experimental animals were Procambarus clarkii, which were purchased from the Xianyang Aquarium Market in Shaanxi Province.
[0025] White spot syndrome virus envelope protein VP28 gene primers:
[0026] Upstream primer (VP28-F) AAACCTCCGCATTCCTGTGA
[0027] Downstream primer (VP28-R) TCCGCATCTTCTTCCTTCAT
[0028] Example 1
[0029] In this example, the safe concentration of atractylodesin for Procambarus clarkii was investigated.
[0030] Experimental methods:
[0031] (1) Preparation of atractylodesin solution: Dissolve atractylodesin in chromatographic grade dimethylsulfoxide (DMSO) to prepare a standard solution with a concentration of 100 mg / mL, and then dilute it with DMSO to different concentrations of 10, 20, 50, and 80 mg / mL; filter it with a 0.22 μm organic syringe filter and transfer it to a brown chromatographic bottle for use as a standard diluent.
[0032] (2) Healthy crayfish were randomly selected and divided into four groups of 10 each. They were placed in plastic boxes at a water temperature of 26°C for experimental treatment. The experiment set up a blank control group and a drug treatment group: the blank control group was injected with TM buffer only, i.e., a buffer containing 100mM Tris-HCl, 10mM MgCl2, pH 7.5; the drug treatment group was injected with different concentrations of atractylodesin (80, 100, and 120mg / kg); the drug injection volume was 100μL / crayfish. After injection, the survival status of the shrimp was observed and recorded for 72 hours.
[0033] Experimental results: Within 72 hours of injection, crayfish in the treatment group showed no significant changes in response to atractylodesin at concentrations of 80-120 mg / kg, and showed no symptoms. Therefore, the safe concentration of atractylodesin was determined to be higher than 120 mg / kg, and subsequent experiments were conducted on crayfish at concentrations lower than 120 mg / kg.
[0034] Example 2
[0035] In this example, the activity of atractylodesin against white spot syndrome virus was tested.
[0036] Experimental methods:
[0037] This example was conducted in a 25°C aquaculture water body. Healthy crayfish were selected and randomly divided into 7 treatment groups. A blank control group, numbered control group 1, was set up, i.e., the treatment group injected with only TM buffer; a WSSV treatment group, numbered control group 2, was set up, i.e., the treatment group injected with a mixture of TM buffer and WSSV virus. The virus dosage per shrimp was 6.9×10 7 copies; a co-treatment group of atractylodesin and WSSV was set up, among which the treatment group with atractylodesin injection concentration of 15 mg / kg was numbered as experimental group 1; the treatment group with atractylodesin injection concentration of 25 mg / kg was numbered as experimental group 2; the treatment group with atractylodesin injection concentration of 35 mg / kg was numbered as experimental group 3; the treatment group with atractylodesin injection concentration of 50 mg / kg was numbered as experimental group 4; the treatment group with atractylodesin injection concentration of 60 mg / kg was numbered as experimental group 5. The drug treatment method of experimental groups 1 to 5 is as follows: after WSSV virus and atractylodesin are evenly mixed at 25°C, they are immediately injected into the abdomen of the crayfish, and the virus dosage per shrimp is 6.9×10 7 copies.
[0038] Three replicates were set up in each group of 30 crayfish, with each shrimp injected with 100 μL of the treatment solution. Twenty-four hours after injection, gill tissues of five crayfish were randomly selected from each treatment group and stored at -80°C until later use.
[0039] The gill tissues collected from each group were used for absolute quantification of WSSV genomic DNA copy number using the following experimental methods:
[0040] (1) Use a marine animal tissue genomic DNA extraction kit to extract DNA from the collected tissue samples.
[0041] The specific operation of extracting DNA from Procambarus clarkii gill tissue is as follows:
[0042] S1. Dissolution: Weigh 15 mg of Procambarus clarkii gill tissue, grind it, mix it with 200 μL of GA buffer, and vortex it until evenly distributed. Then, add 20 μL of 20 mg / mL Proteinase K solution, vortex it again to mix evenly, and incubate it at 56°C until the tissue is completely dissolved to obtain a mixed solution.
[0043] S2. Thoroughly mix the mixture with 200 μL of Buffer GB and incubate at 70°C until the solution becomes clear. Then, add 200 μL of anhydrous ethanol and mix thoroughly until a precipitate forms. Add both the solution and precipitate to adsorption column CB3 and centrifuge at 12,000 rpm for 30 seconds. Discard the supernatant.
[0044] S3. Wash: Wash the precipitate with 500 μL of Buffer GD and then 600 μL of Rinse Buffer PW by centrifugation. Place the 600 μL of Rinse Buffer PW and the washed precipitate into Adsorption Column CB3 and centrifuge at 12,000 rpm for 2 minutes. Discard the supernatant and allow the Adsorption Column CB3 to stand at room temperature to completely dry any residual rinse buffer from the precipitate.
[0045] S4. Elution: Transfer the adsorption column CB3 to a clean centrifuge tube. Add 50 μL of double-distilled water (ddHO) as elution buffer to the adsorption membrane. Incubate at room temperature for 2–5 minutes. Centrifuge at 12,000 rpm for 2 minutes. Collect the solution into a centrifuge tube. Repeat the elution process of adding ddHO, incubating at room temperature, and centrifuging. The resulting solution contains the DNA product, which should be stored at 20°C until further use.
[0046] (2) Absolute fluorescence quantitative PCR was used to detect the viral genome copy number in the gill tissue of the treated samples.
[0047] The specific operation of PCR quantitative detection is as follows: real-time PCR quantitative detection is performed using a fluorescent quantitative PCR instrument CFX-96, and the quantitative kit is AceQ produced by Vazyme. qPCR SYBR The reaction program was preheating at 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.
[0048] (3) Use an ultra-micro spectrophotometer to detect the concentration and purity of the extracted DNA, and then adjust the DNA concentration to 50 ng / μL.
[0049] (4) The viral copy number in the tissue was quantified by RT-qPCR and the constructed absolute quantitative standard curve. The qRTPCR reaction system was 10 μL, including 1 μL DNA template, 5 μL ChamQ SYBR qPCR Master Mix, 3 μL nuclease-free water, and 0.5 μL of the upstream and downstream primers of the white spot syndrome virus envelope protein VP28 gene primers.
[0050] Experimental results: The constructed absolute quantitative standard curve is as follows Figure 2 The copy numbers of WSSV detected in different groups of crayfish are shown in Table 1.
[0051] The experimental results of control groups 1-2 and experimental groups 1-5 in Table 1 show that atractylodesin can inhibit the replication of white spot syndrome virus (WSSV) in crayfish, thereby reducing the concentration of WSSV and effectively reducing the transmission and incidence of white spot syndrome. Comparing the virus inhibition rates of experimental groups 1-5, it can be seen that the virus inhibition rates in the corresponding crayfish in experimental groups 2-4 are higher, indicating that atractylodesin injection concentrations between 25 and 50 mg / kg can significantly reduce the copy number of WSSV in crayfish and has good anti-WSSV biological activity. Among them, the treatment group with the highest WSSV virus inhibition rate was experimental group 4, that is, the atractylodesin injection concentration of 50 mg / kg had the best anti-WSSV activity.
[0052] The inhibition rate in experimental group 1 was small, indicating that the concentration of atractylodesin was small and the anti-WSSV activity was weak; the virus inhibition rate in experimental group 5 was similar to that in experimental group 4, with no significant difference, indicating that when the concentration of atractylodesin was greater than 50 mg / kg, further increasing the concentration of atractylodesin had little effect on the WSSV virus inhibition rate. Comparing the virus inhibition rates in the crayfish in control group 1 (i.e., blank control group), experimental group 2 (i.e., injection concentration of atractylodesin was 25 mg / kg) and experimental group 4 (i.e., injection concentration of atractylodesin was 50 mg / kg), the results showed that the virus inhibition rate in the crayfish in group 5 was similar to that in group 4, with no significant difference. Figure 3 It can be found that the virus inhibition rate of experimental group 4 is greater than that of experimental group 2, indicating that the injection of a 50 mg / kg atractylodesin concentration solution is more effective in preventing or treating white spot syndrome in aquatic animals than the injection of a 25 mg / kg atractylodesin concentration solution.
[0053] Table 1. Inhibition rate of WSSV virus in different groups of Procambarus clarkii
[0054]
[0055] The virus inhibition rate was calculated as follows: virus inhibition rate (%) = (virus concentration of control group 2 24 hours after injection - virus concentration of experimental group 24 hours after injection) / virus concentration of control group 2 24 hours after injection × 100%.
[0056] Example 3
[0057] In this example, the effect of atractylodesin concentration on the survival rate of Procambarus clarkii infected with white spot syndrome virus was investigated.
[0058] Experimental methods:
[0059] According to the grouping method of Example 2, healthy Procambarus clarkii were randomly divided into 7 treatment groups, with 100 Procambarus clarkii in each group, namely control group 1, control group 2, experimental group 1, experimental group 2, experimental group 3, experimental group 4, and experimental group 5.
[0060] The treatment methods of each group were strictly consistent with those of the treatment groups in Example 2: the treatment group injected with only TM buffer was set as the blank control group, numbered as control group 1; the WSSV treatment group was set as the positive control group, numbered as control group 2, that is, the treatment group injected with a mixture of TM buffer and WSSV virus, and the virus dosage per shrimp was 6.9×10 7 copies; a co-treatment group of atractylodesin and WSSV was set up, among which the treatment group with atractylodesin injection concentration of 15 mg / kg was numbered as experimental group 1; the treatment group with atractylodesin injection concentration of 25 mg / kg was numbered as experimental group 2; the treatment group with atractylodesin injection concentration of 35 mg / kg was numbered as experimental group 3; the treatment group with atractylodesin injection concentration of 50 mg / kg was numbered as experimental group 4; the treatment group with atractylodesin injection concentration of 60 mg / kg was numbered as experimental group 5. The drug treatment method of experimental groups 1 to 5 is as follows: after WSSV virus and atractylodesin are evenly mixed at 25°C, they are immediately injected into the abdomen of the crayfish, and the virus dosage per shrimp is 6.9×10 7 copies.
[0061] Each group of crayfish was observed daily and the mortality was recorded. The survival rate was calculated as follows: survival rate (%) = number of survivors in the treatment group / total number in each group × 100%.
[0062] Experimental results: The survival rates of different groups of crayfish on the 8th day are shown in Table 2.
[0063] The experimental results for control groups 1-2 and experimental groups 1-5 in Table 2 show that experimental groups 1-5 had higher survival rates than control group 2, indicating that atractylodesin significantly reduced mortality in crayfish infected with WSSV. During the experiment, no or only a small number of crayfish died in control group 1, which was treated with TM buffer alone. However, in control group 2, which was treated with WSSV, a large number of crayfish died, with a survival rate of only 8% on day 8.
[0064] Comparing the survival rates of experimental groups 1 to 5, it can be seen that the virus inhibition rate in the corresponding crayfish in experimental groups 2 to 4 is higher, indicating that the injection concentration of atractylodesin between 25 and 50 mg / kg can significantly improve the survival rate of crayfish infected with WSSV. Figure 4 In the study, the daily survival rates of Procambarus clarkii in control group 1 (blank control group), control group 2 (positive control group), experimental group 2 (injection concentration of atractylodesin was 25 mg / kg), and experimental group 4 (injection concentration of atractylodesin was 50 mg / kg) were compared. It was found that the daily survival rate of experimental group 4 was greater than that of experimental group 2, indicating that the injection of a 50 mg / kg atractylodesin solution is more effective in preventing or treating white spot syndrome in aquatic animals than the injection of a 25 mg / kg atractylodesin solution. Among them, the treatment group with the highest survival rate was experimental group 4, that is, when the atractylodesin injection concentration in the solution was 50 mg / kg, it had the best survival rate, reaching 47% on the 8th day.
[0065] Table 2. 8-day survival rate of different groups of Procambarus clarkii
[0066] Group Virus injection concentration (copies) Atractylodesin injection concentration (mg / kg) 8-day survival rate (%) Control group 1 0 0 97 Control group 2 <![CDATA[6.9×10 7 ]]> 0 8 Experimental Group 1 <![CDATA[6.9×10 7 ]]> 15 14 Experimental Group 2 <![CDATA[6.9×10 7 ]]> 25 28 Experimental Group 3 <![CDATA[6.9×10 7 ]]> 35 36 Experimental Group 4 6.9 x 10 7 ]] 50 47 Experimental Group 5 <![CDATA[6.9×10 7 ]]> 60 44
[0067] In summary, the results of the examples of the present invention fully demonstrate that atractylodesin can inhibit WSSV replication in Procambarus clarkii by significantly reducing the expression of WSSV replication-related genes, thereby improving the survival rate of virus-infected hosts. This study provides a theoretical basis for the development of atractylodesin as a highly effective and practical anti-WSSV drug and provides an important reference for the study of atractylodesin's antiviral effects against other aquatic animal viruses.
[0068] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A method for preparing a drug for preventing or treating white spot syndrome in aquatic animals, characterized in that: The aquatic animal is Procambarus clarkii.
2. The use according to claim 1, characterized in that The dosage of the drug is 25-50 mg per kg of aquatic animals.
Citation Information
Patent Citations
Application of atractylodin in pharmacy
CN106727487A