Fermenting cyclosporin a producing strain of fusarium solani and its use
The strain FIM-CS-66-69 of Fusarium solanum was screened using atmospheric pressure and room temperature plasma mutagenesis technology, and the fermentation conditions were optimized. This solved the problem of unsatisfactory fermentation performance of cyclosporine A, and achieved efficient, stable, high-yield and high-purity fermentation, which is suitable for industrial production.
Patent Information
- Application Number
- CN202310570938.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-19
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2043-05-19
AI Technical Summary
The performance of cyclosporin A fermentation strains in the existing technology is not ideal, resulting in insufficient market competitiveness, and traditional breeding methods are difficult to obtain efficient, stable and high-yielding strains.
The strain of Fusarium solani FIM-CS-66-69 was screened using atmospheric pressure and room temperature plasma mutagenesis. The fermentation medium and conditions, including the ratio of corn starch, glucose, casein and other components, were optimized, and the rotation speed and temperature were controlled for fermentation culture.
The Fusarium solani strain FIM-CS-66-69 can efficiently ferment cyclosporin A with a yield of 16551 μg/mL, high purity, and good stability, making it suitable for industrial production.
Smart Images

Figure CN116445298B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial fermentation, and particularly relates to a Fusarium solani strain capable of producing cyclosporin A through fermentation, and further discloses an application of the strain in producing cyclosporin A through fermentation. Background Art
[0002] Cyclosporin A (CsA) is a cyclic peptide immunosuppressant composed of 11 amino acids produced by fungal fermentation. Currently, it is widely used clinically to combat organ transplant rejection, primarily in liver, kidney, and heart transplants. It can be used with corticosteroids and is also used to treat some immune diseases.
[0003] Reportedly, CsA-producing bacteria primarily include Trichoderma polyporus, Cylinderia glabra, Fusarium solani, Beauveria bassiana, and Neoerythrostomia invasives from the Ascomycetes. In 1983, the Fujian Institute of Microbiology first reported the isolation of Fusarium solani 4-11, a cyclosporin A-producing fungus, from domestic soil. The strain entered industrial production and was the first in China to successfully develop cyclosporin A. However, this product suffered from unstable fermentation levels and relatively low component content, resulting in limited market competitiveness. With the increasing use of immunosuppressants such as mycophenolate mofetil and tacrolimus, the market price of CsA has continued to decline, intensifying market competition.
[0004] At present, the breeding technology for improving cyclosporin A fermentation strains mainly adopts traditional breeding methods such as ultraviolet mutagenesis combined with different mutagens and protoplast fusion technology, and has achieved certain results. For example, Wei Jun et al. used a UV and NTG combined mutagenesis method to obtain a cyclosporin A-producing Fusarium solani mutant strain FS-un26, whose cyclosporin production was 1931 μg / mL, 20.6% higher than the starting strain; Deng Lixin et al. screened a high-yielding strain of cyclosporin A-producing Fusarium solani 421502 by protoplast fusion and laser mutagenesis, and the titer was about 950 μg / mL; Chinese patent CN1570130 (CN1219889C) discloses a method for producing cyclosporin A by fermentation of Fusarium solani ATCC46829, and the fermentation level of the strain was 2023 μg / mL; Wu Hui et al. used protoplast fusion and UV mutagenesis on Fusarium solani S-4-H, and the fermentation capacity of the mutated strain was only about 3000 μg / mL; Zhou Li et al. UV mutagenesis screening of strain A19-12 resulted in the identification of a relatively genetically stable mutant strain, CsA-12, which achieved a titer of 3300 μg / mL after 7 days of fermentation. In 2014, Yan Tongshun et al. studied the fermentation of cyclosporin A using a fructose fed-batch batch fermentation method, achieving a cyclosporin A yield of 6000 μg / mL after 10 days of fermentation. In 2021, Liu Yu et al. optimized the fermentation conditions for high-yield cyclosporin A production by Beauveria bassiana. By adding precursor amino acids and feeding glucose during fermentation, they achieved a tank titer of 15414 μg / mL after 10 days of fermentation. While this significantly improved the product titer, it was also associated with the high costs of fructose and amino acids. Furthermore, the conversion from simple batch fermentation to fed-batch fermentation resulted in complex production operations and high labor costs, making it unsuitable for industrial production. Thus, while UV mutagenesis combined with different mutagens and fermentation process optimization has achieved some success, improving the cyclosporin production capacity of strains, it is generally not ideal. This is mainly because the complexity and multi-node nature of the metabolic network in microorganisms make it difficult to obtain excellent industrial production strains in the complex system that produces secondary metabolites.
[0005] Atmospheric pressure room temperature plasma breeding (ARTP) is a technique for rapid mutation of microbial genomes. The plasma it produces is rich in chemically active particles, which damage the genetic material of the strain cells, causing changes in cell membrane permeability and protein structure. This triggers the cells' SOS repair mechanism, generating a rich variety of mismatch sites during the repair process, resulting in a high mutation rate. ARTP has been successfully applied in the selection and breeding of various industrial microbial strains. Therefore, practitioners are eager to obtain a strain that is suitable for industrial production and can efficiently produce cyclosporin A. Summary of the Invention
[0006] Therefore, the technical problem to be solved by the present invention is to provide a strain of Fusarium solani that can produce cyclosporin A by fermentation, so as to solve the problem that the performance of the fermentation strain of cyclosporin A in the prior art is not ideal;
[0007] The second technical problem to be solved by the present invention is to provide an application of the above-mentioned Fusarium solani strain in producing cyclosporin A through fermentation.
[0008] In order to solve the above technical problems, the present invention discloses a Fusarium solani strain, which is classified and named Fusarium solani FIM-CS-66-69, and has been deposited in the Guangdong Provincial Microbiological Culture Collection Center with a deposit number of GDMCC No. 63322 and a deposit date of April 4, 2023. The deposit address is 5th Floor, Dayuanyuan Experimental Building, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province.
[0009] The invention also discloses application of the Fusarium solani strain in fermentation production of cyclosporin A.
[0010] The present invention also discloses a method for producing cyclosporin A by fermentation, which comprises inoculating the Fusarium solani strain into a suitable fermentation medium for fermentation culture.
[0011] Specifically, in the method for producing cyclosporin A by fermentation, the fermentation medium comprises the following components by weight: 3.0-6.5wt% corn starch, 0.2-1.5wt% glucose, 0.2-1.5wt% casein, 0.2-0.8wt% yeast powder, 0.02-0.2wt% potassium chloride, 0.02-0.2wt% magnesium sulfate, 0.01-0.03wt% potassium dihydrogen phosphate, 0.1-0.8wt% calcium carbonate, and a natural pH.
[0012] Preferably, the fermentation medium comprises the following components by mass: 3.5wt% corn starch, 0.5wt% glucose, 0.5wt% casein, 0.5wt% yeast powder, 0.05wt% potassium chloride, 0.05wt% magnesium sulfate, 0.02wt% potassium dihydrogen phosphate, 0.3wt% calcium carbonate, and natural pH.
[0013] Specifically, in the method for producing cyclosporin A by fermentation, the fermentation culture conditions include: controlling the rotation speed to 100-250 rpm and carrying out the fermentation culture at 25-29° C. for 68-146 hours.
[0014] Specifically, the fermentation method for producing cyclosporin A further comprises inoculating the Fusarium solani strain into a seed culture medium for seed liquid culture;
[0015] The seed culture medium comprises the following components by weight: 1.0-4.0 wt% of corn starch, 0.1-0.5 wt% of casein, 1.0-5.5 wt% of glucose, 0.02-0.2 wt% of potassium chloride, 0.02-0.2 wt% of sodium nitrate, 0.001-0.05 wt% of magnesium sulfate, 0.05-0.8 wt% of potassium dihydrogen phosphate, and a pH value of 5.4-5.8.
[0016] Preferably, the seed culture medium comprises the following components in mass content: 2.0wt% corn starch, 0.3t% casein, 1.2wt% glucose, 0.05wt% potassium chloride, 0.05wt% sodium nitrate, 0.005wt% magnesium sulfate, 0.2wt% potassium dihydrogen phosphate, pH 5.4-5.8.
[0017] Specifically, in the method for producing cyclosporin A by fermentation, the conditions for the seed liquid culture include: controlling the rotation speed to 100-250 rpm and culturing the seed liquid at 25-29° C. for 32-60 hours.
[0018] Specifically, the method for producing cyclosporin A by fermentation further comprises the step of inoculating the Fusarium solani strain into a slant culture medium for activation;
[0019] The slant culture medium is a PDA culture medium, which includes the following components by weight: 15-25 wt% of potato, 1-3 wt% of glucose, 1.5-2.5 wt% of agar, and has a natural pH.
[0020] Preferably, the slant culture medium is a PDA culture medium, comprising the following components by weight: 20 wt% potato, 2 wt% glucose, 2.0 wt% agar, and natural pH.
[0021] Specifically, in the method for producing cyclosporin A by fermentation, the conditions of the slant culture medium activation step include: constant temperature culture at 25-29° C. for 6-12 days.
[0022] The present invention screens a high-cyclosporin A-producing Fusarium solani FIM-CS-66-69 strain through atmospheric pressure and room temperature plasma mutagenesis technology. The strain is capable of fermenting high-yield cyclosporin A. In fermentation experiments, the titer of cyclosporin A produced by the Fusarium solani FIM-CS-66-69 is as high as 16551 μg / mL, significantly improving the yield of cyclosporin A. The strain also has a low homologue content, making it more suitable for industrial fermentation production. The screened strain FIM-CS-66-69 has excellent stability, and its cyclosporin A titer is substantially stable and maintained at a high level after four consecutive generations. The strain can be used as a production strain for further research and development. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:
[0024] Figure 1 This is the relationship curve between ARTP efflux time and lethality in the mutagenesis experiment;
[0025] Figure 2 Phylogenetic tree of the strain FIM-CS-66-69 described in the present invention. DETAILED DESCRIPTION
[0026] In the following embodiments of the present invention, the culture medium involved includes:
[0027] The separation plate culture medium and the slant culture medium comprise the following components by weight: 20 wt% potato, 2 wt% glucose, 2.0 wt% agar, the balance being distilled water, with a natural pH, and sterilized by high-pressure steam at 121° C. for 20 min.
[0028] The seed culture medium includes the following components by mass: 2.0wt% corn starch, 0.3t% casein, 1.2wt% glucose, 0.05wt% potassium chloride, 0.05wt% sodium nitrate, 0.005wt% magnesium sulfate, 0.2wt% potassium dihydrogen phosphate, pH 5.4-5.8, and is sterilized by high-pressure steam at 121°C for 30 minutes.
[0029] The fermentation medium includes the following components by mass: 3.5 wt% corn starch, 0.5 wt% glucose, 0.5 wt% casein, 0.5 wt% yeast powder, 0.05 wt% potassium chloride, 0.05 wt% magnesium sulfate, 0.02 wt% potassium dihydrogen phosphate, and 0.3 wt% calcium carbonate. The pH is natural and the medium is sterilized by high-pressure steam at 121° C. for 30 min.
[0030] In the following examples of the present invention, the cyclosporin A content was determined using high-performance liquid chromatography (HPLC). The method involved taking an appropriate amount of fermentation broth, adding 3 volumes of methanol, and extracting twice with ultrasonic vibration. The combined supernatants were filtered through a membrane to obtain the primary fermentation extract, which was then analyzed by HPLC. Chromatographic conditions included a C18 column (4.6 mm × 250 mm, 5 μm), a detection wavelength of 210 nm, a flow rate of 1 ml / min, a column temperature of 60°C, a mobile phase of methanol-ultrapure water (84:16), and an injection volume of 5 μL. Using a cyclosporin A standard as a reference, the titer was calculated based on the peak area of the sample divided by the peak area of the standard solution × the concentration of the standard solution × the dilution factor. The fermentation titer was the average of three replicates.
[0031] Example 1 Obtaining the mutagenic strain FIM-CS-66-69
[0032] The genetically stable Fusarium solani FIM-CS-66 strain was used as the starting strain and transferred to a slant culture medium. The spores were cultured in a constant temperature incubator at 26°C for 8-12 days. The spores on the slant culture medium were then washed with physiological saline, broken up with glass beads, and filtered through gauze to prepare 10 6 Spore suspension with a concentration of 100 μg / mL.
[0033] 10 μL of the prepared spore suspension was pipetted onto a circular iron sheet with a diameter of 1 cm, and placed in a normal-pressure room-temperature plasma mutagenesis system using helium as the working gas, a power supply of 110 W, and a working gas flow rate of 10 L / min. The treatment distance was 2 mm, and the treatment was performed for 5 s, 10 s, 20 s, 30 s, 40 s, 50 s, 60 s, 75 s, and 90 s, respectively. The treated spore suspension was gradiently diluted and plated to prepare a lethality curve, as shown in FIG. Figure 1 As shown. Figure 1 It can be seen that there is an obvious dose-effect relationship between the mutagenic treatment dose and the lethality of the strain FIM-CS-66. As the treatment time increases, the lethality gradually increases.
[0034] According to the above-mentioned lethality curve, a 40-second irradiation time of a lethal dose was selected, and a spore suspension of the strain FIM-CS-66 was subjected to plasma mutagenesis. The treated spore suspension was placed in a test tube containing physiological saline, and mixed evenly to obtain a mutagenized spore suspension for later use.
[0035] The spore suspensions obtained above were spread onto nystatin-containing plate cultures at nystatin concentrations of 12.5 mg / L, 25 mg / L, 50 mg / L, 100 mg / L, and 150 mg / L, respectively. After incubation at 28°C for 10 days, the growth of colonies on the different plates was observed, and the results are recorded as shown in Table 1. The minimum inhibitory concentration of nystatin corresponding to the lowest effective concentration in the plate culture medium where no colonies grew was considered the nystatin minimum inhibitory concentration. Based on Table 1, the minimum inhibitory concentration against nystatin was determined to be 100 mg / L.
[0036] Table 1 Effect of nystatin concentration on spore growth of strain FIM-CS-66
[0037] Nystatin (mg / L) 0 12.5 25 50 100 150 Colony growth +++ ++ + +- - -
[0038] Note:+++ means good colony growth;++ means good colony growth;+ means average colony growth;+- means little colony growth;- means no colony growth
[0039] The mutagenized spore suspension obtained above was diluted in a gradient manner, with dilutions of 10 -1 , 10 -2 , 10 -3 , 10-4 , 10 -5 , 10 -6 , select 10 -4 , 10 -5 , 10 -6 Three dilutions of spore suspension were spread on resistance separation plates containing 100 mg / L nystatin and cultured in the dark at 26°C for 6-10 days.
[0040] The single colony grown on the resistance plate was transferred to the slant culture medium and cultured for 6-10 days, then inoculated into the seed culture medium at an inoculum size of 0.2-0.5%, and cultured at 28°C and 230 r / min for 36-60 hours to obtain the seed liquid; the seed liquid was inoculated into the fermentation medium at an inoculum size of 10%, and cultured at 26°C and 230 r / min for 4-7 days to obtain the fermentation liquid.
[0041] An appropriate amount of the resulting fermentation broth was added with 3 volumes of methanol, and ultrasonic extraction was performed twice. The supernatant and the extract were combined and filtered through a membrane to obtain the primary fermentation extract. The yield of cyclosporin A was determined by high-performance liquid chromatography, and the structure of the product in the fermentation broth of this example was confirmed to be correct.
[0042] By this method, the strain with the largest cyclosporin A production was screened out. For the convenience of description, the screened strain was named strain FIM-CS-66-69, and strain FIM-CS-66-69 was stored in glycerol.
[0043] Example 2 Identification of strain FIM-CS-66-69
[0044] Identification of physiological and biochemical characteristics
[0045] The obtained strain FIM-CS-66-69 was streaked on a separation medium plate and inserted into a coverslip. It was cultured at 26°C for 5-15 days. The morphological characteristics of single colonies and their hyphae were observed using optical microscopy, transmission electron microscopy and scanning electron microscopy.
[0046] The main morphological, physiological, and biochemical characteristics of the strain FIM-CS-66-69 are as follows: On plates, colonies are round, with a short, pubescent surface, and produce a soluble light green pigment. Mature colonies exhibit radial wrinkles, a raised center, and a dark yellow underside. Microscopic observation reveals elongated, branched stalks, producing two types of conidia of varying sizes. Large conidia are falcate, with three septa, and are attached to conidiophores or myxospores, measuring 22.5-37.5 μm by 3-4 μm. Small conidia are spindle-shaped to oval, with a single septum, and measuring 4.5-24 μm by 2.5-4 μm. This strain FIM-CS-66-69 is a highly aerobic bacterium. Dissolved oxygen has a significant effect on the production of cyclosporin A during fermentation. The optimal growth temperature is 25-29°C, and the optimal growth pH is 5.5-7.5. The cyclosporin A yield is highest when the shaker speed is 200-280 r / min and the culture is 4-7 days.
[0047] Molecular biology identification
[0048] The ITS sequence of strain FIM-CS-66-69 was sequenced, and the sequence obtained is shown in SEQ ID NO. 1. The ITS sequence of the strain was compared with the existing sequences in the GenBank database, and homology analysis was performed. The corresponding model strain ITS gene sequence was selected from the LPSN website (http: / / www.bacterio.cict.fr), and phylogenetic analysis was performed using CLUSTAL-X software. The generated alignment file was subjected to phylogenetic analysis using the neighbor-joining method of MEGA software. The topological analysis was the result of 1000 repeated samplings, see Appendix. Figure 2 ITS sequence analysis showed that the sequence homology between strain FIM-CS-66-69 and Fusarium solani was 99.79%.
[0049] SEQ ID NO.1:
[0050] TACCTAAAACGTTGCTTCGGCGGGAACAGACGGCCCTGTAACAACGGGCCGCCCCCGCAGAGGACCCCTAACTCTGTTTTTATAATGTTTTTCTGAGTAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCC CGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCAGAAGCCCCTGTGGGCACACGCCGTCCCTCAAATACAGTGGCGGTCCCGCCGCAGCTTCCATTGCGTAGTAGCTAACACCTCGCAACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTTCTGAATGTTGACCTCGAATCAGGTAGGAAT.
[0051] Based on the above morphological, physiological and biochemical characteristics and molecular biological identification, the strain FIM-CS-66-69 was finally determined to be Fusarium solani, and its classification name was Fusarium solani FIM-CS-66-69. It has been deposited in the Guangdong Provincial Microbiological Culture Collection, located at 5th Floor, Dayuan Experimental Building, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, with the deposit number GDMCC No. 63322 and the deposit date of April 4, 2023.
[0052] Example 3 Fermentation of Cyclosporin A by Starting Strain FIM-CS-66
[0053] Activation of the starting strain FIM-CS-66: The strain FIM-CS-66 preserved in glycerol was transferred to a slant culture medium and cultured in a constant temperature incubator at 26°C for 6-10 days.
[0054] Preparation of FIM-CS-66 seed solution: inoculate a single colony obtained by activating the above-mentioned strain FIM-CS-66 into a seed culture medium (100 mL of seed culture medium in a 500 mL Erlenmeyer flask), and culture at 28°C and 230 r / min for 46 h to obtain the seed solution.
[0055] Fermentation culture: The prepared seed liquid was inoculated into the fermentation medium (100 mL fermentation medium in a 500 mL Erlenmeyer flask) at a 10% (v / v) inoculation rate, and fermented at 26°C and 230 r / min for 120 h. The obtained fermentation liquid was then tested.
[0056] Test results showed that the yields of cyclosporin A in three shake flask fermentations were 3218 μg / mL, 3132 μg / mL, and 3166 μg / mL, respectively. Further analysis of the fermentation broths revealed cyclosporin A purities of 63.5%, 65.2%, and 61.8%, respectively.
[0057] Example 4 Fermentation of Cyclosporin A by Mutagenic Strain FIM-CS-66-69
[0058] Activation of strain FIM-CS-66-69: The strain FIM-CS-66-69 preserved in glycerol was transferred to a slant culture medium and cultured in a constant temperature incubator at 26°C for 6-10 days.
[0059] Prepare FIM-CS-66-69 seed solution: inoculate a 0.5 cm*0.5 cm bacterial moss obtained by activating the above-mentioned strain FIM-CS-66-69 into a seed culture medium (100 mL seed culture medium in a 500 mL Erlenmeyer flask), and culture at 28°C and 220 r / min for 46 hours to obtain the seed solution.
[0060] Fermentation culture: The prepared seed liquid was inoculated into the fermentation medium (100 mL fermentation medium in a 500 mL Erlenmeyer flask) at a 10% (v / v) inoculation rate, and fermented at 26°C and 230 r / min for 120 h. The obtained fermentation liquid was then tested.
[0061] Test results showed that the yields of cyclosporin A in three shake flask fermentations were 16,580 μg / mL, 16,660 μg / mL, and 16,551 μg / mL, respectively. Further analysis of the fermentation broths revealed cyclosporin A purities of 87.2%, 88.3%, and 86.1%, respectively.
[0062] It can be seen that the strain screened in the present invention can not only efficiently ferment cyclosporin A, but also has a higher purity of cyclosporin A in the fermentation broth and lower impact of by-products.
[0063] Example 5 Fermentation production of cyclosporin A by mutagenic strain FIM-CS-66-69
[0064] Shake flask seed culture: The above strain FIM-CS-66-69 was inoculated into a seed culture medium (280 mL of seed culture medium in a 1000 mL Erlenmeyer flask), and cultured at 26°C and 230 r / min for 46 h to obtain a shake flask seed solution.
[0065] Seed culture in seed tanks: inoculate 0.5% of the shake flask seed liquid into the seed culture medium (70L seed culture medium in a 100L tank), and culture for 43 hours at a culture temperature of 28°C, a tank pressure of 0.05MPa, an air flow rate of 1:1vvm, and a stirring speed of 100-200r / min to obtain the seed liquid in the seed tank.
[0066] Fermentation culture in a fermenter: inoculate the prepared seed liquid into a fermentation medium (700 L fermentation medium in a 1-ton tank) at a 10% (v / v) inoculation rate, culture at a temperature of 26°C, a tank pressure of 0.05 MPa, an air flow rate of 1:0.8-1.8 vvm, a stirring speed of 100-280 r / min, and control the dissolved oxygen to be not less than 30% during the process. Fermentation culture is carried out for 120 hours, and the obtained fermentation liquid is placed in the tank for detection.
[0067] Test results showed that the yields of cyclosporin A in the three fermentation batches were 16,633 μg / mL, 16,589 μg / mL, and 16,609 μg / mL, respectively. Further analysis of the fermentation broths revealed cyclosporin A purities of 90.1%, 87.5%, and 89.3%, respectively.
[0068] It is further proved that the strain screened by the present invention can not only efficiently ferment cyclosporin A, but also the purity of cyclosporin A in the fermentation broth is better.
[0069] Example 6 Verification of genetic stability of strain FIM-CS-66-69
[0070] The strain FIM-CS-66-69 with high cyclosporin A production screened and preserved above was cultured and subcultured continuously (F1, F2, F3, F4, F5), and the fermentation titer was determined after fermentation in 500 mL shake flasks. The well-grown primary strain (F0) was used as a control. The results are shown in Table 2 below.
[0071] Table 2 Effect of subculture on cyclosporin A production by strain FIM-CS-66-69
[0072] Strain generations F0 F1 F2 F3 F4 F5 Relative potency (%) 100 101.4 100.6 99.3 97.6 93.0
[0073] As shown in Table 2 above, the fourth generation of the strain FIM-CS-66-69 screened by the present invention had no significant effect on the fermentation level, and the cyclosporin A titer was essentially stable, remaining at a high level. This indicates that the strain FIM-CS-66-69 has good genetic stability. The target strain, i.e., the strain FIM-CS-66-69, produced a maximum cyclosporin A titer of no less than 16,551 μg / mL, and the purity of cyclosporin A in the fermentation broth was no less than 86%, effectively controlling the impurity content and further facilitating the downstream purification of cyclosporin A.
[0074] In summary, the mutant strain FIM-CS-66-69 (Fusarium solani) screened by the present invention can be used as a production strain for further research and development.
[0075] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.
Claims
1. A strain of Fusarium solani, which is classified as Fusarium solani The strain number is FIM-CS-66-69, and it has been deposited in Guangdong Provincial Microbiological Culture Collection Center with the deposit number GDMCC No.63322 and the deposit date is April 4, 2023.
2. Use of the Fusarium solani strain according to claim 1 in the fermentation production of cyclosporin A.
3. A method for producing cyclosporin A by fermentation, characterized in that: The method comprises inoculating the Fusarium solani strain according to claim 1 into a suitable fermentation medium for fermentation culture.
4. The method for producing cyclosporin A by fermentation according to claim 3, characterized in that: The fermentation medium includes the following components by weight: 3.0-6.5wt% corn starch, 0.2-1.5wt% glucose, 0.2-1.5wt% casein, 0.2-0.8wt% yeast powder, 0.02-0.2wt% potassium chloride, 0.02-0.2wt% magnesium sulfate, 0.01-0.03wt% potassium dihydrogen phosphate, 0.1-0.8wt% calcium carbonate, and natural pH.
5. The method for producing cyclosporin A by fermentation according to claim 4, characterized in that: The fermentation culture conditions include: controlling the rotation speed to 100-250 rpm and performing fermentation culture at 25-29° C. for 68-146 hours.
6. The method for producing cyclosporin A by fermentation according to any one of claims 3 to 5, characterized in that: The method further comprises inoculating the Fusarium solani strain according to claim 1 into a seed culture medium for seed liquid culture; The seed culture medium comprises the following components by weight: 1.0-4.0 wt% corn starch, 0.1-0.5 wt% casein, 1.0-5.5 wt% glucose, 0.02-0.2 wt% potassium chloride, 0.02-0.2 wt% sodium nitrate, 0.001-0.05 wt% magnesium sulfate, 0.05-0.8 wt% potassium dihydrogen phosphate, and a pH value of 5.4-5.
8.
7. The method for producing cyclosporin A by fermentation according to claim 6, characterized in that: The conditions for the seed liquid culture include: controlling the rotation speed to 100-250 rpm and carrying out the seed liquid culture at 25-29° C. for 36-60 hours.
8. The method for producing cyclosporin A by fermentation according to any one of claims 3 to 5, characterized in that: The method further comprises the step of inoculating the Fusarium solani strain according to claim 1 into a slant culture medium for activation; The slant culture medium is a PDA culture medium, which includes the following components by weight: 15-25 wt% potato, 1-3 wt% glucose, 1.5-2.5 wt% agar, and a natural pH.
9. The method for producing cyclosporin A by fermentation according to claim 8, characterized in that: The conditions of the slant culture medium activation step include: constant temperature culture at 25-29° C. for 6-10 days.
Citation Information
Patent Citations
Cyclosporins A fermentation production method
CN1219889C
Compound mutation of immunosuppressive agent microbial strains
CN102676495A
Process for the isolation of pharmaceutical compound cyclosporin a from fungus fusarium nivale
US20030186856A1